ID: 1152382329

View in Genome Browser
Species Human (GRCh38)
Location 17:79948550-79948572
Sequence CCACCCACGGGGAGATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152382319_1152382329 10 Left 1152382319 17:79948517-79948539 CCTCTGGCTCTGTGTGGCTGTAT 0: 1
1: 1
2: 2
3: 35
4: 340
Right 1152382329 17:79948550-79948572 CCACCCACGGGGAGATGGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 171
1152382318_1152382329 14 Left 1152382318 17:79948513-79948535 CCAGCCTCTGGCTCTGTGTGGCT 0: 1
1: 0
2: 7
3: 82
4: 1056
Right 1152382329 17:79948550-79948572 CCACCCACGGGGAGATGGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152382329 Original CRISPR CCACCCACGGGGAGATGGAG GGG Intronic
903333925 1:22612608-22612630 CAACCCAAGGGGAGAAAGAGGGG - Intergenic
904293485 1:29502761-29502783 CAACCCAGGGAGAGAAGGAGAGG + Intergenic
905584583 1:39106271-39106293 AGACCCCCGGGGAGATGGAGGGG - Intronic
909677045 1:78250347-78250369 CAAGCTACGGGCAGATGGAGAGG - Intergenic
910174156 1:84410927-84410949 CCACCCACAGGGAGACGAAATGG + Exonic
910223616 1:84914887-84914909 CCACCCTGGGCGAGATGGTGAGG - Intergenic
913430422 1:118785242-118785264 CGACTCACAGGGAGTTGGAGGGG - Intergenic
915021578 1:152784904-152784926 GCACACATGGGGAGATGGAAGGG - Intronic
916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG + Intronic
916578637 1:166088753-166088775 CCAACCACGGGGAGGGGCAGAGG + Intronic
917405829 1:174707782-174707804 TCAACCACTGGGTGATGGAGGGG - Intronic
920250031 1:204617414-204617436 CCCCCCGAGGTGAGATGGAGTGG + Exonic
920701863 1:208223993-208224015 CCACCCACGGGGAAAAGATGGGG - Intronic
921303488 1:213772608-213772630 CCCCTCCCGGGAAGATGGAGTGG + Intergenic
922986720 1:229871693-229871715 ACATCCCCGGGGAGTTGGAGGGG + Intergenic
1068062657 10:52088586-52088608 TCACACACTGGGAGATGGAAGGG - Intronic
1070103792 10:73413727-73413749 CCGCCCTCGGGCAGGTGGAGGGG - Intronic
1070306845 10:75244867-75244889 TCACCCACAGGGAGATCCAGAGG - Intergenic
1070651089 10:78236853-78236875 CCTCCCACGGTGCGTTGGAGAGG + Intergenic
1070785552 10:79160303-79160325 CCAGCCATGGGGAGAGGAAGTGG - Intronic
1074207246 10:111293869-111293891 CCACCCACAATGAGAGGGAGGGG - Intergenic
1074883058 10:117673276-117673298 CCACCCATGGGAAGATCCAGAGG + Intergenic
1076216273 10:128696136-128696158 CCAGCCACAGGGAGAAGCAGAGG + Intergenic
1077119650 11:900976-900998 CCACCCTGTGGGACATGGAGGGG + Exonic
1078020223 11:7650874-7650896 CCAACCACAGGGTGATGGAGTGG + Exonic
1080514429 11:33006893-33006915 CCATCCAAGTGGAGATGTAGTGG + Intergenic
1080896419 11:36452238-36452260 GCACCCATGGAGAGATGCAGAGG + Intronic
1083202952 11:61131410-61131432 AAACCCCAGGGGAGATGGAGGGG + Exonic
1083272267 11:61578523-61578545 CCAGCCAAGGGGAGATGGGGAGG + Intronic
1083603363 11:63962246-63962268 CCACCCACAGGCAGATGAAGAGG + Intergenic
1083682685 11:64358705-64358727 CCACCCCCAGGACGATGGAGTGG + Intergenic
1084084413 11:66848446-66848468 CCACCCATGGGGAGCTTGAAAGG + Intronic
1084530944 11:69727464-69727486 CCACCCCCTGGGAGCAGGAGGGG - Intergenic
1084697389 11:70763767-70763789 CCACACCCAGGGAGACGGAGAGG + Intronic
1085518115 11:77123007-77123029 CCCCCCACGGGGAAATGGGAGGG - Intronic
1091221959 11:133935103-133935125 CCACCCAAGGGGAGAGGCCGCGG + Intronic
1092265280 12:6976265-6976287 CCCCCCATGGGGGGGTGGAGAGG - Exonic
1092750202 12:11711868-11711890 CCACCCACGGGGGGAAGGTTGGG - Intronic
1093135425 12:15444327-15444349 CTACTCAAGGGGAGAGGGAGAGG + Intronic
1094035288 12:26063918-26063940 GCACTCAGGTGGAGATGGAGAGG + Intronic
1096616104 12:52834391-52834413 CGCCCCAAGGGGAGAGGGAGGGG + Intergenic
1096749898 12:53751981-53752003 ACAACCACGGGGAGAGGGGGAGG - Intergenic
1097262105 12:57725906-57725928 CCACCCATGGGTAGGTGTAGGGG + Intronic
1098275484 12:68808047-68808069 CCACCTCCGGGATGATGGAGTGG - Intergenic
1100239289 12:92694611-92694633 CCAACCACTGGGAGAAGGAGGGG + Intergenic
1104035668 12:125095580-125095602 ACACCCAGGGGCAGGTGGAGTGG - Intronic
1104747012 12:131216884-131216906 CCAGCGAGGGGAAGATGGAGAGG - Intergenic
1104785606 12:131446301-131446323 CCAGCGAGGGGAAGATGGAGAGG + Intergenic
1113473221 13:110561545-110561567 CCAGCCTCGGGGAGAGGGCGCGG - Exonic
1113824881 13:113244452-113244474 CCACAGACGAGGAGCTGGAGCGG + Exonic
1114215706 14:20656243-20656265 ACACCTCCAGGGAGATGGAGTGG - Intergenic
1119770660 14:77218942-77218964 CCACCCACAGGGCGATGTTGAGG - Exonic
1120518404 14:85497303-85497325 TCAGCCACGTGGAGATGCAGAGG - Intergenic
1121159009 14:91717201-91717223 CCAGGGACTGGGAGATGGAGAGG + Intronic
1121320494 14:92989010-92989032 CAACCCTCGGGGAGCTGCAGAGG - Intronic
1122877840 14:104677130-104677152 AGACCCACGGGGAGATCAAGGGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124437820 15:29665522-29665544 CCTCCCACGAGGAGATTCAGAGG - Intergenic
1128131434 15:65229674-65229696 CCATCGTCGGGGAGATGGAATGG + Intergenic
1128711816 15:69877895-69877917 CCTCCCTCGGGGAGAAGGACTGG - Intergenic
1133807790 16:9138591-9138613 CCGACCAGGGGAAGATGGAGTGG - Intergenic
1135727719 16:24869882-24869904 CCACCTGTGGGGAGATGGACGGG - Exonic
1138366211 16:56479778-56479800 CCATCCAGGGGAAGGTGGAGCGG - Intronic
1138536344 16:57662397-57662419 CCCCCCATGGAGAGATGGGGGGG + Intronic
1138643663 16:58406854-58406876 CCATCTGCGTGGAGATGGAGAGG - Intergenic
1139430434 16:66908263-66908285 CCACCCCAGGGCAGATGGAGGGG + Exonic
1143129951 17:4671874-4671896 CCTCCCAGGGAGAGGTGGAGAGG - Exonic
1144789860 17:17851435-17851457 CCAGCCCCGGGGGGATGCAGGGG + Intronic
1148208366 17:45793580-45793602 CGACTCACAGGGAGCTGGAGGGG - Intronic
1150009119 17:61488294-61488316 CCAGCCATGGGGATGTGGAGGGG + Intergenic
1151565326 17:74894249-74894271 TGACCCACGGGGAGGGGGAGTGG - Intergenic
1152242186 17:79166489-79166511 CCACCCACGGGGAGCTGAGATGG + Intronic
1152382329 17:79948550-79948572 CCACCCACGGGGAGATGGAGGGG + Intronic
1152678509 17:81653696-81653718 TCACCCACAGGGAGGTGGTGAGG - Intronic
1152774750 17:82194038-82194060 CCACCAACGCCGAGCTGGAGAGG - Exonic
1157807449 18:50668580-50668602 CCACACTTGGGGAGATGGTGTGG + Intronic
1160505073 18:79422517-79422539 CCAGCCACGAGAAGATGCAGCGG + Intronic
1161135906 19:2619718-2619740 CCATCCATGGGGACAGGGAGGGG + Intronic
1161144319 19:2668505-2668527 CCAACCCCAGGGAGATGGAGGGG + Intronic
1161238166 19:3208135-3208157 CCACCATCGGGGAGCGGGAGGGG - Exonic
1161361082 19:3850143-3850165 GCACCCTCTGGGAGAAGGAGGGG + Intronic
1162572090 19:11479880-11479902 CCGCCCCCCGGGAGATGGGGTGG - Intronic
1163490445 19:17614573-17614595 CCATGCACGGGGAGAAGAAGGGG + Intronic
1165243303 19:34483434-34483456 ACAGCAACCGGGAGATGGAGTGG + Intronic
1166733041 19:45069329-45069351 CCACCCACAGGGAGCTGGGCAGG - Intronic
1167102866 19:47414896-47414918 CCACCCACGGGGGCAGGGCGGGG + Intronic
1167117767 19:47498069-47498091 CCACCCTCTGCGAGAGGGAGAGG + Intronic
925018960 2:553654-553676 CCACCCAGGAGGAGGTGGGGAGG + Intergenic
927859518 2:26551637-26551659 CCACGCACTGGGGGATGGTGGGG - Intronic
929049067 2:37819233-37819255 CCACCAGAGGGGTGATGGAGAGG - Intergenic
930217334 2:48710107-48710129 CCACCCAGAGTGAGATGCAGGGG - Intronic
935221705 2:101020943-101020965 GCATCCACGGGGAGTTGGGGGGG + Intronic
936234648 2:110732616-110732638 CCAGCCACGCGGAGAAGCAGAGG + Exonic
940136213 2:150438433-150438455 CCACAGAAAGGGAGATGGAGAGG - Intergenic
943983219 2:194583397-194583419 GCACCCACTGAGAGCTGGAGAGG - Intergenic
947571464 2:231238907-231238929 CCACCCCTGGGGAGCTGGAAAGG - Intronic
948656598 2:239480240-239480262 AGACCCGGGGGGAGATGGAGGGG - Intergenic
1171381412 20:24737084-24737106 TCAGCCACGGGGAGAGGGATAGG - Intergenic
1172608488 20:36231737-36231759 ACACTCAGGGGGAGTTGGAGTGG - Exonic
1173009200 20:39166145-39166167 TCTCCCACTGAGAGATGGAGTGG + Intergenic
1173930760 20:46816271-46816293 CCACCTGTGGGGAGAGGGAGTGG + Intergenic
1175144915 20:56888364-56888386 CCACCCACCTGGGCATGGAGAGG - Intergenic
1175637434 20:60597499-60597521 CCACTGCTGGGGAGATGGAGAGG - Intergenic
1175783873 20:61700050-61700072 CCACCCCCGGGGACAAGGAAGGG + Intronic
1175825906 20:61936423-61936445 CAACCCAAGGGCAGATGGGGGGG - Intronic
1176364045 21:6021852-6021874 CCACCCACAAGCACATGGAGAGG - Intergenic
1178439161 21:32584413-32584435 TGACCCAGGGGGAGAAGGAGCGG - Intronic
1179030938 21:37718963-37718985 GCATCCATGGGGAGATGGGGAGG + Intronic
1179759473 21:43516693-43516715 CCACCCACAAGCACATGGAGAGG + Intergenic
1179935971 21:44603419-44603441 CCACAGACGGCAAGATGGAGGGG + Intronic
1180704816 22:17802798-17802820 GCCTCCACGGGGAGATGAAGGGG + Intronic
1181871053 22:25899677-25899699 GCACCCACAGGGAGGTGGAAAGG - Intronic
1181964251 22:26645533-26645555 CCACCACCGGGGAGAGGGCGGGG - Intergenic
1182864477 22:33591442-33591464 TCAGCCAAGGAGAGATGGAGTGG - Intronic
1184414018 22:44341772-44341794 CCTCCCACTGTGAGCTGGAGGGG - Intergenic
1184565431 22:45288992-45289014 CCACCCACAGGGAGGCGGTGGGG - Intronic
1185299399 22:50071819-50071841 ACACCTTCGGGGAGATGAAGAGG - Intronic
1185335350 22:50268788-50268810 CCACACAAGGGGAGCAGGAGCGG + Intronic
950181993 3:10919944-10919966 CCAGCCACAGTGGGATGGAGTGG - Intronic
952867164 3:37861927-37861949 CCGCGCACGGGGAGGCGGAGCGG - Intergenic
954684173 3:52361567-52361589 CCTCCCAAGTGGAGTTGGAGGGG + Intronic
956788311 3:72661037-72661059 CCACCCAAGGGGAGATGTAGAGG + Intergenic
956798551 3:72737338-72737360 CCACGGAAGGGGAGAAGGAGAGG + Intergenic
956826011 3:72997201-72997223 CCGCCCCTGGGGAGGTGGAGGGG - Intronic
958141718 3:89570914-89570936 CCAGTCACGGGGAGGTGGGGGGG + Intergenic
966751097 3:183323013-183323035 CCCCACACCGGGAGATGCAGTGG + Intronic
966823670 3:183945277-183945299 CCACCCACGGCAAGACGGAAGGG + Intronic
968504525 4:965704-965726 CCCCCCAGAGGGAGAGGGAGAGG + Intronic
968850204 4:3073705-3073727 CCACCCCCAGTGAGCTGGAGAGG - Intergenic
969465051 4:7351351-7351373 CCAGCCACGGGGATGGGGAGAGG - Intronic
972675641 4:41257309-41257331 CCGGTCACGGGGAGACGGAGGGG + Intronic
978567616 4:110100776-110100798 CAAAGGACGGGGAGATGGAGTGG + Intronic
981547594 4:145910134-145910156 CCACACACGGGGGGAGGGAGGGG + Intronic
985760324 5:1745640-1745662 TCAGCTGCGGGGAGATGGAGCGG - Intergenic
986886058 5:12237969-12237991 CCTCCCACAGAGAGAGGGAGAGG + Intergenic
998164861 5:139837159-139837181 CCTCCCACGGGGCGCTGGGGAGG - Exonic
999849959 5:155527274-155527296 CCACCCACAGGATGTTGGAGAGG - Intergenic
1000378913 5:160611305-160611327 CCAGCCAGAGGGAGATCGAGTGG - Intronic
1000910185 5:167012672-167012694 CCAACCAAAGGGAGATGTAGGGG + Intergenic
1001845174 5:174915932-174915954 GGGCCCACGGGGAGATGTAGTGG - Intergenic
1001993482 5:176135349-176135371 CCACCCTTGGGGAGCTTGAGTGG + Intergenic
1002469181 5:179424763-179424785 CCACCCAAGGAGAGCTGGGGTGG + Intergenic
1004271861 6:14202831-14202853 CCTCACACAGGGAGAGGGAGAGG + Intergenic
1006515277 6:34542057-34542079 CCACCCACAGGGCTAGGGAGGGG - Intronic
1010382003 6:75236198-75236220 CCACTCAGTGGGTGATGGAGAGG - Intergenic
1016773690 6:147880657-147880679 CCACCCACGAGCTGAAGGAGAGG - Intergenic
1016841967 6:148533801-148533823 CCACCCATGGGGACCTGGATGGG + Exonic
1018207077 6:161445903-161445925 CCTCCTGTGGGGAGATGGAGTGG + Intronic
1018722233 6:166581713-166581735 CCACCCTGGGCGAGATGGGGAGG + Intronic
1019134182 6:169897919-169897941 CCACCCAGGGTGAGCTGGACGGG - Intergenic
1019743508 7:2687574-2687596 CCAGCCACCAGGAGATGGAAAGG - Intronic
1021926705 7:25540801-25540823 CTAGCCATGGGGAGATGGGGAGG + Intergenic
1022207655 7:28179921-28179943 GCAGCCGCGGGGAGGTGGAGCGG - Intronic
1023768975 7:43537224-43537246 ACACCCACAGGCAGAGGGAGCGG + Intronic
1025015312 7:55434742-55434764 GCACCCAGGGGAAGAGGGAGTGG - Intergenic
1026851581 7:73727026-73727048 CCATCCTCGGGGAGCAGGAGAGG + Intergenic
1029441975 7:100591835-100591857 CCACCCTCGGCCAGATGCAGTGG + Exonic
1029896368 7:103989213-103989235 CCCACCACGGGGAGCTGGAAGGG - Exonic
1033354142 7:140585883-140585905 CCACAAATGAGGAGATGGAGAGG - Intronic
1048173345 8:132129475-132129497 TCAACCACGAGGAGCTGGAGAGG - Exonic
1049578377 8:143400021-143400043 CCAGCAACGGGGTGATGCAGGGG - Intergenic
1051403544 9:16709183-16709205 CCACTGAAGGGGAGATGAAGTGG + Intronic
1052853953 9:33395360-33395382 AGAGCCACGGGGACATGGAGAGG + Intronic
1053681971 9:40491520-40491542 CGAGCCATGGGGACATGGAGAGG + Intergenic
1054173058 9:61857692-61857714 CCACCGATGGAGGGATGGAGGGG - Intergenic
1054281742 9:63133412-63133434 CGAGCCATGGGGACATGGAGAGG - Intergenic
1054664484 9:67723089-67723111 CCACCGATGGAGGGATGGAGGGG + Intergenic
1056602173 9:88054888-88054910 GCACCCAGGGGGTGCTGGAGGGG + Intergenic
1056904258 9:90631787-90631809 GCACCCAGGGGGAGATGTTGAGG - Intronic
1057706145 9:97396414-97396436 CCACACACACGGCGATGGAGAGG + Intergenic
1060548170 9:124472834-124472856 TCATGCACAGGGAGATGGAGAGG - Intronic
1060826174 9:126689276-126689298 CCGCCCACGGCGAGCTGGTGGGG - Intronic
1061916170 9:133755628-133755650 CCACCAGTGGGGAGAGGGAGAGG + Intergenic
1062364282 9:136201658-136201680 TCACCCACTGGGAGATGGGCTGG - Intronic
1189377154 X:40474970-40474992 CCCCCCGAGGGGAGATGAAGAGG - Intergenic
1193863360 X:86698647-86698669 CCAGCTACTGGGGGATGGAGGGG - Intronic
1196488582 X:116243320-116243342 CCAACCACTGGGACATGGATAGG - Intergenic
1198963836 X:142207677-142207699 CCAGCCACGTGGAGGTGGATAGG - Intergenic