ID: 1152387117

View in Genome Browser
Species Human (GRCh38)
Location 17:79981267-79981289
Sequence ATTTGACGCAAACCAGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152387113_1152387117 -10 Left 1152387113 17:79981254-79981276 CCCGGCTCAGAGGATTTGACGCA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1152387117 17:79981267-79981289 ATTTGACGCAAACCAGGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1152387109_1152387117 11 Left 1152387109 17:79981233-79981255 CCGCACCAATGCACTGCTTGGCC 0: 1
1: 0
2: 1
3: 6
4: 147
Right 1152387117 17:79981267-79981289 ATTTGACGCAAACCAGGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1152387111_1152387117 6 Left 1152387111 17:79981238-79981260 CCAATGCACTGCTTGGCCCGGCT 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1152387117 17:79981267-79981289 ATTTGACGCAAACCAGGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 69
1152387107_1152387117 21 Left 1152387107 17:79981223-79981245 CCAGCATCTTCCGCACCAATGCA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1152387117 17:79981267-79981289 ATTTGACGCAAACCAGGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152387117 Original CRISPR ATTTGACGCAAACCAGGACT GGG Intronic
906346597 1:45019443-45019465 ATATGAGGCAAACCAGGGCAAGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
912580591 1:110717635-110717657 ATTTGAGCCAAACCAATACTTGG - Intergenic
915123010 1:153643719-153643741 ATGTGACTCAAACCAGGATTTGG - Intronic
915884177 1:159705169-159705191 CTTTGACACAAACCAGTCCTTGG - Intergenic
919305649 1:195831987-195832009 ATTTGCCGCAAACCAGCACATGG + Intergenic
920833982 1:209490693-209490715 ATTAGAGGCAAATCTGGACTTGG + Intergenic
921033656 1:211355959-211355981 TTTTAGCGCAAACCAGGAGTCGG - Intronic
1066366329 10:34780299-34780321 ATCTGCCGTAAACCAGTACTTGG - Intronic
1071134110 10:82433714-82433736 ATTTGACAAAAACCAGCAATGGG - Intronic
1073889021 10:108075871-108075893 ATGTGAAGGAAAACAGGACTTGG + Intergenic
1089059996 11:115618625-115618647 AGATGATGCAGACCAGGACTTGG - Intergenic
1102182892 12:110925600-110925622 CTTTGGAGCAAACCAGTACTTGG - Intergenic
1125301187 15:38254296-38254318 ATTTTACGTTAAACAGGACTCGG - Intronic
1125314851 15:38419991-38420013 ATTTGCTGCAAACCAGGAGTTGG - Intergenic
1126179068 15:45767324-45767346 AATTGATGTAAACCAGGAGTTGG - Intergenic
1127797591 15:62451851-62451873 GTTTGACACAAAACAAGACTTGG - Intronic
1132720579 16:1313758-1313780 ATGTGTCGCAGACCAGGGCTGGG + Intronic
1141185354 16:81783110-81783132 ATTAGACAGAAACCAGGACAAGG - Intronic
1149471036 17:56915209-56915231 AATTTATGCAAAGCAGGACTGGG + Intergenic
1152387117 17:79981267-79981289 ATTTGACGCAAACCAGGACTGGG + Intronic
1157109686 18:44808911-44808933 ATCTCACGCAAAGCAGGATTAGG + Intronic
1158584723 18:58721873-58721895 CTCTGACGCAGGCCAGGACTTGG - Intronic
1158906008 18:62012489-62012511 ATTTGGCAAAAGCCAGGACTTGG - Intergenic
925019880 2:560171-560193 ATTTGTCTCCATCCAGGACTTGG + Intergenic
940964964 2:159826832-159826854 ATCTGACACAAACAAGCACTGGG + Intronic
943776412 2:191771268-191771290 GTTTGACTGGAACCAGGACTTGG + Intergenic
945784691 2:214218379-214218401 ATTTGGCACAAACCAGTGCTGGG - Intronic
945909404 2:215630846-215630868 AGTTGACGCAAACAAGCAATGGG - Intergenic
1169198225 20:3694594-3694616 ATGTGACACAGCCCAGGACTGGG + Intronic
1172437285 20:34938387-34938409 ATTTCAGGCAAACCAGGAGAGGG - Intronic
1176195304 20:63834143-63834165 AGGTGACGCACACCAGGCCTGGG + Intergenic
1177840418 21:26229327-26229349 ATTTGCCCCCACCCAGGACTGGG - Intergenic
1178740848 21:35199691-35199713 ATTTCACACAAACCAGGTCAGGG + Intronic
1181157698 22:20934570-20934592 ATTTGGGGCAAACAAGGAATAGG - Intronic
949841045 3:8320452-8320474 GTTTTAAGCCAACCAGGACTGGG - Intergenic
950714944 3:14841430-14841452 ATTTGATACAAACCAGGACAGGG - Intronic
951356761 3:21676839-21676861 ATTTGGTGGAAATCAGGACTTGG - Intronic
953376559 3:42433176-42433198 ATTAGAGACAAACCAGGACATGG + Intergenic
961907019 3:130273454-130273476 TTTTCACGCCAACAAGGACTTGG + Intergenic
972627456 4:40814443-40814465 AGTTCATGAAAACCAGGACTAGG - Intronic
975719471 4:77235974-77235996 ACTTGAAGAAAACCAGGAATAGG - Intronic
978955216 4:114603830-114603852 GTTTTATGGAAACCAGGACTTGG + Intronic
979864169 4:125732804-125732826 ATTTGGCACAAACTAGCACTGGG - Intergenic
981277432 4:142917657-142917679 ATTTGTGGCAAATCAGGACCAGG + Intergenic
982144855 4:152375093-152375115 TTTTAAGGCAAACCAGGATTGGG + Intronic
987066584 5:14295937-14295959 TTCTGACCCAAACCAGAACTTGG - Intronic
987957141 5:24754862-24754884 ATTTGACAAAAACCAGCAATGGG + Intergenic
989485747 5:41989903-41989925 ATTTCACCAAAACTAGGACTGGG + Intergenic
991139357 5:63221890-63221912 ATTTGATGCAAACTAAGATTTGG - Intergenic
995676434 5:114667850-114667872 ATTTGAGGCAACCCAGGAAGAGG + Intergenic
996795350 5:127340671-127340693 AATGGAAGCAAACCAGCACTGGG - Intronic
1000140135 5:158395278-158395300 TTTTAAAGCAAACCTGGACTAGG + Intergenic
1000484705 5:161826575-161826597 ATTTGGGGCAAACCATAACTAGG + Intergenic
1003007768 6:2397617-2397639 ATATGACACAGACCTGGACTGGG - Intergenic
1008366706 6:50689553-50689575 ATTTGAGACTAAACAGGACTTGG - Intergenic
1012969325 6:105710649-105710671 ATTTGGCTCAATTCAGGACTGGG - Intergenic
1017609124 6:156165637-156165659 TTTGGAAGCAAACCAGAACTCGG - Intergenic
1021591808 7:22271901-22271923 CTTTGATGCAAAACAGGTCTGGG - Intronic
1022625793 7:32034575-32034597 ATTTGAAGCCAAGCATGACTGGG - Intronic
1028730962 7:94147929-94147951 TTCTGACACATACCAGGACTGGG + Intergenic
1028850138 7:95528472-95528494 ATTTCAAGCAAACCTAGACTAGG - Intronic
1028935510 7:96459529-96459551 TTTTGACTAAAACCATGACTAGG + Intergenic
1038374362 8:27023660-27023682 ATGTGACCCAAACAAGGCCTCGG + Intergenic
1045212546 8:100113466-100113488 ATCTGACACAAACAAGGAATGGG + Intronic
1051225173 9:14891646-14891668 ATTTGACTCAAACTGGGCCTAGG + Intronic
1058481916 9:105404372-105404394 ATTGCATGCAAACCAGGACCTGG - Intronic
1058483760 9:105422751-105422773 ACTTCACGCAAACCAGAAGTAGG - Intronic
1186066955 X:5776609-5776631 ATTTGTCACATACCTGGACTTGG - Intergenic
1189316690 X:40061830-40061852 ATCTGACACAACCCAGGGCTTGG - Intronic
1192915760 X:75649491-75649513 ACTGGACCCAAACCAGGCCTGGG - Intergenic
1198642826 X:138775602-138775624 ATTTCTTGCAGACCAGGACTCGG + Intronic
1198703504 X:139421918-139421940 ATTTGTAGCAAACCTGCACTGGG - Intergenic
1199474126 X:148227463-148227485 ATTTGAAGCAAGGCAGGAGTTGG - Intergenic