ID: 1152381230

View in Genome Browser
Species Human (GRCh38)
Location 17:79943271-79943293
Sequence GTGGCTGGTGCGAGACACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152381227_1152381230 -2 Left 1152381227 17:79943250-79943272 CCTTTTGCAGTGATTTGAACTGT 0: 1
1: 0
2: 1
3: 22
4: 242
Right 1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG 0: 1
1: 0
2: 1
3: 12
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152381230 Original CRISPR GTGGCTGGTGCGAGACACAG CGG Intronic
900648781 1:3720963-3720985 GGGGCTGGTGAGGGGCACAGAGG + Intronic
904469756 1:30729063-30729085 GTGGCTGCAGAGACACACAGTGG + Intergenic
904758320 1:32782090-32782112 GTGACCGGGGCCAGACACAGTGG - Intronic
905857644 1:41324666-41324688 GTGTCAGGTGAGAGACAGAGGGG + Intergenic
907247968 1:53120211-53120233 GGGGTTGGTGCGAGAACCAGGGG - Intronic
907306685 1:53517257-53517279 CTGGCTGCTGTGAGACCCAGGGG + Intronic
907758318 1:57332863-57332885 GTGGCTGGTGGGAGGCAGACAGG - Intronic
908326496 1:63028729-63028751 GTCACTGGTGGGAGGCACAGAGG - Intergenic
908867589 1:68568784-68568806 GTGGTTGATGTGAGACACAAAGG + Intergenic
911134516 1:94424702-94424724 GTGGCAGGGGCCAGGCACAGTGG - Intronic
912649069 1:111422274-111422296 GAGGAGGGTGAGAGACACAGGGG - Intronic
914747033 1:150508583-150508605 GTGGCTGGTGGGAGAGGCAAGGG + Intronic
915230432 1:154441795-154441817 GTGGCCTTTGGGAGACACAGAGG + Intronic
915981176 1:160420764-160420786 AGGGCTGATGAGAGACACAGAGG - Intronic
916246243 1:162691103-162691125 ATGCCTGGTGCCTGACACAGCGG + Intronic
917968187 1:180191606-180191628 GTGGCAGGAGACAGACACAGAGG + Intronic
919897495 1:202018390-202018412 GTGACTGGTGCCCGACAGAGAGG - Intergenic
924320102 1:242840015-242840037 ATGGCTGGTGCTGGAGACAGAGG - Intergenic
1064782047 10:18852343-18852365 GTGGCAGGGGCCAGGCACAGTGG - Intergenic
1065884115 10:30061657-30061679 GTGGCTAGGGAGAGACACAAAGG + Intronic
1069055619 10:63841564-63841586 CTGCATGGTGCGAGACCCAGAGG - Intergenic
1072754886 10:98012752-98012774 GAGGCTGGGGAGTGACACAGGGG + Intronic
1076016347 10:127030375-127030397 GTGGCTGGTGACAGACAGCGAGG - Intronic
1077587437 11:3464523-3464545 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1078974904 11:16462683-16462705 CTGGCAGGTGCCAGGCACAGGGG - Intronic
1081403836 11:42673497-42673519 GTGCCTGCTGTGAGACTCAGTGG - Intergenic
1084128540 11:67117719-67117741 GTGGCTGGGGCGTTACACATCGG - Intergenic
1084829555 11:71758420-71758442 GAGGCTGGTGATAGGCACAGAGG + Intergenic
1085022894 11:73220100-73220122 GAAGCTGGTGCCAGAGACAGGGG - Intronic
1085852914 11:80142287-80142309 GGGCCTGGTCTGAGACACAGTGG + Intergenic
1085936118 11:81146009-81146031 GTGGCTGGTGCTTGTCACATTGG + Intergenic
1086096927 11:83059921-83059943 GTGGTTGGGGCCAGACACAGTGG + Intronic
1089383273 11:118051295-118051317 CTGGCTTGTGGGAGACCCAGGGG - Intergenic
1089498441 11:118919299-118919321 GTGGCTGGTGCTAGAATCTGGGG - Intronic
1089896433 11:121934983-121935005 GTAGCTGGTGGGAGAATCAGAGG - Intergenic
1090415591 11:126538118-126538140 ATGGGTGGTGCGGGAGACAGTGG + Intronic
1094117911 12:26937898-26937920 GTGTCTGGTGCCACAGACAGGGG + Exonic
1098255595 12:68611693-68611715 GTGGCTGCTGCCAGACTAAGTGG - Intronic
1100301769 12:93314592-93314614 GTGGCTGGGGCGGGGGACAGTGG + Intergenic
1101436521 12:104669136-104669158 CTGGCTGGCAGGAGACACAGCGG - Intronic
1102767479 12:115446158-115446180 GTGGCCAGTGGGAGTCACAGAGG - Intergenic
1103702957 12:122857122-122857144 GAGCCTGGTGCGCGAGACAGAGG + Exonic
1103748325 12:123141438-123141460 GTTGCTGGTGCCAGGCCCAGTGG - Intronic
1104822325 12:131684244-131684266 GTGGCTGTTTCCAGACTCAGGGG - Intergenic
1107658974 13:42619695-42619717 GTGGCTGGTGCCAGAGGCACTGG - Intergenic
1108572008 13:51761158-51761180 GTGGGTGGTCCGAGACAGAATGG + Exonic
1110825805 13:79970411-79970433 GTGGCAGGTGCGAGAGAGAGAGG + Intergenic
1113654231 13:112058043-112058065 GTGGCTGGTGCGGGAGTCAATGG + Intergenic
1114614267 14:24059954-24059976 GTGGTTGCTGTGGGACACAGGGG - Exonic
1115169899 14:30492689-30492711 GTGGCAGGGGCCAGACACAGTGG + Intergenic
1119348146 14:73943173-73943195 GTGACTGATGAGAGACACGGAGG - Intronic
1119741293 14:77015280-77015302 GTGGCTGGTGGGAGAGGGAGGGG + Intergenic
1119805631 14:77480264-77480286 GTGTCTGGAGTGAGACACAGTGG - Intronic
1119865366 14:77968727-77968749 GTGGATGGTGCCAGGCACGGTGG - Intergenic
1121344146 14:93122798-93122820 TTTGCTAGTGCAAGACACAGTGG + Intergenic
1123116916 14:105899049-105899071 GTGTCTGGAGTGATACACAGGGG + Intergenic
1123121198 14:105917914-105917936 GTGTCTGGAGGGAGAGACAGGGG + Intergenic
1123403901 15:20009483-20009505 GTGTCTGGAGGGAGAGACAGGGG + Intergenic
1123513241 15:21016129-21016151 GTGTCTGGAGGGAGAGACAGGGG + Intergenic
1123859375 15:24448043-24448065 GTTGCTCGTGTGAGACACAGAGG + Intergenic
1124360316 15:29032134-29032156 GTGGCTGGTGTGTGTCAAAGAGG + Intronic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1125743991 15:41986806-41986828 GTGAGTGGTGCCAGGCACAGTGG - Intronic
1127281623 15:57498067-57498089 GTGCTTGGTGCCACACACAGAGG - Intronic
1127531081 15:59844062-59844084 GAGGCTGCTGGGAGAAACAGTGG + Intergenic
1128147424 15:65339769-65339791 GTGGCTGGTGCACGTGACAGTGG + Intronic
1128678475 15:69628976-69628998 CTGGCAGGTGCGAGGCAGAGTGG + Intergenic
1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG + Intronic
1131467158 15:92664764-92664786 CTGGCTGCTCAGAGACACAGAGG - Intronic
1133027664 16:2995700-2995722 GGGGCTGGTGAGTGACTCAGGGG - Intergenic
1133354850 16:5128462-5128484 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1133454813 16:5932831-5932853 GTGGCGGGTGTGAGGCACTGGGG - Intergenic
1136077336 16:27826209-27826231 GTGGCTGGGGAAAGACACAGTGG + Intronic
1137491816 16:48939256-48939278 GTGGCTACTAGGAGACACAGAGG - Intergenic
1138388153 16:56650645-56650667 GTGGCTGATGAGAAAGACAGAGG - Intronic
1138392541 16:56681070-56681092 GTGGCTGATGAGAAAGACAGAGG - Intronic
1141483809 16:84325488-84325510 GTGGATGGGGCCAGGCACAGTGG - Intronic
1142272989 16:89100742-89100764 CTGGCGCCTGCGAGACACAGAGG + Exonic
1143027850 17:3951565-3951587 GTGGCAGGTGGGAGGCACTGGGG - Exonic
1144339345 17:14299540-14299562 GTGGCTGGTCCTGGACAGAGTGG + Intergenic
1145970520 17:28953748-28953770 GTGGCTTGTGCTAGAGCCAGGGG + Intronic
1148157919 17:45433820-45433842 GTGGCTGGTGCCGGGCACGGTGG + Intronic
1149643653 17:58222208-58222230 ATGGCTTGGGCCAGACACAGTGG + Intronic
1150067616 17:62124800-62124822 GTGGATCTTGAGAGACACAGAGG - Intergenic
1150354501 17:64471448-64471470 GTGCCTGGGGTGAGACACTGAGG - Intergenic
1151593742 17:75064134-75064156 GGGGGTGGTCAGAGACACAGGGG - Exonic
1152157179 17:78642100-78642122 GGGGCTTGTGAGAGTCACAGAGG + Intergenic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1155176761 18:23307835-23307857 ATGGCTGTGGGGAGACACAGTGG - Intronic
1155930503 18:31702713-31702735 GTAGCTGGAGAGAGCCACAGTGG + Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157563705 18:48665403-48665425 GTGACTCCAGCGAGACACAGAGG + Intronic
1158522024 18:58179602-58179624 GTGGCTGATCCGAGAGGCAGCGG - Intronic
1159906061 18:74093339-74093361 GTGGCTGGTGCGTGTCAGCGAGG + Intronic
1160988508 19:1851227-1851249 GTGGGTGGTGAGACACACAGTGG + Intergenic
1161369514 19:3902690-3902712 GTGGTGGGTGAGAGACACAATGG + Intronic
1161528010 19:4769409-4769431 GTGGCGGGGGGGAGACACAGAGG - Intergenic
1161730824 19:5959524-5959546 GTGGCGTGCGCGAGACCCAGGGG + Intronic
1162569722 19:11464448-11464470 GTGGCTGTGGCCAGGCACAGTGG - Intronic
1163365232 19:16872377-16872399 GTGGCTGGGTGGGGACACAGGGG - Intronic
1165863651 19:38922756-38922778 GTGGCTGGAGACAGCCACAGGGG - Intronic
1165982300 19:39735058-39735080 CTGGCAGGTGCCATACACAGAGG - Exonic
1166006790 19:39913755-39913777 GTGGCCAGTGCGTCACACAGTGG + Exonic
1166260535 19:41637408-41637430 GTGTGTGGTGCCAGGCACAGTGG + Intronic
1166802202 19:45465259-45465281 CTGGCTGGTGGCAGACAGAGGGG + Intronic
1167066046 19:47186888-47186910 GTGGCTGTGGCGACAGACAGAGG + Intronic
1167698243 19:51027255-51027277 GGGGCTGCTGCCAGGCACAGGGG + Intronic
925572372 2:5325724-5325746 CTGGCGGTTGCGAGACGCAGAGG - Intergenic
926027226 2:9555826-9555848 GTGGGTGGTGCGGGGGACAGCGG - Intergenic
927495794 2:23550764-23550786 GTGCCTGGAGCCAGACCCAGTGG - Intronic
927821563 2:26270473-26270495 GTGGCTGGTTGAAGACACAAAGG - Intronic
929236969 2:39615810-39615832 CTGGGAGGTGGGAGACACAGTGG + Intergenic
932924743 2:75959905-75959927 GTTGCTGGTGTGGGTCACAGGGG + Intergenic
935589174 2:104830026-104830048 GTGGCTGGAGAGAAACAAAGAGG + Intergenic
947642439 2:231714539-231714561 GTGCCTGGTGTGAAACACAAAGG - Intergenic
947839244 2:233197199-233197221 GAGGCCGGTGCCTGACACAGTGG + Intronic
948204876 2:236158307-236158329 GTGGGTGGCGAGAGAAACAGTGG + Intergenic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1168979685 20:1993965-1993987 GTGGCTGGTCCAAGGCTCAGGGG + Exonic
1172270812 20:33654807-33654829 GGGGCTGGGGCGAGGCACAATGG + Intergenic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1174200903 20:48805694-48805716 GTGGCTGTTGGGGGGCACAGAGG - Intronic
1175239244 20:57534412-57534434 GTTGCTGGGGCCAGGCACAGTGG + Intergenic
1175910071 20:62401038-62401060 ATGGCTGGTAAGAGACAGAGTGG + Intronic
1177229748 21:18304437-18304459 CTGGCTGGAGTGAGACCCAGAGG - Intronic
1177241231 21:18460613-18460635 CTGGCAGGTGGGAGACCCAGAGG + Intronic
1179398965 21:41066524-41066546 GTGGCTGGTGGGTGATGCAGGGG + Intergenic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1181016804 22:20074810-20074832 GTGGCTGGGGCCAGGCGCAGTGG - Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1183197484 22:36363438-36363460 GTAGCTGGAGGGAGAGACAGAGG + Intronic
1184119159 22:42439106-42439128 GAGGCTGGAGAGAGACGCAGGGG + Intergenic
1184431958 22:44446336-44446358 TTAGCTGGTGACAGACACAGAGG - Intergenic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
950249973 3:11456684-11456706 GTGGCTTTTGTTAGACACAGTGG - Intronic
950782950 3:15408205-15408227 GTGACTGGAACGAGACACAGGGG + Intronic
953606197 3:44414901-44414923 TTGGCTGGTGAGAGACAAGGGGG - Intergenic
954351459 3:50047629-50047651 TTGGCTGGTGGGAGCAACAGCGG - Intronic
954690244 3:52391848-52391870 GAGGCTGGTGCTAGACACAGAGG - Intronic
955140343 3:56262289-56262311 GTGCCATGTGCCAGACACAGTGG - Intronic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
961841450 3:129716634-129716656 GTGGCTGAGGCCAGGCACAGTGG - Intronic
961891239 3:130131907-130131929 GAGGCTGGTGATAGGCACAGAGG - Intergenic
962169678 3:133087793-133087815 GTTGCTGCTGCCACACACAGTGG - Intronic
962936220 3:140083252-140083274 GTGCCCAGTGCCAGACACAGTGG + Intronic
963561031 3:146865348-146865370 GTGGCTGGTGCCAGAATGAGAGG + Intergenic
964642594 3:158925979-158926001 GTGGCTGGTGTGGGAAAGAGTGG + Intergenic
965096668 3:164237451-164237473 ATGGCATGTGCAAGACACAGAGG - Intergenic
966653747 3:182329836-182329858 GTGGCTGTAGTGAGACAAAGGGG - Intergenic
966944150 3:184765890-184765912 GTGGCTGGTGGCAGGCTCAGAGG + Intergenic
967151303 3:186653204-186653226 GTGGCCTGTGCTAGACACTGTGG + Intergenic
968442460 4:630798-630820 GGGGCTGGTGAGACACAAAGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969002628 4:3994348-3994370 GAGGCTGGTGATAGGCACAGAGG - Intergenic
969751392 4:9114180-9114202 GAGGCTGGTGATAGGCACAGAGG + Intergenic
969811300 4:9650464-9650486 GAGGCTGGTGATAGGCACAGAGG + Intergenic
974663029 4:64919787-64919809 CAGGCTGGTGCGTGCCACAGAGG - Intergenic
979672977 4:123380943-123380965 GTGGCTGGAGAGAGAGGCAGGGG + Intergenic
980197286 4:129606421-129606443 GTGGCTGATGCTGGGCACAGTGG - Intergenic
984242417 4:177233611-177233633 GAGGCAGGTGCCAGGCACAGTGG + Intergenic
985723338 5:1502147-1502169 GTGGCTTGGGAAAGACACAGTGG + Intronic
986001903 5:3637228-3637250 GTCTCCGGTGCAAGACACAGAGG - Intergenic
986001936 5:3637459-3637481 GTCTCCGGTGCAAGACACAGAGG - Intergenic
986001950 5:3637558-3637580 GTCTCTAGTGCAAGACACAGAGG - Intergenic
986001958 5:3637624-3637646 GTCTCTAGTGCAAGACACAGAGG - Intergenic
986060541 5:4186138-4186160 GTGGATGTTGGGAGACAAAGAGG + Intergenic
990977364 5:61571584-61571606 GTGGCTGGAGCTAGACAGAAAGG + Intergenic
992906896 5:81355965-81355987 GTGGACGGTGAGGGACACAGTGG - Intronic
997726079 5:136120749-136120771 GTGACAGGTGCCAGACACAGTGG - Intergenic
1002358214 5:178648255-178648277 GGTGCTGGTGAGAGGCACAGGGG + Intergenic
1004242438 6:13936971-13936993 GTGGCTGGTGAGGTAGACAGAGG + Intronic
1006075187 6:31528076-31528098 GTGGCTGCTGCCAGACAGAAAGG - Intergenic
1007616818 6:43184729-43184751 GTGGATGGTGTGAAGCACAGCGG - Exonic
1013177751 6:107691627-107691649 GTGGCAAGTGAGAGTCACAGGGG + Intergenic
1019556285 7:1633187-1633209 GTGGCTGCTGGGAGACCCAGGGG + Intergenic
1019615431 7:1957406-1957428 GTGGGTGGTGCGGGCCGCAGAGG + Intronic
1020321574 7:6942470-6942492 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1022751487 7:33231289-33231311 GTTGCTGGAGCCAGGCACAGTGG - Intronic
1023772270 7:43568672-43568694 GGGTCTTGTGCCAGACACAGGGG + Intergenic
1026158186 7:67845946-67845968 GTGGGTGGTGGGAGCCACTGGGG + Intergenic
1026368487 7:69674095-69674117 GAGGCTTGTCCCAGACACAGTGG - Intronic
1027560095 7:79718748-79718770 GTGGCAGGTGAGAGAGAGAGAGG + Intergenic
1028778008 7:94702525-94702547 CTGGCTGGAGCGAGAGACAAAGG - Intergenic
1028976568 7:96921476-96921498 GTGGCTGAAGCCAGACACACTGG - Intergenic
1029964559 7:104725689-104725711 GTGACTGCTGGGAGATACAGAGG + Intronic
1033543298 7:142376590-142376612 GTGGGTGCTGCCAGACAGAGGGG + Intergenic
1033756388 7:144400823-144400845 GAGGCTGGAGCCAGGCACAGTGG - Intronic
1035429569 7:158808660-158808682 GTGGCTGGGGCCTGGCACAGGGG + Intronic
1035443432 7:158922711-158922733 GTGGGTGCAGCGAGACACATGGG + Intronic
1036374600 8:8189594-8189616 GAGGCTGGTGATAGGCACAGAGG + Intergenic
1036854942 8:12233553-12233575 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1036876301 8:12476041-12476063 GAGGCTGGTGATAGGCACAGAGG - Intergenic
1037712246 8:21364129-21364151 GTGTCTGGGCCCAGACACAGTGG + Intergenic
1038545886 8:28425315-28425337 GAGGATGGTCCCAGACACAGTGG - Intronic
1039475328 8:37836597-37836619 GTGGATGGTGGGAGTAACAGTGG - Intronic
1041173663 8:55171306-55171328 GCGTCTGGTGGGAGACACAATGG + Intronic
1043463898 8:80486707-80486729 GGGGCGGGGGCGAGACAGAGGGG + Exonic
1047288398 8:123507836-123507858 CAGGCTGGTGAGAGACCCAGAGG + Intronic
1047956620 8:129981436-129981458 GGGGCTGGAGCCAGGCACAGTGG - Intronic
1049516371 8:143059752-143059774 TTTGCTTGTGCCAGACACAGTGG - Intronic
1049575707 8:143388768-143388790 GTGGCTGGAGGGGGACTCAGGGG + Intergenic
1049757775 8:144318417-144318439 GTGGCTGGCCCGAGACAGATGGG + Intronic
1054985398 9:71256380-71256402 GTGACAGGTGCGAGGCACATAGG + Intronic
1057557376 9:96098725-96098747 GGGGCTGGTCAGTGACACAGAGG + Intergenic
1058809457 9:108625578-108625600 GGGGCTGGGGCCAGGCACAGTGG + Intergenic
1059310422 9:113385101-113385123 ATGGCTGGTGCTGGGCACAGTGG - Intergenic
1059477809 9:114561840-114561862 GTGGCTCTTCCCAGACACAGGGG - Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060776166 9:126376493-126376515 CTGGCTGGTGTGCTACACAGTGG + Intronic
1061328282 9:129877175-129877197 GGGCCTGGTGAGAGACACTGAGG + Intronic
1061497642 9:130984651-130984673 ATGGCAGGTGCGGAACACAGGGG - Intergenic
1061997195 9:134192566-134192588 TGGGCTGGTGGGGGACACAGCGG + Intergenic
1061997207 9:134192602-134192624 GTGGCTGGTGGGGGACACACTGG + Intergenic
1062551522 9:137089682-137089704 CTGGCTGGGTGGAGACACAGTGG + Intronic
1062620218 9:137417179-137417201 GTGGGCGGTGGGAGACACACGGG + Intronic
1188012681 X:25074286-25074308 GTGGCTTTGGCCAGACACAGTGG - Intergenic
1189011587 X:37050516-37050538 ATGGCTGCTGCGAGAAACTGGGG - Intergenic
1195068573 X:101258774-101258796 GTGGCTGGAGAGTGACACACAGG - Intronic
1197226920 X:123962863-123962885 GTGGCTGCTGCGAAATACGGCGG - Intronic