ID: 1152381067

View in Genome Browser
Species Human (GRCh38)
Location 17:79942473-79942495
Sequence CGGGCTGCTGCTGCTCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152381054_1152381067 26 Left 1152381054 17:79942424-79942446 CCCAGGCTGCTGTGACATCCAGA 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG 0: 1
1: 0
2: 4
3: 35
4: 412
1152381059_1152381067 8 Left 1152381059 17:79942442-79942464 CCAGAGGGGACGATGCTGAGCTC 0: 1
1: 0
2: 2
3: 10
4: 98
Right 1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG 0: 1
1: 0
2: 4
3: 35
4: 412
1152381055_1152381067 25 Left 1152381055 17:79942425-79942447 CCAGGCTGCTGTGACATCCAGAG 0: 1
1: 0
2: 3
3: 23
4: 274
Right 1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG 0: 1
1: 0
2: 4
3: 35
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152381067 Original CRISPR CGGGCTGCTGCTGCTCTCCT GGG Intronic
900532682 1:3162454-3162476 GGGCCTGCTGCAGCTCTCTTGGG - Intronic
900544427 1:3220562-3220584 CAGGCTGCTGTGGTTCTCCTTGG + Intronic
900574434 1:3376060-3376082 CGGGATGCTGTGGCGCTCCTGGG - Intronic
900595528 1:3478583-3478605 GGAGCAGCTCCTGCTCTCCTCGG + Exonic
900671771 1:3858804-3858826 CGAGCTGGTGCTGCTCACCTTGG + Exonic
900742849 1:4341222-4341244 CAGGCTGGTGTTGATCTCCTGGG + Intergenic
900899874 1:5509149-5509171 CTGGCTGCTGTTGCTGTCCCAGG - Intergenic
901104366 1:6743764-6743786 CTTGCTGCTGCCTCTCTCCTGGG + Intergenic
901179484 1:7331334-7331356 AGGGCTGCTGCTGCCCTCAGGGG - Intronic
901443100 1:9291628-9291650 CGGGCTGCTCTTGAACTCCTGGG + Intergenic
901495090 1:9616365-9616387 CAGGCTGCTGTTGAACTCCTGGG - Intergenic
901604736 1:10450244-10450266 CCTGCTGCTGCTGCTCTCCGGGG + Exonic
901827054 1:11869039-11869061 CTGGCTGCTGCTGTTTTCCCTGG + Intergenic
902853056 1:19176659-19176681 CCGGCGGCTGTTGCTGTCCTGGG + Exonic
902931811 1:19736674-19736696 AGGGCTGCTGCTCCTGGCCTTGG - Intronic
903036217 1:20494297-20494319 CGTGCTGCTGCTGCTGCCATTGG - Intergenic
904305629 1:29587077-29587099 CTGGCTGCTTCTGCTGACCTAGG + Intergenic
904809277 1:33152890-33152912 CAGGCTGCTCCTGGTGTCCTTGG + Intronic
904991634 1:34598074-34598096 GGGGGTGCTGCTGCTCCACTGGG - Intergenic
905811844 1:40918849-40918871 CAAGCTGCTGCTGCTCCTCTAGG + Intergenic
906114854 1:43349570-43349592 CCGCCTCCTGCTGCTCACCTCGG + Intronic
906243348 1:44256256-44256278 TGGGCTGTTGCTGTTCTGCTGGG - Intronic
907609577 1:55854750-55854772 CTGGCTGTTGCTCCCCTCCTAGG - Intergenic
909571752 1:77120428-77120450 CGGGCTGGTCCTGAACTCCTGGG + Intronic
911341957 1:96650318-96650340 AGGCCTGCTGCTGCTGTACTGGG - Intergenic
911664587 1:100539011-100539033 CTCGCTGCTGCTGCTCTGCGAGG + Exonic
911824710 1:102467078-102467100 CTGGCTTCTCCTTCTCTCCTTGG + Intergenic
912625233 1:111200654-111200676 CTGGCTTCTGCTGCCTTCCTGGG - Exonic
913259431 1:116985130-116985152 AGGGCTGCTGGTGCCCTTCTGGG - Intronic
914377796 1:147087855-147087877 CAGGCTGCTGTTGAACTCCTAGG + Intergenic
914667002 1:149840498-149840520 CGGGCTGCGGACGCTTTCCTGGG - Exonic
914668765 1:149853292-149853314 CGGGCTGCGGACGCTTTCCTGGG + Exonic
914874693 1:151504179-151504201 CAGGCTGCTCCTGAACTCCTGGG - Intergenic
914899209 1:151703065-151703087 CAGGCCCCTGCGGCTCTCCTGGG + Exonic
915017119 1:152744459-152744481 GGGGCTGCTGCAGCTCTGATTGG + Intronic
915367339 1:155323562-155323584 CGGGCAGCAGCTGCTCCTCTGGG - Intronic
915637325 1:157195814-157195836 TGGGCTGCTGCAGCTGGCCTGGG - Intergenic
915874667 1:159599873-159599895 CTGGCTGCTGGTTCTCTCCATGG + Intergenic
916609982 1:166382233-166382255 CAGGCTGGTCTTGCTCTCCTGGG + Intergenic
917224304 1:172765280-172765302 CGGGATGCTGCTGGGCTCATGGG + Intergenic
917369899 1:174281195-174281217 CGGGTTGCTGCTGCTGGCTTAGG + Intronic
918192745 1:182191893-182191915 CAGGCTGCAGCTGCTGTCTTGGG - Intergenic
918262509 1:182808742-182808764 CAGGCTGGTCCTGATCTCCTGGG - Intronic
919793913 1:201309714-201309736 CTGGCTGCAGCTGCTCTCTCGGG + Intronic
920500965 1:206485237-206485259 CAGGCTGCTCAGGCTCTCCTGGG - Exonic
921806378 1:219460051-219460073 GGGGTTGTTGCTGCTCTACTGGG - Intergenic
922532348 1:226354013-226354035 CGGGCTGGTCCTGGTGTCCTGGG + Intergenic
923040127 1:230313967-230313989 CGGGCAGTTGCAGCTCTCCTGGG + Intergenic
924742260 1:246801495-246801517 CGCGGTGCAGCTGCTCTCCAGGG + Intergenic
1063134579 10:3205757-3205779 GGGGCTGCCGCTGCTGCCCTAGG - Intergenic
1063238600 10:4145252-4145274 CGTGCTGCTGTTTCTCTCCAAGG + Intergenic
1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG + Intronic
1064600701 10:16989804-16989826 AGGGCTGCCGCTGCTCTTCAAGG - Intronic
1064744921 10:18469035-18469057 CAGGCTGCTTTTGCACTCCTGGG - Intronic
1065557510 10:26931448-26931470 GGGGCTGCTGCTGGTATCCCTGG + Intergenic
1066171077 10:32847132-32847154 AGTGCTACTGCTGCTCTCCAAGG - Intronic
1066255015 10:33670271-33670293 CAGGCTGCTTTTGTTCTCCTGGG + Intergenic
1067249622 10:44575700-44575722 GGGGCTCCAGCTCCTCTCCTTGG - Intergenic
1068604173 10:58987326-58987348 GTGGCTGCTGCTGGTCTTCTGGG - Intergenic
1070682333 10:78457224-78457246 CAGGCTGCTGCAGCTGCCCTTGG + Intergenic
1070867009 10:79712763-79712785 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1070880799 10:79850884-79850906 GGGGCTGCTGCCTCTGTCCTCGG + Intergenic
1071291918 10:84194793-84194815 GGGGCTGCTGCGCCTCTGCTTGG + Exonic
1071633921 10:87234986-87235008 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1071647371 10:87367203-87367225 GGGGCTGCTGCCTCTGTCCTCGG + Intronic
1072362435 10:94673109-94673131 CGGGCAGCTGCTCATCTCATAGG + Intergenic
1072540429 10:96394290-96394312 AGGGCTGCTGCTGTGCTCCTGGG + Intronic
1073560626 10:104493480-104493502 CCTGCTGCTACTGCTGTCCTAGG - Intergenic
1076462379 10:130656004-130656026 CAGGCTGCTACTGCCCTCCCAGG + Intergenic
1076673868 10:132137685-132137707 CAGGGTCCTGCTGCTCTCCGGGG - Intronic
1076754857 10:132564097-132564119 GAGCCTGCTGCTGCTCCCCTGGG + Intronic
1076806052 10:132859311-132859333 TGGGCTGCCGCTGTTCTCCCCGG + Intronic
1077035969 11:494664-494686 CTTCCTGCTGCTGCTCTCCCTGG - Exonic
1077107338 11:847920-847942 CTGGCGGCGGATGCTCTCCTTGG + Intronic
1077393088 11:2308806-2308828 GGGGCAGCTGGTGCTCACCTGGG - Exonic
1078159937 11:8831649-8831671 CGGGCTGCTCTTGAACTCCTGGG - Intronic
1078915166 11:15771889-15771911 GGGTCTGCTTCTGCTCTCCTAGG - Intergenic
1079136938 11:17780741-17780763 CGGGCTGCCTCTCCTCTTCTAGG - Intronic
1079380427 11:19933233-19933255 GGAGCTGCTGCCGCTCTCCAAGG - Exonic
1080544816 11:33305940-33305962 CAGGCTGCTGTTGGACTCCTGGG + Intronic
1083614023 11:64017750-64017772 CGGTCGGCAGCTGCCCTCCTCGG + Intronic
1083765450 11:64839330-64839352 TGGCCTGCTGCTGCCCACCTGGG + Intronic
1083863754 11:65442227-65442249 CACGCTGCTGCTGTTCTCATGGG + Intergenic
1084146251 11:67266808-67266830 CGGGCAGCTTCTCCTCACCTGGG - Exonic
1084353211 11:68618506-68618528 CCGGCTGCTGCTTCCCTTCTCGG + Intergenic
1084553554 11:69863135-69863157 GGCGCTGCTGCTGCTCTCCTTGG - Intergenic
1084832643 11:71781724-71781746 CTTGCTGCTCCTGCTTTCCTGGG - Intergenic
1085046163 11:73354970-73354992 CTGGCTTCTCCTGATCTCCTAGG - Intronic
1085373426 11:76034407-76034429 CGGGCTGGTCCTGAACTCCTGGG + Intronic
1086873506 11:92067700-92067722 CAAGCTTCTTCTGCTCTCCTAGG + Intergenic
1087936239 11:104037155-104037177 TGCGCTGCTGCTGCTGTCCAGGG - Exonic
1087962183 11:104366013-104366035 CGGGTTGCTGCTGCTAGCTTGGG + Intergenic
1088454272 11:110017153-110017175 CAGGCTGCTGTTGAACTCCTGGG - Intergenic
1088495771 11:110430151-110430173 CGCGCCGCTTCTGCTGTCCTCGG + Exonic
1089074995 11:115731040-115731062 ATGGCTGCTGCTGGACTCCTTGG - Intergenic
1089476621 11:118768796-118768818 CGGGCTGGTGTTGAACTCCTGGG - Intronic
1090278774 11:125438547-125438569 GGGAATGCAGCTGCTCTCCTTGG + Intergenic
1090991364 11:131819832-131819854 CAGGGTGCTGCTGCTCTCATGGG - Intronic
1091203391 11:133800275-133800297 GGGCCTGCTCCTGCTCCCCTAGG - Intergenic
1092241257 12:6837727-6837749 TGCGCTGCTCTTGCTCTCCTAGG - Exonic
1092951506 12:13507788-13507810 CATGCTGCAGCTGTTCTCCTGGG - Intergenic
1094343254 12:29436923-29436945 CGGGTTGCTGCTGCTGGCCCCGG + Intronic
1095145406 12:38721098-38721120 CTGCCTCCTGCTGCTCTTCTTGG - Intronic
1095727416 12:45469165-45469187 ACGGCTGCGGCTGCCCTCCTAGG + Intergenic
1096417247 12:51424933-51424955 CGGGCTGCTGATGCTTGGCTTGG + Exonic
1100025471 12:90122494-90122516 GGGGATCCTGCTGCTCTGCTGGG + Intergenic
1102189281 12:110974385-110974407 CAGGCTGCTGTTGAACTCCTGGG - Intergenic
1102884068 12:116508501-116508523 CGGGGGGCTGCTGCGCTGCTCGG + Intergenic
1103276175 12:119713497-119713519 CAAGCTGCTGCTGGGCTCCTTGG + Exonic
1103553806 12:121753969-121753991 TGGGCTGCTGCTGCCCTGCCTGG + Intronic
1103706405 12:122876186-122876208 CGGGCTGCTGCTGTTACCCTGGG - Intronic
1103720990 12:122975347-122975369 GGCGCAGCTGCTGCTCGCCTCGG - Intronic
1103885583 12:124197812-124197834 AGGGCTCCCTCTGCTCTCCTTGG + Intronic
1104576008 12:129966427-129966449 CTGGCTGCTGCAGGCCTCCTGGG - Intergenic
1104965039 12:132505217-132505239 GCGGCCGCTGCTGGTCTCCTTGG + Intronic
1105476170 13:20729849-20729871 CGGGCTGTTGCTGCACCCCAGGG - Intronic
1111567596 13:90036215-90036237 CAGGCTGCTCTTGCACTCCTAGG + Intergenic
1112562838 13:100529127-100529149 CGGGCCACTTCTGCTCTTCTTGG - Intronic
1113360913 13:109630746-109630768 CGGGCTGGTCCTGTACTCCTGGG + Intergenic
1113670979 13:112175932-112175954 CGAGGTGCTGCCGCTGTCCTGGG - Intergenic
1113670998 13:112175992-112176014 CGCGGTGCTGCTGCTGTCCCGGG - Intergenic
1113671016 13:112176054-112176076 CGAGGTGCTGCCGCTATCCTGGG - Intergenic
1113671054 13:112176175-112176197 CGAGGTGCTGCCGCTATCCTGGG - Intergenic
1113671125 13:112176420-112176442 CGAGGTGCTGCCGCTGTCCTGGG - Intergenic
1113671144 13:112176480-112176502 CGAGGTGCTGCTGCTGTCCCAGG - Intergenic
1113671199 13:112176662-112176684 CGCGGTGCTGCTGCTGTCCCGGG - Intergenic
1113782348 13:112983842-112983864 CGTGCTGCAGCTGTTTTCCTTGG + Intronic
1113812343 13:113150272-113150294 CGGGGGGCTCCTCCTCTCCTAGG + Intergenic
1115185573 14:30684219-30684241 CAGGCTGCTGTTGAACTCCTGGG + Intronic
1119324421 14:73751372-73751394 GGGGCTGAAGCTGCTCTCCAGGG - Intronic
1120117108 14:80633014-80633036 CAGGCTGCTCTTGCACTCCTGGG - Intronic
1120749607 14:88185895-88185917 CCGGTTGTTGATGCTCTCCTGGG + Exonic
1121257427 14:92540897-92540919 ACAGCTGCTGCTGCTCTCCCAGG + Intronic
1122316416 14:100828191-100828213 CAGGTGGCTGCTGCACTCCTGGG + Intergenic
1122805320 14:104253488-104253510 CTGGCTGCAGCTGGTGTCCTGGG + Intergenic
1123172745 14:106389892-106389914 AGGGCTGGTGCTTCTCTCCCAGG + Intergenic
1124613045 15:31222206-31222228 CGGGCCCCTGCTTCTCTCTTTGG + Intergenic
1127308723 15:57732354-57732376 CAGGCTGGTGCTGAACTCCTGGG + Intronic
1127933097 15:63610661-63610683 CAGGCTGCTGCTCTGCTCCTGGG - Intronic
1128397835 15:67246902-67246924 CGGGTTGCTGCTGCTGGCTTGGG - Intronic
1129247992 15:74291657-74291679 CAGGCTGCAGCTGCTGTCCTTGG - Intronic
1129386012 15:75196412-75196434 CAGGCTACTGCTGGTGTCCTGGG + Intronic
1129653876 15:77510111-77510133 GGGGCTGCTGCTCCTGCCCTTGG + Intergenic
1129772643 15:78212677-78212699 GGGGCTGCTGTGGCTCTCCCGGG - Intronic
1129921400 15:79322248-79322270 CAGGCTGGAGCAGCTCTCCTAGG + Exonic
1130020495 15:80226664-80226686 CGGCCTTCTGCTGCTCTACTAGG + Intergenic
1131311260 15:91292475-91292497 CTGGCTGCTGCTTCTCTGGTTGG + Exonic
1131535166 15:93231411-93231433 GTGGCTGCTGCTGCTGTCATGGG + Intergenic
1131843393 15:96462954-96462976 TGGGTTGCTGCTGCCCTCTTTGG + Intergenic
1132399661 15:101497563-101497585 CGGCCGGCAGCTTCTCTCCTTGG + Intronic
1132515175 16:362839-362861 CGGGCCGCGGCTGCTCCCCCAGG + Intergenic
1132515191 16:362882-362904 CGGGCCGCGGCTGCTCCCCCAGG + Intergenic
1132515207 16:362925-362947 CGGGCCGCGGCTGCTCCCCCAGG + Intergenic
1132515223 16:362968-362990 CGGGCCGCGGCTGCTCCCCCAGG + Intergenic
1132600217 16:769764-769786 CCACCTGCGGCTGCTCTCCTGGG + Intronic
1132652298 16:1027011-1027033 CTGGCGGCTGCCGCTGTCCTGGG - Intergenic
1132750867 16:1457051-1457073 CGGCCCGCTGCTTCCCTCCTTGG - Intronic
1132809865 16:1792366-1792388 GGCGCTGCTGCTGCTGTCCTGGG - Exonic
1132829357 16:1919810-1919832 CGGGCTGCACCTGCTCATCTGGG + Intergenic
1132976538 16:2713906-2713928 GGGTCTGCTGCTGCTCCCCTCGG + Intronic
1133210408 16:4260437-4260459 CGGGCGCCTCCTGCTCACCTGGG + Exonic
1133351469 16:5103545-5103567 CTGGCTGCTCCTGGTTTCCTGGG + Intergenic
1135654370 16:24234797-24234819 CAGGCTGGTGCTGAACTCCTTGG + Intergenic
1135892838 16:26372966-26372988 CAAGCTCCTGCTGCTCTTCTTGG + Intergenic
1136293983 16:29291444-29291466 GGTGCTCCTGCTGCTGTCCTGGG + Intergenic
1136622663 16:31440661-31440683 GGGGCAGCAGCTGCGCTCCTGGG - Intronic
1137436071 16:48455284-48455306 CAGGCTGTTGCTGAACTCCTGGG + Intergenic
1137720580 16:50625301-50625323 CGGGCTCTGGCTGCCCTCCTGGG + Intronic
1138544478 16:57707492-57707514 CGGCCTGCGGGTGCACTCCTGGG + Exonic
1139929845 16:70517375-70517397 CGGGCTGGTCCTGAACTCCTGGG - Intronic
1141682230 16:85551396-85551418 AGGGGTGCTGCAGCTCCCCTGGG + Intergenic
1141882515 16:86869368-86869390 TGGGCTGGCGCTGGTCTCCTTGG - Intergenic
1141900809 16:86989068-86989090 AGTGCTGCTGCTGCTCTGCGGGG + Intergenic
1142033135 16:87848335-87848357 CGTGCTGCTGCTGCTGGGCTGGG + Intronic
1142068640 16:88077023-88077045 AGGGCTCCTGCTACTCCCCTGGG - Exonic
1142099887 16:88265490-88265512 GGTGCTCCTGCTGCTGTCCTGGG + Intergenic
1142163426 16:88570955-88570977 CGGGCTGCTGCTGGGCTCTTCGG + Intronic
1142262759 16:89050457-89050479 CGGGCTTCTCCCGCTCTGCTGGG - Intergenic
1142590708 17:1004547-1004569 GGAGCTGCATCTGCTCTCCTAGG + Exonic
1142738215 17:1915100-1915122 AGGGGTTCTGCTGTTCTCCTAGG - Intergenic
1142863279 17:2776410-2776432 CAGGCTGCTCCTTCTCTCCCCGG + Intergenic
1143587216 17:7856315-7856337 CCGCCTGCCGCTGCTCCCCTTGG + Intergenic
1144389511 17:14780334-14780356 CGGGCTGCACCTGCTGCCCTGGG + Intergenic
1144777964 17:17794295-17794317 CCAGCAGCTGCTGCTCTCCAAGG + Exonic
1145034719 17:19533223-19533245 CGCGCTGCTCCTGCCCTTCTGGG + Intronic
1145217213 17:21061339-21061361 TGGGCTGCTGCAGCTGTGCTTGG + Intergenic
1145302995 17:21653805-21653827 CTGGGTGCTGCTGTTCACCTGGG - Intergenic
1145347045 17:22048036-22048058 CTGGGTGCTGCTGTTCACCTGGG + Intergenic
1146421551 17:32691049-32691071 CGGGCTGGTGTTGAACTCCTGGG - Intronic
1146904497 17:36609224-36609246 CTGGCTCCTGCTGCTTTCCTGGG - Intergenic
1147120952 17:38334819-38334841 TGAGCTGCTGCTGCTGTGCTGGG - Exonic
1147155862 17:38544244-38544266 GGGGCAGCTGATGCCCTCCTTGG + Intronic
1147197560 17:38777800-38777822 CTAACTGCTGTTGCTCTCCTAGG - Exonic
1147232544 17:39029772-39029794 CTGGCTGCTCCTGCTCACCGGGG - Intergenic
1147922284 17:43925338-43925360 CTGGCTGCTGCTGCTCACTGAGG + Intergenic
1148437788 17:47696057-47696079 ACGGTTGCTCCTGCTCTCCTAGG + Exonic
1148441945 17:47716022-47716044 TGGGCTACTGCTGCCCTCCTAGG + Intergenic
1149029306 17:52065708-52065730 CAGGCCCCTGCTGCTCTCCAAGG + Intronic
1149833762 17:59893774-59893796 CGGCCTGTCGCTTCTCTCCTAGG + Intronic
1150693843 17:67387245-67387267 CCAGCCCCTGCTGCTCTCCTGGG + Intronic
1151683018 17:75631539-75631561 CCAGCTGCTGCTGCGCTCCAAGG + Exonic
1151781046 17:76245667-76245689 CAGGCTGGTGCTGAACTCCTGGG - Intergenic
1152133429 17:78490847-78490869 CGGGCTGCTGTCCCCCTCCTAGG - Exonic
1152189539 17:78880031-78880053 CCGGCTGCTGCTGCTCTCGGAGG + Intronic
1152198265 17:78930119-78930141 CGGGAGGATGCTGCTCTTCTCGG + Intergenic
1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG + Intronic
1152568561 17:81111289-81111311 CGGGCTGCAGCTGCTTGCCGGGG - Intronic
1152643134 17:81457474-81457496 AGGGCTGCTGCTGCACACCGGGG + Exonic
1152663154 17:81552274-81552296 CGGGCTTCTGCTGCCCTCTCGGG - Exonic
1152784668 17:82241540-82241562 AGGCCTGCAGCTGCCCTCCTGGG - Intronic
1152790061 17:82273863-82273885 CAGGCTCCTGCTGCTCTCGCGGG + Intergenic
1156117441 18:33802937-33802959 GGGACTGCTGCTCATCTCCTAGG + Intergenic
1156448392 18:37253376-37253398 CGGGCGGCTGCAGCTCTTCTGGG + Intronic
1158427436 18:57352626-57352648 CGGGGTCCCGCTGCTCTCCGGGG + Exonic
1158601970 18:58863629-58863651 GTGGCTGCTGCTGCTGTCGTCGG - Intronic
1160463936 18:79059821-79059843 ACGGCTGCAGCTGCTCCCCTCGG - Intergenic
1160763974 19:798907-798929 CGGCCGCCTCCTGCTCTCCTCGG + Intronic
1160792668 19:929724-929746 CGGGCTGCAGCTGCGGGCCTGGG + Exonic
1161268057 19:3374271-3374293 CCAGCTGCTGCTGCTCTCTTTGG + Intronic
1161426806 19:4208153-4208175 GGGTCTGCTTCTGCTTTCCTGGG + Intronic
1162035203 19:7934705-7934727 TGGGGTGCTGCGGCTCTCCTCGG - Intronic
1162809173 19:13153971-13153993 CGGGCGGCGGCTTCTCTCCACGG - Exonic
1163352976 19:16791019-16791041 CAGGCTGCTCCTGAGCTCCTGGG - Intronic
1163764160 19:19153125-19153147 AGCCCTGCTGCTGCTCTCGTGGG - Intronic
1164630789 19:29760280-29760302 CTGCCTCCTGCTGCCCTCCTTGG - Intergenic
1164826996 19:31291113-31291135 CAGGCTGCGGCTGCTCCTCTAGG + Intronic
1164993306 19:32700139-32700161 CGGGTTGCTGCTGCTGGCTTGGG + Intronic
1165193851 19:34085903-34085925 CGGGCTGGTGTTGACCTCCTAGG + Intergenic
1166011605 19:39946855-39946877 CAGGCTGGTCCTGATCTCCTGGG + Intergenic
1166617256 19:44261227-44261249 CAGGCTGCTGTTGAACTCCTGGG - Intronic
1166739673 19:45106194-45106216 CAGGCTCCTGCTGCTCTCCTCGG + Intronic
1168281247 19:55306522-55306544 CCTCCTGCTGCTGCACTCCTGGG - Intronic
926112835 2:10193758-10193780 GTGGCTGCTGCGGCTCTGCTGGG - Intronic
926122390 2:10251256-10251278 AGGGATGCTGCTGCTGTCCAGGG + Intergenic
927072818 2:19548205-19548227 GTGGCTGCTGCTGCCCTCCCAGG + Intergenic
927199188 2:20567970-20567992 GGGGCTGGAGCTGCCCTCCTAGG - Intronic
927790746 2:26007522-26007544 CAGGCTGCTCCTGAACTCCTAGG - Intergenic
927997201 2:27494758-27494780 CGGGGGGCAGCAGCTCTCCTGGG + Intronic
928722986 2:34141986-34142008 CGGGTTGTTGCTGCTGTCTTGGG + Intergenic
929188824 2:39121162-39121184 CGGGCTGTGGCTGCGCTCCTGGG + Intronic
929330038 2:40672240-40672262 CGGGTTGCTGCTGCTGGCTTGGG - Intergenic
929666571 2:43838501-43838523 CTTGCTGCTGCTGCTCCCCCAGG - Intronic
929951182 2:46410679-46410701 AGGCCTGCTTCTGCTCTCATGGG + Intergenic
932001722 2:67891342-67891364 AGGAATTCTGCTGCTCTCCTAGG + Intergenic
932885811 2:75548343-75548365 CTGGCTGGTGCTGAACTCCTGGG + Intronic
933890618 2:86765972-86765994 CGGGATGCTTGTGCCCTCCTGGG + Exonic
934528414 2:95068065-95068087 TGAGCTGAAGCTGCTCTCCTTGG + Intergenic
935226077 2:101054304-101054326 GAGCCTGCTGCTGGTCTCCTCGG + Exonic
936227682 2:110672728-110672750 TGGCATGCTGCAGCTCTCCTTGG + Exonic
937324882 2:120984670-120984692 CTGGCTGGTGCTGCTGGCCTCGG - Exonic
937338174 2:121074774-121074796 TGGGCTGATGATGCTCCCCTGGG + Intergenic
937363807 2:121246620-121246642 CAGGCTGCTGCTGCCCTGCTGGG - Intronic
937817677 2:126271285-126271307 GTGGCTGATGCTGCTTTCCTGGG + Intergenic
937984943 2:127634232-127634254 CAGGCTGCAGCTGGCCTCCTGGG + Exonic
938095022 2:128455936-128455958 AGAGCTGAAGCTGCTCTCCTGGG - Intergenic
938121377 2:128636607-128636629 AGGCCTGCTGCTGCTCTCCTTGG + Intergenic
938228092 2:129635127-129635149 CAGGCTGCTGCTGCAGTGCTGGG - Intergenic
939041167 2:137190911-137190933 CGGACTGCTGCGTGTCTCCTTGG + Intronic
939647382 2:144717296-144717318 CGGGTTTCTGCTGCTCTCCTGGG - Intergenic
944987008 2:205188672-205188694 CCTGCTGCTGCTGGTCACCTAGG - Intronic
946216099 2:218184826-218184848 CGGGCTGGTGTTGAACTCCTGGG - Intergenic
946713748 2:222532444-222532466 CGGGCTCCAGCTAGTCTCCTGGG + Intronic
947136929 2:226984899-226984921 CGCCCTTCTGATGCTCTCCTGGG + Intronic
947791193 2:232870368-232870390 GGCGCTGCTGCTGGTCTCCGGGG + Exonic
948528797 2:238589862-238589884 AGGGCTGCTCCTGGTTTCCTTGG - Intergenic
948788157 2:240363799-240363821 CGAGGTGCAGCTGCTGTCCTTGG - Intergenic
948873177 2:240813706-240813728 AGGGCTGCTGCTGCTCACCCCGG - Intronic
949004562 2:241637796-241637818 CGGGCTGCCGCGACTCGCCTCGG + Intronic
1168876279 20:1174349-1174371 GTGGCAGCTGCTGCTCTCCTGGG - Intronic
1170921413 20:20683186-20683208 TGGACTGCTTCTGCTCTCCACGG + Intronic
1171494771 20:25548174-25548196 GGGGGTTCTGCTGCACTCCTGGG + Intronic
1172991990 20:39043266-39043288 CAGCCAGCTCCTGCTCTCCTGGG - Intergenic
1175384170 20:58583699-58583721 CGCCCTGCTCCTGCTCCCCTGGG - Intergenic
1175806207 20:61830555-61830577 GGGGCCGCTGCAGATCTCCTGGG - Intronic
1175918561 20:62439103-62439125 CGGGCTGCGCCTCCTCTCCAAGG - Intergenic
1176184382 20:63770251-63770273 TGGGCTGGCGCTGATCTCCTGGG - Intronic
1176511482 21:7751778-7751800 CAGGCTGGTGCTGAACTCCTGGG - Intronic
1177894631 21:26844831-26844853 CACGCTGCTGCTGCTCGCCGCGG - Exonic
1178645596 21:34382307-34382329 CAGGCTGGTGCTGAACTCCTGGG - Intronic
1179124267 21:38577556-38577578 CAGGCTCCTGGTGCTCTCGTGGG + Intronic
1179135345 21:38675628-38675650 CGGGCTGCTGCTGCCCTTGCCGG - Intergenic
1179776889 21:43670365-43670387 AGCGCTACTGCTGCTCTCCATGG - Intronic
1180590475 22:16932970-16932992 AGGGCTGCTGATGCTCTGCTTGG - Intergenic
1180797236 22:18611804-18611826 TGGGCTGCTGCTCCTGTACTTGG + Exonic
1181224487 22:21383467-21383489 TGGGCTGCTGCTCCTGTACTTGG - Exonic
1181254145 22:21551346-21551368 TGGGCTGCTGCTCCTGTACTTGG + Exonic
1182813781 22:33139982-33140004 AGGGCTGCCTCTGGTCTCCTTGG + Intergenic
1183452776 22:37905994-37906016 CGGGCTCCCGCTGCTCCACTGGG - Intronic
1183630203 22:39027898-39027920 CGGGCTGGTGCTCCCCGCCTTGG + Intronic
1184094825 22:42310882-42310904 CTGCCTGCCGCTGCTCTGCTGGG - Intronic
1184224546 22:43121669-43121691 AGGGCTGGAGCTGCTTTCCTAGG + Intronic
1184657366 22:45948497-45948519 CCGGCAGCTGCGGCTCTGCTCGG + Intronic
1185063364 22:48618677-48618699 CGGGCCCTTGCTGCTCTGCTGGG + Intronic
1185231694 22:49687503-49687525 CGGGATGCTGCTGCTGGCCTGGG + Intergenic
1185297348 22:50060943-50060965 CAGGCTGCCGCTGCTCTCCCAGG - Exonic
1185418147 22:50721031-50721053 CGACCTGCTGCTGCCCTCCCCGG + Intergenic
950248996 3:11448359-11448381 CTGGCTGCTTCTGCTCACCCAGG + Intronic
950429920 3:12944819-12944841 CAGGCTGCTGCTGAGCTGCTGGG + Intronic
950569279 3:13790221-13790243 CTGGCTGCTGCTACTAACCTGGG - Intergenic
951477205 3:23119473-23119495 CCTGCTGCTGCTGCTGTTCTGGG + Intergenic
951508726 3:23478828-23478850 CAGGCTGGTTCTGATCTCCTGGG - Intronic
951798296 3:26566661-26566683 GTGGCTGCTGCCGCCCTCCTAGG - Intergenic
952184817 3:30957214-30957236 AGAGCTTCTGCTGCTCTCCTGGG - Intergenic
952646425 3:35664601-35664623 CGGACTGCTGATTCACTCCTAGG - Intronic
954149159 3:48648624-48648646 CAGGCTCCTGCTGTTCTCTTGGG - Intronic
954196348 3:48999306-48999328 CTGGCTGCTCCTGCTTGCCTGGG - Intronic
954375723 3:50193236-50193258 GGCGCTGATTCTGCTCTCCTCGG + Intronic
956228561 3:66987154-66987176 GTTGATGCTGCTGCTCTCCTGGG - Intergenic
956698881 3:71941513-71941535 ACGGCTCCTGCTGCTCTCCAGGG + Intergenic
956923074 3:73951413-73951435 ATGCCTGCTGCTGCCCTCCTGGG + Intergenic
961819736 3:129569846-129569868 CGTCCTGCTGCTGCTCTCCGTGG - Exonic
962234671 3:133697630-133697652 TGGGCTGCTGCTGCCCCCCTGGG + Intergenic
962314548 3:134350959-134350981 CAGGCAGGTGCGGCTCTCCTAGG + Intergenic
962887621 3:139642118-139642140 GGGGCTGCTACAGCCCTCCTAGG + Intronic
964758869 3:160114780-160114802 CGGGCTGCAGATTCTCTTCTGGG - Intergenic
965033324 3:163402236-163402258 CAGGCTCCTGTTGCACTCCTGGG - Intergenic
965607416 3:170510942-170510964 GGGGCTGCTGATGCTGGCCTCGG - Intronic
967386786 3:188919878-188919900 AGCTATGCTGCTGCTCTCCTAGG + Intergenic
968235865 3:197029749-197029771 CCGGCTGCTGCGGACCTCCTCGG - Exonic
968529804 4:1085608-1085630 GGGGCACCTGCTGCTCTCCCAGG + Intronic
968727572 4:2255471-2255493 CAGGCCACTGCTGCTCTCCAGGG - Intronic
969036210 4:4255946-4255968 TGACCTGCTGCTGCTCCCCTGGG - Intergenic
969220531 4:5755798-5755820 CAGTCTCCTGCTGCTCTGCTGGG + Intronic
969248829 4:5954117-5954139 CTGTGTGCTGCTGCTGTCCTGGG - Intronic
969483989 4:7461616-7461638 GAGGCTGCTGCTACGCTCCTCGG - Intronic
969923339 4:10561109-10561131 CAGGCTGCTACTGAGCTCCTGGG + Intronic
973142213 4:46782551-46782573 TGGGTTGCTGCTGCTCGCTTGGG - Intronic
974839218 4:67282381-67282403 CGGGTTGCTGCTGCTGGCTTGGG + Intergenic
975254796 4:72220373-72220395 CATGCTGCTGCTGCCTTCCTGGG - Intergenic
976283043 4:83344222-83344244 CAGGCTGCTCCTGAACTCCTGGG - Intergenic
977608439 4:99007165-99007187 CGGGCTGCTGTCTCACTCCTGGG + Intronic
977640568 4:99353873-99353895 TGGGTTGCTGCTGCTGTCTTGGG + Intergenic
977640801 4:99356073-99356095 CGGGTTGCTGCTGCTGTCTTGGG - Intergenic
978492302 4:109322360-109322382 CGGGTTGCTGCTGCTGGCTTGGG - Intergenic
980098044 4:128513153-128513175 CAGACTGCTGCTACTCTCCCTGG - Intergenic
981654776 4:147100889-147100911 CAGGTTGCTGCTGCTCTTCTTGG - Intergenic
984138408 4:175971214-175971236 TCTGCTGCTGCTGCGCTCCTGGG + Intronic
984477953 4:180260570-180260592 CAGGCTGCTCTTGATCTCCTGGG + Intergenic
988171444 5:27662180-27662202 TGGTCTGCTCCTGCTCACCTTGG - Intergenic
988949959 5:36246087-36246109 CGGGCTGGTCCTGAACTCCTGGG + Intergenic
989496736 5:42117478-42117500 CGGGTTGCTGCTGCTGGCTTGGG - Intergenic
989750117 5:44883507-44883529 CAGGTTGCTGCTGCTCACTTGGG + Intergenic
993249558 5:85501210-85501232 CTGGCTTCTGCTGCACTTCTTGG - Intergenic
994171356 5:96662462-96662484 CGGGCGGCGGCTGCTCGCCGGGG - Exonic
997357866 5:133275867-133275889 CAGGCTGCTGTTGTTCTCCAGGG - Intronic
999250949 5:150182023-150182045 GGGGCTGCTGCTGGACCCCTAGG - Intronic
999785988 5:154891104-154891126 CGGGCTGGTGGTGAACTCCTGGG + Intronic
1001304699 5:170563201-170563223 GGCGCTGCTGCTCCTCACCTTGG + Intronic
1001582418 5:172807828-172807850 CGGGCTGGTCCTGGACTCCTGGG - Intergenic
1001732287 5:173969295-173969317 CGGGCTGCCGCCGCTCTGCCTGG + Intergenic
1002096813 5:176836203-176836225 CAGCCTGCTGTTGCCCTCCTGGG - Intronic
1002637214 5:180614387-180614409 CTCCCTGCTGCTGTTCTCCTGGG + Intronic
1002857127 6:1047953-1047975 GGGCGTGCTGCTGCTTTCCTTGG - Intergenic
1003855403 6:10268631-10268653 CAGGCTGCTGCTGTCCTCCGTGG - Intergenic
1003874779 6:10425923-10425945 GGGGCTGCTGCAGCTCCCCGAGG - Intergenic
1004589045 6:17031059-17031081 GGGGCTGCTGCTGTTCTTCATGG - Intergenic
1004748059 6:18532355-18532377 CTCGGTGCTGCTGCTGTCCTGGG + Intergenic
1006741911 6:36314974-36314996 CTGCCTCCTCCTGCTCTCCTTGG + Intergenic
1006749289 6:36366549-36366571 GGGGATCCTGCTGCTCTGCTGGG + Exonic
1006759708 6:36449125-36449147 CGGGCTGCTGCTGCTGGCTCAGG + Intronic
1007075620 6:39064483-39064505 CTGGCTGCAGCTTCTCTCCTTGG + Intronic
1007718668 6:43872273-43872295 CGCACCGCTCCTGCTCTCCTGGG - Intergenic
1007808693 6:44470997-44471019 GTGGCTGCTGCTGTTCTCCGTGG + Intergenic
1010690962 6:78910678-78910700 CGGGCTCCCGCTCCTCACCTCGG + Intronic
1013094293 6:106930244-106930266 AGGGATACTGCTACTCTCCTAGG - Intergenic
1015344784 6:132143485-132143507 AGTGCTGCTGCTGCTGTTCTAGG - Intergenic
1016044511 6:139467352-139467374 CAGGCTGGTGTTGCACTCCTAGG + Intergenic
1017815439 6:158012871-158012893 GGGGCTTCTGCTGCTCTCAGAGG + Intronic
1018180975 6:161223162-161223184 AGGGGTGCAGCTGCTGTCCTTGG - Intronic
1018231225 6:161677575-161677597 CTGGCAGCTGGTGCTCACCTCGG + Intronic
1018837448 6:167496024-167496046 CCGGCGGCTGCTGCCTTCCTGGG + Intergenic
1019576924 7:1742123-1742145 GGGGCTGCTCCGGCTCTCCTGGG - Intronic
1022092011 7:27113916-27113938 CGGGCCGCGGCTGCTGCCCTCGG - Intronic
1022120569 7:27304137-27304159 CAGGCTGCTCTTGATCTCCTAGG - Intergenic
1022332182 7:29390411-29390433 CCAGCTGCAGCTGCTGTCCTAGG + Intronic
1022436114 7:30387434-30387456 CAGGCTGCTTTTGCACTCCTGGG - Intronic
1023948695 7:44823879-44823901 CAGGCTGGTGTTGATCTCCTGGG + Intronic
1024088628 7:45917843-45917865 CGGGCTGCCGCTGCTCCCGCGGG - Intronic
1026186430 7:68085265-68085287 CAGGCTGCTGTTGAACTCCTGGG + Intergenic
1029482578 7:100822305-100822327 CGGGCTGCAGCTGTGCTCCGGGG - Exonic
1030727129 7:112939452-112939474 CCAGCCGCTGCTGCTCTCCCGGG - Intronic
1032162675 7:129522792-129522814 CACGCTGCTGCTGCTGTCCTTGG - Intergenic
1032790643 7:135240086-135240108 CAGGGTACAGCTGCTCTCCTTGG + Intronic
1033673013 7:143511265-143511287 GGTGCTGCTGCTGCTGCCCTCGG - Intergenic
1034068514 7:148160026-148160048 CGGGCTGGTCCTGAACTCCTGGG - Intronic
1034351004 7:150414699-150414721 CAGACTGAAGCTGCTCTCCTGGG + Intergenic
1034353954 7:150435881-150435903 CAGGCTTCTGCTGGCCTCCTGGG + Intergenic
1034488001 7:151378213-151378235 CTGGCTGCTGCTGTGGTCCTGGG - Exonic
1034897008 7:154882582-154882604 AGGGTGGCTGCTGCTCCCCTGGG - Intronic
1035015730 7:155764223-155764245 CTGGCTGCGGGTGCTCTTCTGGG - Intronic
1035239927 7:157523013-157523035 CCGGCAGCTCCTGCTCTGCTGGG + Intergenic
1035268314 7:157704552-157704574 CATGCTGCTCCCGCTCTCCTGGG + Intronic
1035292578 7:157849125-157849147 CGGGCTGACGCTGGTCTCCAGGG + Intronic
1035870620 8:3133187-3133209 TTGGCTGCTGCTGTCCTCCTGGG + Intronic
1036434865 8:8723655-8723677 CGGGCTGCAGCTGCGCTCGCTGG + Intergenic
1036627841 8:10486536-10486558 AAGGATGCTGGTGCTCTCCTTGG - Intergenic
1038622510 8:29157342-29157364 CGGGCTGGTCTTGATCTCCTAGG - Intronic
1038780883 8:30567804-30567826 CTGGCTGCTGCCGCTCTCTCAGG - Intronic
1039081574 8:33738996-33739018 CCAGCTGCTGATGCTCTGCTTGG + Intergenic
1039416460 8:37398716-37398738 TTGGCTGCTGCTGCCGTCCTGGG + Intergenic
1039453704 8:37695232-37695254 AGAGCTGCTCCGGCTCTCCTCGG - Intergenic
1039455047 8:37700492-37700514 CGGGCTGCGCCTTCTCTCCGAGG - Intergenic
1039492977 8:37961740-37961762 GGAGCTGCTCCTACTCTCCTAGG + Intergenic
1039947480 8:42142463-42142485 CAGGCTGGTGCTGAACTCCTGGG - Intergenic
1040303504 8:46200307-46200329 CGGTTCGCTGCTTCTCTCCTGGG - Intergenic
1041045487 8:53882451-53882473 TGGGCAGCAGCTGCTCCCCTGGG - Intronic
1041713077 8:60910579-60910601 AGGGCAACTGCTGCTGTCCTGGG - Intergenic
1041898822 8:62958242-62958264 CTGGCTGCTGCAGGTCTCTTAGG - Intronic
1042095961 8:65216327-65216349 GGTGCTGCTGCTGCTCCTCTGGG - Intergenic
1042342763 8:67697243-67697265 CTGGGGGCTGCTGCTCTCCACGG + Intronic
1044298260 8:90553623-90553645 GGGGCTGGTGCTGAGCTCCTAGG + Intergenic
1044581693 8:93832059-93832081 TGGCCTGCTGCTGTGCTCCTAGG + Intergenic
1046329728 8:112699095-112699117 CGGGTTGCTGCTGCTGGCTTGGG - Intronic
1046823917 8:118666297-118666319 CAGGCTGGTTGTGCTCTCCTGGG + Intergenic
1048130665 8:131693667-131693689 CAGGCTGGTGTTGCACTCCTGGG + Intergenic
1048323001 8:133416173-133416195 CGGGCTGCTCCTGGACTCCAGGG - Intergenic
1051222869 9:14868923-14868945 CGTGCTGCTGCTGCTCCTCCTGG - Exonic
1051436916 9:17043155-17043177 CCAGCTGCTGCTGCTGCCCTGGG + Intergenic
1052495036 9:29213979-29214001 GTGGCTGCAGCAGCTCTCCTGGG + Intergenic
1052793813 9:32903611-32903633 CGTTCTGAGGCTGCTCTCCTTGG + Intergenic
1052915927 9:33924332-33924354 TGTGCTGGTTCTGCTCTCCTGGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1057049895 9:91915620-91915642 CAGGTTGCTGCTGCTGTCTTGGG + Intronic
1058480609 9:105390060-105390082 CTGGCAGGTGCTCCTCTCCTTGG + Exonic
1058876393 9:109248653-109248675 CGGGCTGGTCCTGAACTCCTGGG + Intronic
1058883842 9:109307939-109307961 CAGTCTGCTGCTGCTCACCGTGG - Intronic
1058904754 9:109473786-109473808 GGGGCTCCTGCTGGGCTCCTGGG - Intronic
1059185670 9:112268482-112268504 CAGGCTGCTGTTGAACTCCTGGG - Intronic
1060115792 9:120939183-120939205 CGGGCAGCTGCTTCTTTCCCTGG - Intergenic
1060723281 9:125992159-125992181 CGGGCTTCTGCTGCTCCTCCTGG - Intergenic
1062077081 9:134595285-134595307 TGGCCTGCTGCTGGTCTCCCGGG + Intergenic
1062577817 9:137216729-137216751 TGGGCTGCTGATGCCGTCCTGGG - Exonic
1185748881 X:2594482-2594504 TGGGATGCTGCTTCTCTTCTCGG - Intergenic
1185763331 X:2704923-2704945 CAGGCTGCTGTTGAACTCCTGGG + Intronic
1186052611 X:5614906-5614928 GAAGCTGCTGCTGCACTCCTAGG + Intergenic
1186067161 X:5778411-5778433 CAGGCTGGTCTTGCTCTCCTGGG - Intergenic
1187528386 X:20074258-20074280 CTGGACTCTGCTGCTCTCCTGGG + Intronic
1187969975 X:24649326-24649348 AGGGCTGCTGCTGCACTTCTTGG - Intronic
1188097359 X:26041658-26041680 CGGGTTGCTGCTGCTGTCTGGGG - Intergenic
1189319177 X:40077165-40077187 CAGGCTGCTGCGGCTGCCCTGGG + Intronic
1190242699 X:48669810-48669832 CGGGCTGCTCTTGAACTCCTGGG + Intergenic
1190273855 X:48887616-48887638 CGGGCTGCTCTTGAACTCCTGGG - Intergenic
1192313688 X:70036007-70036029 GGGGCTGCTGCTCCTCTCTTGGG + Exonic
1192956526 X:76076340-76076362 GGGGCTTTTGCTGGTCTCCTGGG - Intergenic
1193121887 X:77831802-77831824 CAGGCTGGTGTTGATCTCCTGGG + Intronic
1193862073 X:86681368-86681390 CGGGCTGATCCTGAACTCCTGGG - Intronic
1198068969 X:133129025-133129047 CAGGCTGGTACTGATCTCCTGGG - Intergenic
1199082123 X:143588759-143588781 CGGGTTGCTGCTGCTGGCGTGGG + Intergenic
1199872646 X:151912833-151912855 CGGGCAGCTGGGGCTTTCCTTGG - Intronic
1200073302 X:153539352-153539374 CGGACAGCTGCGGCTCTTCTGGG + Intronic
1200165176 X:154030754-154030776 GGCGCTGCTGCTGCGCCCCTTGG + Exonic
1200796556 Y:7346205-7346227 GGGGCTCCTCCTGTTCTCCTGGG + Intergenic