ID: 1152388197

View in Genome Browser
Species Human (GRCh38)
Location 17:79987645-79987667
Sequence CCAGCCAGGGGCTACCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152388197_1152388207 14 Left 1152388197 17:79987645-79987667 CCATGAAGGTAGCCCCTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 1152388207 17:79987682-79987704 CAGCCACAGCCTCCCTCTGCGGG 0: 1
1: 0
2: 6
3: 76
4: 550
1152388197_1152388206 13 Left 1152388197 17:79987645-79987667 CCATGAAGGTAGCCCCTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 1152388206 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 7
3: 75
4: 605
1152388197_1152388210 25 Left 1152388197 17:79987645-79987667 CCATGAAGGTAGCCCCTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 1152388210 17:79987693-79987715 TCCCTCTGCGGGCAGAACCCTGG 0: 1
1: 0
2: 1
3: 19
4: 187
1152388197_1152388212 26 Left 1152388197 17:79987645-79987667 CCATGAAGGTAGCCCCTGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 1152388212 17:79987694-79987716 CCCTCTGCGGGCAGAACCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152388197 Original CRISPR CCAGCCAGGGGCTACCTTCA TGG (reversed) Intronic
900625649 1:3607388-3607410 CCATCCAGGAGCTGCTTTCAGGG - Intronic
902093812 1:13925933-13925955 CCACCCAGGGGAGACCCTCATGG - Intergenic
902414336 1:16230152-16230174 CAGGCCTGGGGCTGCCTTCAGGG + Intergenic
903057790 1:20648500-20648522 CCAGCCAGGGGCAGCCGTCTGGG - Exonic
904402349 1:30265222-30265244 CCAGCCTGGGGCTGCCCTCCAGG + Intergenic
905053837 1:35076259-35076281 CAAGCCAGGGGACACCTTCCAGG + Intronic
905506288 1:38482155-38482177 CCAGCCCTGGGCTAGCCTCATGG - Intergenic
906959906 1:50413901-50413923 CCAGGCAGAGGTGACCTTCATGG + Intergenic
908159748 1:61394810-61394832 CCAGCCAAAGACTACTTTCAAGG - Intronic
910431861 1:87167258-87167280 CTAGACAGGGGCTTCATTCAGGG - Intronic
913159637 1:116133360-116133382 CCAGGCCGGGGCAACCATCAGGG - Exonic
915228767 1:154430382-154430404 CCAGCCACGTGCTCCCCTCAAGG + Intronic
919923155 1:202178139-202178161 CCAGCCTGAGGCCACCTTCCTGG + Intergenic
922583032 1:226712577-226712599 CCAGCCGAGCGCTCCCTTCACGG - Intronic
923145561 1:231195352-231195374 GCAGCTAGCGGCTACCGTCAGGG + Intronic
1063031748 10:2242621-2242643 CCAGCGAGGGGCTCCCTTCCTGG - Intergenic
1064033903 10:11900284-11900306 CCAACCAGGAGCTGCCTCCAGGG + Intergenic
1065162131 10:22933540-22933562 CCCGCCATTGGCTACCTCCAAGG - Intronic
1065190511 10:23203950-23203972 CCAGCCAGGGCTTTCCTTAAAGG + Exonic
1069907138 10:71738593-71738615 CCAGCGAGTGGCTACTGTCAAGG + Intronic
1070383284 10:75900962-75900984 CCAGCCAAGGACTACCTTTTTGG - Intronic
1070660911 10:78304625-78304647 CCAGGCAGGAGCCAGCTTCAGGG - Intergenic
1071060926 10:81570461-81570483 CCAGCCAAGAGCAACCTGCAGGG + Intergenic
1071516083 10:86298770-86298792 CCAGCCTGGGGTTTCCTTGAGGG + Intronic
1072951007 10:99846765-99846787 CCAGCCAGGGGCTAGGCACAGGG - Intronic
1076469051 10:130705882-130705904 CCAGGCAGAGGCTAGCTGCAGGG + Intergenic
1076915634 10:133421994-133422016 CCAGCCTGGGGCATCCTCCATGG - Exonic
1077469956 11:2752925-2752947 CCAGCCAGGGCAGACCTTCCTGG - Intronic
1078099104 11:8319140-8319162 GCAGGCAGGGGCTACCATCCAGG + Intergenic
1078538986 11:12198533-12198555 ACAGCCAGGGGCTTCCTGCCTGG + Intronic
1083294042 11:61705803-61705825 CCACCCAGGGCCCACCCTCAGGG + Intronic
1083644830 11:64166093-64166115 CCAGCCAGCGGCGACCTGCTCGG + Intronic
1084870432 11:72095110-72095132 CCAGCTAGACGCTACCTCCAGGG - Intronic
1087457235 11:98402671-98402693 GCAGCTAGGGGCTACCCTGAGGG - Intergenic
1090393618 11:126405447-126405469 CCAGCCATGGGCTAAGCTCAGGG - Intronic
1091840945 12:3620113-3620135 CCAGCCAGGGGCCTGCTTCCCGG + Intronic
1095344683 12:41135999-41136021 CCAGTGAGGGTCAACCTTCAAGG + Intergenic
1096518802 12:52172680-52172702 CCAGCCAGGACAAACCTTCAGGG - Intronic
1097299602 12:58004130-58004152 CCACCTAAGGGTTACCTTCAAGG - Intergenic
1103132829 12:118483612-118483634 CAAGCTAGGGGATACCTTCCAGG - Intergenic
1103305178 12:119958550-119958572 CCAGCTATGGGCTATCTTGAAGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104332315 12:127858346-127858368 ACAGACTGGGGCTACCTTCTTGG + Intergenic
1108313096 13:49214992-49215014 TCTGCCAGGGGCTCCCTTCCAGG + Intergenic
1112636519 13:101223310-101223332 CAAGCCAGGGGACACCTTCCAGG + Intronic
1113110301 13:106815647-106815669 CCAGCCACTGGCTGCCTACATGG + Intergenic
1115034678 14:28842850-28842872 CCAGCCAGTGGCAACCTGCTTGG + Intergenic
1118002504 14:61536703-61536725 TCAGCGAGGGCCTACATTCAGGG + Intronic
1118327622 14:64792280-64792302 CCAGCCAGGTGCTCCATTCCTGG + Intronic
1121801286 14:96776193-96776215 CCAGCCAAAGCCTCCCTTCAAGG - Intergenic
1124347218 15:28930872-28930894 CCAGCCTGGGGCCGCCTTGAAGG - Intronic
1125356074 15:38818514-38818536 ACAGGCAGGGGCCACCTCCACGG - Intergenic
1128349905 15:66881735-66881757 CCAGCCAGGGGCAAGGCTCAGGG - Intergenic
1128448752 15:67788371-67788393 ACAGCCTGAGGCTACCTTCCTGG - Intronic
1129499710 15:76024172-76024194 CTAGCCAGGGGCAGCCTGCAGGG - Intronic
1129743930 15:78004946-78004968 CCAGCCAGGAGCTGCCTTTCAGG + Intronic
1131006685 15:88984139-88984161 CCAGGCAAGGGCCACCTGCAAGG - Intergenic
1131595087 15:93790183-93790205 CCTGCCAGGGGCTTCCCCCAGGG - Intergenic
1132764811 16:1528982-1529004 CCTGCCCGGGGCTACCATCTCGG - Intronic
1132878933 16:2152780-2152802 CCAGGCTGGGGCTCCCTGCATGG - Intronic
1132882282 16:2167780-2167802 CCAGGCAGGGTCTTCTTTCAGGG - Intronic
1132981711 16:2741572-2741594 CCTGCTAGGGGCTAGCGTCAGGG - Intergenic
1134682810 16:16138289-16138311 CCAGCCTGGGCCTAGGTTCAGGG + Intronic
1135585194 16:23665024-23665046 CCAGGCAGGTTCTTCCTTCATGG + Intronic
1135859145 16:26038977-26038999 CCAGCCTGGTTCTTCCTTCAAGG + Intronic
1135990592 16:27216459-27216481 CCTGCCAAGGGCTGCCTTCCTGG - Intronic
1138551588 16:57751717-57751739 CAGGCCGGGAGCTACCTTCACGG - Exonic
1139431044 16:66911206-66911228 CCAGCCTGGGGACACCTACACGG - Exonic
1141834931 16:86532275-86532297 GGAGCCAGGGGCTGCCTCCATGG + Exonic
1142306545 16:89289149-89289171 CCAGCCAGGAGCTGCCTGCCCGG - Intronic
1144958088 17:19029688-19029710 CCAGACTGGGGCTACCCTCTGGG + Intronic
1144977070 17:19144832-19144854 CCAGACTGGGGCTACCCTCTGGG - Intronic
1146891119 17:36507058-36507080 CCAGGCAGGGGCTGCCTGCCAGG + Exonic
1147533494 17:41302047-41302069 CCAGCCAGTGGCTAACTGCCAGG - Exonic
1148923974 17:51065718-51065740 TCAGTCAGAGGCTACCTGCAGGG - Intronic
1149849939 17:60028324-60028346 CCAGCCAGGGCCTCCTCTCATGG + Intergenic
1149860228 17:60118200-60118222 CCAGCCAGGGCCTCCTCTCATGG - Intergenic
1150170159 17:62986348-62986370 CCTGCCAGGAGCAGCCTTCAGGG + Intergenic
1150295798 17:64006721-64006743 CCAGCCAAGGGCTGCCTGGAGGG + Exonic
1151176760 17:72295022-72295044 CCAGACAAGTGCTACCTTCTTGG + Intergenic
1151319524 17:73344044-73344066 CCAGCCAGGGTCTCTCTGCAGGG + Intronic
1151582794 17:74989568-74989590 CCTGCCAGGGTATACCTTCAGGG - Intronic
1152388197 17:79987645-79987667 CCAGCCAGGGGCTACCTTCATGG - Intronic
1152581378 17:81166795-81166817 TCAGCCAGGTTCTTCCTTCATGG - Intergenic
1155307591 18:24493779-24493801 ACAGCTTGGGGCAACCTTCAGGG - Intergenic
1155369192 18:25080046-25080068 CCAGCCAGGAGCTGCTATCAAGG + Intronic
1157580565 18:48771694-48771716 CCAGCCAGGGGTGACCCTCTGGG - Intronic
1157921079 18:51713138-51713160 TCAGCCAGGGCCTCCCTTCCAGG - Intergenic
1159607070 18:70485703-70485725 CAAGCCAGGGGTTCCCTGCATGG + Intergenic
1161028665 19:2048124-2048146 CCCACCAGGGGCTCCCTCCAGGG - Intronic
1161363220 19:3863212-3863234 GCAGGCAGGGGCTCCCATCAGGG + Intronic
1162723477 19:12676002-12676024 CCAGCCAGCGCTTACCTTGACGG + Exonic
1163657546 19:18556104-18556126 CCAGCCAGGAGCTAATTTAAAGG + Intergenic
1164463736 19:28470239-28470261 CCTGGCAGTGGCTACCTTCAGGG - Intergenic
1165818961 19:38662309-38662331 CCAGCAAGAAGTTACCTTCATGG + Intronic
1166714285 19:44956565-44956587 TCAGCCAGGGCCTGGCTTCAGGG + Intronic
1168516345 19:57013129-57013151 CCATCCAGGGGATACCATCCAGG + Intergenic
1168516356 19:57013157-57013179 CCATCCAGGGGATACCATCCAGG + Intergenic
1168516415 19:57013323-57013345 CCATCCAGGGGATACCATCCAGG + Intergenic
1168516421 19:57013337-57013359 CCATCCAGGGGGTACCTTCCAGG + Intergenic
925853040 2:8102128-8102150 CCAGCCAGGGACTACCACCATGG - Intergenic
926090973 2:10049195-10049217 GCAGCCAGTGGCTACCCTAATGG - Intronic
932579373 2:72983589-72983611 GCAGCCTGGGGTGACCTTCAGGG + Intronic
934768887 2:96895579-96895601 CCAGCCAAGAGTTAGCTTCAGGG - Intronic
935185388 2:100727085-100727107 CCAGCCACAGCCTGCCTTCATGG - Intergenic
935616040 2:105082999-105083021 CCATGCAGGGGATCCCTTCATGG - Intronic
939909496 2:147962870-147962892 CCTGCCAGGGGTAACCTTCTGGG - Intronic
945241012 2:207676909-207676931 CCAGCCCCTGCCTACCTTCAGGG - Intergenic
948773782 2:240269484-240269506 CCAGCCAGGGCTTAACCTCAAGG - Intergenic
1170665335 20:18381512-18381534 CCAGCCTGGGGCAAATTTCACGG + Intergenic
1171034214 20:21703338-21703360 CCAGCCACGGGCGGCCTTCACGG + Intergenic
1174283778 20:49457880-49457902 CCAGTCAGAGGCAATCTTCATGG + Intronic
1175490617 20:59378694-59378716 CCAGCCAGGGGTTTCCTTCAGGG - Intergenic
1175804934 20:61821891-61821913 CCAGCCAGGTGGGCCCTTCAGGG + Intronic
1176026905 20:62990436-62990458 CCAGGCAGGGGCTGCCTCTATGG + Intergenic
1176088406 20:63308345-63308367 CCAGCCAGACCCTACCTGCAAGG - Intronic
1180060479 21:45382507-45382529 TCAGCCAGTGCCTGCCTTCATGG - Intergenic
1181314980 22:21965032-21965054 CCAGCCAGATGTCACCTTCAGGG - Intronic
1182357892 22:29730446-29730468 CCAGCCAGGGGGCTCCTCCAGGG + Exonic
1184492825 22:44820170-44820192 TCAGCCAGGGGCTCCCAACACGG - Intronic
1184654986 22:45936604-45936626 CCAGCCAGGGGGTCCTTTGAGGG - Intronic
1184784280 22:46664289-46664311 CCAGCCATGGGGTGGCTTCAAGG + Intronic
1184821492 22:46912113-46912135 CCAGCCAGTGGATACGTTCAGGG + Exonic
951262470 3:20526729-20526751 CCAGCCAGGCTCTACCATAAAGG + Intergenic
952411983 3:33057636-33057658 CCAGCCAGTGGCTGACCTCAAGG + Intronic
952904342 3:38129726-38129748 CAAGCCAGGGCCTGCCCTCAGGG + Intronic
959550750 3:107653961-107653983 CCATCCAGGTGCTACCTGCATGG - Intronic
961641814 3:128369486-128369508 CCTGGCAGGGGCTACTTTCCAGG - Intronic
961809604 3:129514303-129514325 CCAGCCTGGGGCTCACTCCAAGG + Intronic
962172261 3:133114064-133114086 ACAGCCAGGTGCTTCCTCCAAGG - Intronic
962826666 3:139105472-139105494 CCAGCCCGGGGCTGCTTCCAGGG - Intronic
963838454 3:150080321-150080343 TCAGCCAGCAGCCACCTTCAAGG + Intergenic
968091257 3:195899791-195899813 CCTGCCAGGTTCTCCCTTCAGGG - Intronic
968762607 4:2450428-2450450 CCAGCCCGGGCCTGCCCTCATGG - Intronic
969422837 4:7107382-7107404 CCAGCCTGGGGCTCCCTGCATGG + Intergenic
969452409 4:7282119-7282141 TCAGCCCCGGGCCACCTTCATGG + Intronic
975471343 4:74772590-74772612 CCATCCATGGGCTTTCTTCATGG + Intronic
976733124 4:88284090-88284112 CCAGCCTGCGGCCACATTCAAGG + Intronic
977139413 4:93348934-93348956 CCAGGCAGGGCCTGCCTTCTTGG + Intronic
985162956 4:187063366-187063388 CCGTCCCGGGGCTTCCTTCATGG + Intergenic
985933678 5:3078696-3078718 CATGCCAGGAGGTACCTTCAGGG + Intergenic
986215105 5:5712712-5712734 CCAGTAAGGCCCTACCTTCAGGG - Intergenic
986407515 5:7441041-7441063 TCAGCCAGAGGCTACAGTCAGGG + Intronic
987337020 5:16906108-16906130 CCAGGCAGGAGTTGCCTTCAAGG - Intronic
990734070 5:58841022-58841044 CCCACCAGGGGCAACCTGCAAGG + Intronic
991663138 5:68970317-68970339 CCCCCCAGTGACTACCTTCATGG + Intergenic
999167735 5:149565039-149565061 CCAGCAAGGAGCTACAGTCAAGG + Intronic
999194220 5:149771203-149771225 CCAGGCAGTGGCTGCCTGCAGGG - Intronic
999850069 5:155528271-155528293 CAAACCTGGGGATACCTTCAAGG + Intergenic
1001282416 5:170396285-170396307 CCAGCCTGGGGAGACCCTCAGGG + Intronic
1001690077 5:173626281-173626303 CCAGCAAGGGGCTCCATTCCAGG - Intergenic
1001787189 5:174423981-174424003 GCAGACAGGCGCTTCCTTCAGGG - Intergenic
1001855053 5:175003755-175003777 CCAGCTAGGGGCTGCCCTCAGGG + Intergenic
1002198278 5:177512896-177512918 CCAGTCAGGGGCTAACTGCCTGG + Intronic
1002693783 5:181070598-181070620 GCAGACAGGGTCTGCCTTCAGGG - Intergenic
1003409505 6:5850511-5850533 CCTCCCAGGGAGTACCTTCAGGG + Intergenic
1005460522 6:26065270-26065292 TCAGACAGGCTCTACCTTCATGG + Intergenic
1006714066 6:36103051-36103073 CCACCCAGGAGCTCCCTGCAGGG + Intronic
1007692984 6:43714804-43714826 TCAGCCAGTGGCTGCCTGCAGGG - Intergenic
1013136451 6:107287333-107287355 CCTGTGAGTGGCTACCTTCAAGG - Intronic
1021041000 7:15862217-15862239 CCAGCCAGGGGCTCCTCTGATGG - Intergenic
1024082047 7:45864059-45864081 CGAGGCAGGGGCTGCCTTCCTGG + Intergenic
1024930367 7:54662707-54662729 ACAGCCAGTGCCTAACTTCAGGG + Intergenic
1026044124 7:66893997-66894019 GGAGTCAGGGGCTATCTTCAAGG + Intergenic
1026899103 7:74027498-74027520 CCAACCCGGGCCTACCTTCCAGG + Intergenic
1029250665 7:99233831-99233853 CCAGCCAGGAGCTGCCCTGAGGG - Intergenic
1029580713 7:101435356-101435378 CCAGCCAGGGGCTTCCTCCAGGG - Intronic
1032206415 7:129869760-129869782 AGACCCAGGGGCTGCCTTCATGG + Intronic
1035177764 7:157064442-157064464 CCAGCCATCGCCTACCTTCCAGG - Intergenic
1035795718 8:2354767-2354789 CCAGCCAGGGGGAGCCTGCAGGG - Intergenic
1045958749 8:107941524-107941546 CTAGCCGGGGGCTATCTTAATGG - Intronic
1046818034 8:118606956-118606978 CCAGCCAGGTGGTACCATGAGGG - Intronic
1046888968 8:119400600-119400622 CCAGGCAGGGGCCTGCTTCAGGG + Intergenic
1049553307 8:143270530-143270552 CTGGCCAGGGGCTACCTGGAAGG + Intronic
1049591332 8:143464356-143464378 CCAGCCAGGCCCTACCTCCCCGG + Intronic
1056053015 9:82789542-82789564 TCAGCAAAGGGCTGCCTTCAAGG + Intergenic
1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG + Intronic
1056755807 9:89381433-89381455 GCAGCCAGAGTGTACCTTCAGGG + Intronic
1059462009 9:114437682-114437704 CCTGATAGGGGCTATCTTCATGG - Intronic
1060417141 9:123438967-123438989 CCAGTGAGGGGCTCCTTTCATGG + Intronic
1060508766 9:124217091-124217113 CCAGCCAGGAGCAACCTAGAGGG - Intergenic
1060735848 9:126066225-126066247 CCAGCCAGGGGGCACCATCTGGG + Intergenic
1062491399 9:136806860-136806882 CCAGCCCGGGGCTACCTCCTCGG - Exonic
1062638743 9:137505968-137505990 ACAGCCAGGGCCTACCTTGCTGG + Exonic
1185831682 X:3309465-3309487 CATGCCAGGGGCTTCATTCAGGG - Exonic
1187011880 X:15287866-15287888 CCAGCCCTTGGTTACCTTCACGG + Exonic
1187125441 X:16449966-16449988 CCAGTTATGGGTTACCTTCAGGG + Intergenic
1189335144 X:40166599-40166621 CCAGCCTGGGGCTGCAGTCAGGG - Intronic
1189614253 X:42767762-42767784 CAAGCCAGGGGACACCTTCCAGG + Intergenic
1190219742 X:48504132-48504154 CCACACCGGGGCTACCCTCAAGG + Intergenic
1190627137 X:52346797-52346819 AAAGCCAGGGGCTGCCTTCCTGG + Intergenic
1190700891 X:52989333-52989355 ACAGCCAGGGGCTGCCTTCCTGG - Intronic
1192573815 X:72227044-72227066 CAAGCCAGGGGACACCTTCCAGG + Intronic
1195976593 X:110534016-110534038 CCAACCAGGGGCTACTTACTAGG - Intergenic
1201244317 Y:11987614-11987636 CATGCCAGGGGCTTCATTCAGGG + Intergenic