ID: 1152388205

View in Genome Browser
Species Human (GRCh38)
Location 17:79987681-79987703
Sequence CCGCAGAGGGAGGCTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 813
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 737}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152388205_1152388221 21 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388221 17:79987725-79987747 GGAGCTGGTTCTCAGGGAAAAGG 0: 1
1: 0
2: 4
3: 37
4: 432
1152388205_1152388222 22 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388222 17:79987726-79987748 GAGCTGGTTCTCAGGGAAAAGGG 0: 1
1: 0
2: 1
3: 29
4: 268
1152388205_1152388214 -1 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388214 17:79987703-79987725 GGCAGAACCCTGGGTGCTGCAGG 0: 1
1: 0
2: 2
3: 44
4: 310
1152388205_1152388219 14 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388219 17:79987718-79987740 GCTGCAGGGAGCTGGTTCTCAGG 0: 1
1: 0
2: 5
3: 27
4: 275
1152388205_1152388212 -10 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388212 17:79987694-79987716 CCCTCTGCGGGCAGAACCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 157
1152388205_1152388220 15 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388220 17:79987719-79987741 CTGCAGGGAGCTGGTTCTCAGGG 0: 1
1: 0
2: 3
3: 32
4: 391
1152388205_1152388215 0 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388215 17:79987704-79987726 GCAGAACCCTGGGTGCTGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 234
1152388205_1152388217 6 Left 1152388205 17:79987681-79987703 CCAGCCACAGCCTCCCTCTGCGG 0: 1
1: 0
2: 4
3: 71
4: 737
Right 1152388217 17:79987710-79987732 CCCTGGGTGCTGCAGGGAGCTGG 0: 1
1: 1
2: 7
3: 72
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152388205 Original CRISPR CCGCAGAGGGAGGCTGTGGC TGG (reversed) Intronic
900136656 1:1120487-1120509 CCGCTGGGGGAAGCTGTGGTGGG + Intergenic
900303548 1:1990369-1990391 CGGGAGAGGGAGACAGTGGCGGG + Intronic
900331663 1:2137842-2137864 CAGCAGAGCGGGGCTGTGGTGGG - Intronic
900461323 1:2803338-2803360 CCGGACAGGGAGGCCGAGGCCGG + Intergenic
900573834 1:3373341-3373363 CCGCAAAGGCACGCTGGGGCGGG - Intronic
900822799 1:4902122-4902144 CAGCAGAGGGACGCTGGGCCTGG + Intergenic
901286414 1:8082756-8082778 TCCCAGCGGGAGGCTGAGGCAGG + Intergenic
901293559 1:8143484-8143506 CCCCAGCGGCAGCCTGTGGCAGG - Intergenic
901319268 1:8329854-8329876 CCTCGGAGGGAGGATGTGCCCGG + Intronic
901325169 1:8361127-8361149 GCGCTGTGGGAGCCTGTGGCTGG + Exonic
901517758 1:9760773-9760795 GCTCTGAGGGAGGCTGAGGCAGG - Intronic
901547126 1:9966364-9966386 ACGCTGTGGGAGGCTGAGGCAGG + Intronic
901828904 1:11880252-11880274 GCGGAGGTGGAGGCTGTGGCAGG + Intergenic
901847743 1:11994993-11995015 CAGCACTGGGAGGCTGAGGCAGG + Intronic
901906143 1:12413359-12413381 CTGTAGGGGGAGGCTGAGGCAGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902727183 1:18344939-18344961 CTGCAGAGGGAGGCATGGGCTGG + Intronic
902838688 1:19062069-19062091 CTGCAGATGCAGGGTGTGGCTGG - Intergenic
903039607 1:20518871-20518893 TCCCAGTGGGAGGCTGAGGCAGG + Intergenic
903203705 1:21764460-21764482 GCGCAGTGGGAGGCCGAGGCTGG + Intronic
903533866 1:24053512-24053534 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
903828884 1:26163192-26163214 CAGGAAAGGGAGGCAGTGGCAGG - Intergenic
903902620 1:26659082-26659104 GGGCAGGGGGAGGCTGAGGCAGG + Intergenic
904036307 1:27561051-27561073 CAGAGGAGGGAGGCTCTGGCAGG - Intronic
904271002 1:29350053-29350075 CTGCAGAGTGAGGGTGTGACGGG - Intergenic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904992488 1:34604366-34604388 GAGGAGAGGGAGGCTGTGGAAGG + Intergenic
905160661 1:36030725-36030747 CAGCATTGGGAGGCTGAGGCGGG - Intronic
905213769 1:36392407-36392429 CCACTCAGGGAGGCTGAGGCAGG + Intronic
905364070 1:37439263-37439285 CTGCACAGAGAGGCTGAGGCAGG + Intergenic
905438583 1:37977590-37977612 CCACTGTGGGAGGCTGAGGCAGG + Intronic
905463071 1:38134002-38134024 CCGAGGAGGGAGGCGGCGGCCGG + Intergenic
905641873 1:39595541-39595563 ACGGAGAAGGAGGCTGTTGCAGG - Intergenic
905790562 1:40787045-40787067 CCAGAGACGCAGGCTGTGGCAGG + Intronic
906191328 1:43901254-43901276 GCCCTGAGGGAGGCTGTGACAGG - Intronic
906467959 1:46101392-46101414 AGGCTGAGGGAGGCTGAGGCAGG + Intronic
906634207 1:47397400-47397422 CCGGTGAGGGAGGCTGTAGAAGG - Intergenic
906660480 1:47578219-47578241 CCGCAGGGCGAGGGTGGGGCAGG - Intergenic
907010070 1:50954650-50954672 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
907439887 1:54472632-54472654 CAGCAGAAGCTGGCTGTGGCTGG + Intergenic
907964928 1:59319757-59319779 AGGCAGAGGGAGCCTGTGGAGGG + Intronic
908512535 1:64860872-64860894 GCGGTGGGGGAGGCTGTGGCAGG + Intronic
908512555 1:64860992-64861014 GCGGTGGGGGAGGCTGTGGCAGG + Intronic
908603794 1:65771169-65771191 CAGCAGAGGGAGGCTTAGTCTGG - Intergenic
909901148 1:81137336-81137358 GCGCTGTGGGAGGCTGAGGCGGG - Intergenic
910316932 1:85896604-85896626 ACTCAGGGGGAGGCTGAGGCAGG - Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910689109 1:89948006-89948028 CAGCATTGGGAGGCTGAGGCGGG - Intergenic
910770161 1:90822885-90822907 CGACAGAGGGAGGCTCTGACTGG + Intergenic
910997300 1:93120182-93120204 AGGCTGAGGGAGGCTGAGGCAGG + Intronic
911607769 1:99928135-99928157 AGGCTGAGGGAGGCTGAGGCAGG - Intergenic
912828535 1:112929249-112929271 CCCCAGATGGAGGCTGGGGCTGG - Exonic
913291840 1:117280744-117280766 TTTCAGAGGGAGGCTGAGGCAGG + Intergenic
915490755 1:156248852-156248874 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
915529721 1:156496405-156496427 GGGCAGAGGCAGGCTGTGCCAGG + Intronic
916108424 1:161447117-161447139 AAGCCGAGGGAGGTTGTGGCTGG + Intergenic
916111597 1:161461908-161461930 AAGCCGAGGGAGGTTGTGGCTGG + Intergenic
916526137 1:165611363-165611385 CCCGGGAGGGAGGCTGAGGCAGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918024805 1:180732979-180733001 ATGCAGAGGTTGGCTGTGGCAGG - Intronic
918071962 1:181139749-181139771 GGCCAGAGGGAGGATGTGGCTGG + Intergenic
918500286 1:185187304-185187326 AAGCCGAGGGAGGCTGAGGCAGG - Intronic
919977020 1:202619357-202619379 CCGGAGAGGGAGGCTGGGGGTGG + Intronic
920008688 1:202852192-202852214 CCACATGGGGAGGCTGAGGCAGG + Intergenic
920044251 1:203123380-203123402 CAGCAGAGGGAGGCAGTGTTAGG - Intronic
920501551 1:206488478-206488500 CCTCACAAGGATGCTGTGGCAGG + Intronic
921257149 1:213352791-213352813 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
921713835 1:218398829-218398851 CCACTGTGGGAGGCTGAGGCAGG - Intronic
921724825 1:218512137-218512159 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
921848077 1:219905172-219905194 CTGCAGAGGGAGGCAGAGGCAGG + Intronic
922161265 1:223080594-223080616 TGGCAGAGTGAGGCTGGGGCCGG - Intergenic
922801902 1:228368285-228368307 GTGGAGAGGGAGGCTGGGGCTGG + Intronic
922845954 1:228684281-228684303 GCACAGTGGGAGGCTGAGGCGGG - Intergenic
922964177 1:229674270-229674292 GGGGAGAGGGAGGCTGTGGGCGG - Intergenic
923048462 1:230372881-230372903 CCACAGAGGAAGGCTGGGCCAGG - Intronic
924726080 1:246672074-246672096 GCACTTAGGGAGGCTGTGGCAGG + Intergenic
1063449250 10:6140501-6140523 AGCCAGAGAGAGGCTGTGGCAGG + Intergenic
1063515354 10:6689767-6689789 ACACAGAGGAAGGCTGTGGGAGG - Intergenic
1064086640 10:12350178-12350200 GCGGAGAGGGCGGCGGTGGCAGG - Intronic
1064589205 10:16871286-16871308 CAGCACAGGGAGGCTGAGGCAGG - Intronic
1065580432 10:27165594-27165616 CCACATTGGGAGGCTGAGGCAGG + Intronic
1065667903 10:28082713-28082735 GCGCTGAGGGAGGCTGAGGCAGG - Intronic
1066392835 10:34992477-34992499 GCACTGAGGGAGGCTGAGGCAGG + Intergenic
1067690514 10:48498536-48498558 GGGCAGAGGGAGGCTGCAGCGGG - Intronic
1068526259 10:58133698-58133720 CCGCAGCGGGAGGCTCAGGTGGG + Intergenic
1069787541 10:70998302-70998324 CAGGACAGGGATGCTGTGGCAGG + Intergenic
1070166335 10:73900956-73900978 CTGGAGATGGAGGCTGAGGCAGG + Intergenic
1071573702 10:86711458-86711480 CCGGAGAGGGAGGTGGAGGCAGG - Intronic
1071840185 10:89462432-89462454 CTCCAGATGGAGGCTGGGGCTGG - Exonic
1072162600 10:92782333-92782355 CAGCACTGGGAGGCTGAGGCCGG + Intergenic
1072187956 10:93060432-93060454 CGGCAGAGGGAGCCAGCGGCCGG + Intergenic
1072583149 10:96757721-96757743 TCCCAGCGGGAGGCTGAGGCGGG + Intergenic
1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG + Exonic
1072624843 10:97104667-97104689 AGGGAGAGGGAGGCTGTAGCTGG - Intronic
1072637292 10:97186111-97186133 CGGGAGAGGGGGGCTGCGGCGGG - Intronic
1072721317 10:97782625-97782647 CCCTGGAGGGAGGCTGTGGCCGG - Intergenic
1072974915 10:100049203-100049225 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1073168408 10:101478825-101478847 CCTCTGTGGGAGGCTGAGGCAGG + Intronic
1073392716 10:103192897-103192919 CCGCGCTGGGAGGCTGAGGCGGG + Intronic
1073403167 10:103275538-103275560 CCAGAGGGGCAGGCTGTGGCAGG + Intergenic
1074109827 10:110414918-110414940 CGGCAGAGGGTGGCAGTGGGTGG + Intergenic
1074503132 10:114044026-114044048 GCGCAGAGGGAGGTCGCGGCCGG - Intergenic
1075119258 10:119651998-119652020 GCGCAGCGGGAGTGTGTGGCGGG - Intronic
1075752203 10:124782248-124782270 GCACAAAGGGAGGCTGAGGCGGG + Intronic
1075865973 10:125719615-125719637 CCGCAGCGGGAGGCGGGGCCGGG + Exonic
1076218682 10:128715988-128716010 CCGGAGAGAGAGGCTGCGCCCGG + Intergenic
1076351061 10:129815678-129815700 GAGCAGAGGGCGGTTGTGGCAGG + Intergenic
1076615417 10:131751460-131751482 CCCCAGTGGGAGGCTGAGGAAGG - Intergenic
1076868416 10:133180919-133180941 CCGCAGAGACTGGCTGCGGCTGG + Intronic
1076874771 10:133210748-133210770 CCCCAGGGGGAAGCTCTGGCGGG - Intronic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1077131213 11:973683-973705 CAGGAGAGGGAGGGTGGGGCTGG + Intronic
1077368598 11:2171293-2171315 GGGCAGAGGGAGGCAGGGGCAGG + Intronic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1077493358 11:2872437-2872459 CTCGAGAGGGAGGCTGAGGCAGG - Intergenic
1077550338 11:3197390-3197412 CCCCAGGGTGAGGCTGGGGCGGG - Intergenic
1078569959 11:12449263-12449285 CCGTGGAGGGAGGCTGAGGCGGG - Intronic
1079135362 11:17773446-17773468 CCTCGGTGGGAGGCTGTTGCTGG - Intronic
1080255197 11:30282436-30282458 CCTCAGGCAGAGGCTGTGGCCGG - Intergenic
1080277954 11:30524139-30524161 ACTCAGTGGGAGGCTGAGGCAGG + Intronic
1081873164 11:46392230-46392252 CCCCAGCGGGAGGCTGCGGGTGG + Intergenic
1082960753 11:58916642-58916664 CCTCAGAGGAAGGCTTTGACTGG - Intronic
1083157344 11:60832283-60832305 CCACAGAGGTAGGCTGGTGCTGG + Intergenic
1083211490 11:61190104-61190126 CAGCATTGGGAGGCTGAGGCAGG + Intergenic
1083264184 11:61538609-61538631 CTGCAGAGGTGGCCTGTGGCTGG + Intronic
1083401933 11:62429543-62429565 CCACTGTGGGAGGCTGAGGCAGG + Intergenic
1083636166 11:64122220-64122242 GAGAAGATGGAGGCTGTGGCGGG - Intronic
1083675945 11:64324684-64324706 CTGGGGAGGGAGGCTGAGGCAGG + Intergenic
1083678302 11:64340160-64340182 CTGCACAGGGTGTCTGTGGCTGG + Intergenic
1083693460 11:64426289-64426311 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1083757095 11:64797473-64797495 ACACAGAGGGAGGCTGGAGCTGG - Intronic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1084265861 11:68004752-68004774 CTGCAGCGGGAGCCTGTGGTGGG + Intronic
1084502792 11:69544741-69544763 CCACAGAGCGAGGCTGAAGCGGG + Intergenic
1084529141 11:69716937-69716959 ACACAGTGGGAGCCTGTGGCAGG - Intergenic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1085098970 11:73784242-73784264 GCGCTTAGGGAGGCTGAGGCAGG - Intergenic
1085205836 11:74731385-74731407 CCGCGGAGGGAGGCTGAGCGCGG + Intronic
1085354915 11:75827361-75827383 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1085511665 11:77091316-77091338 CAGCAGAGGGTGGCAGAGGCAGG - Intronic
1085524515 11:77156637-77156659 CTGCAGAGGGAGGGAGTGGCAGG - Intronic
1085525424 11:77160923-77160945 CCCCCGGGGGAGGGTGTGGCTGG + Intronic
1085626611 11:78078835-78078857 AGGCTGAGGGAGGCTGAGGCAGG - Intronic
1087241923 11:95789886-95789908 CCACAAAGGGAGGATGTCGCCGG + Intronic
1087473210 11:98603347-98603369 CCCAGGAGGGAGGCTGAGGCAGG + Intergenic
1087749491 11:101990924-101990946 CCACTCAGGGAGGCTGAGGCAGG + Intronic
1089127398 11:116186331-116186353 CCGAGGTGGGAGGCTGAGGCAGG + Intergenic
1089538272 11:119173868-119173890 TGGCACAGGGAGGCTGGGGCAGG - Exonic
1089545208 11:119219129-119219151 GCACTGAGGGAGGCTGAGGCTGG + Intronic
1089734591 11:120541021-120541043 CTGGAGAGAGAGGCTGGGGCAGG - Intronic
1089735524 11:120547971-120547993 ACTCAGAGGGTGGCTGTGGGAGG + Intronic
1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG + Exonic
1090755760 11:129789791-129789813 CCACTTTGGGAGGCTGTGGCGGG + Intergenic
1090920006 11:131198912-131198934 TAGCAGAGGCAGCCTGTGGCTGG - Intergenic
1090963743 11:131580414-131580436 CCTCAGAGGGCAGGTGTGGCAGG - Intronic
1091014766 11:132040034-132040056 CTCCAGAGGGAGGCTGAGGCAGG - Intronic
1091527309 12:1315997-1316019 CTGCTGGGGGAGGCTGAGGCAGG - Intronic
1091797143 12:3303938-3303960 CTGCAGGGGGAGGCAGAGGCTGG + Intergenic
1092039217 12:5368827-5368849 CTGCAGAGGGGGTCTGGGGCAGG - Intergenic
1092276601 12:7066080-7066102 CTACCGAGGGAGGCTGAGGCAGG + Intronic
1092808617 12:12251040-12251062 CCTACGAGGGAGGCTGAGGCAGG - Intronic
1092987965 12:13865383-13865405 GCGCTGTGGGAGGCTGAGGCAGG + Intronic
1093485529 12:19647961-19647983 CAGCTGTTGGAGGCTGTGGCTGG + Intronic
1093916528 12:24808546-24808568 GCTACGAGGGAGGCTGTGGCAGG - Intergenic
1094684833 12:32701026-32701048 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1096165169 12:49416597-49416619 TCCCAGTGGGAGGCTGAGGCAGG - Intronic
1096646068 12:53036655-53036677 CCCCATTGGGAGGCTGAGGCAGG - Intronic
1096665790 12:53163258-53163280 CCACAGTGGGAGTCTGAGGCAGG + Intronic
1096725098 12:53555071-53555093 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1097169892 12:57106698-57106720 CTGCAGAAGGGGGCTGAGGCTGG - Exonic
1097439837 12:59596074-59596096 GCGGAGAAGGAGGCGGTGGCGGG - Intronic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1098102690 12:67035300-67035322 CTGCTGAGGGGGGCTGAGGCAGG - Intergenic
1098355357 12:69607622-69607644 AGGCTGAGGGAGGCTGAGGCAGG + Intergenic
1098431093 12:70420939-70420961 TCCCAGCGGGAGGCTGAGGCAGG + Intronic
1098548747 12:71739939-71739961 ACTCGGAGGGAGGCTGAGGCAGG - Intergenic
1099572959 12:84348518-84348540 CCTCAGACAGAAGCTGTGGCTGG + Intergenic
1100162116 12:91872484-91872506 TGGCAGAGAGAGGCTGAGGCAGG + Intergenic
1100306540 12:93355062-93355084 GCACATAGGGAGGCTGTGGCAGG + Intergenic
1100486403 12:95032344-95032366 CAGCACAAGGAGGCTGAGGCAGG + Intronic
1100595405 12:96067581-96067603 GCACTGTGGGAGGCTGTGGCGGG + Intergenic
1101090872 12:101283794-101283816 CAACAGTGGGAGGCTGAGGCAGG - Intronic
1101520303 12:105475995-105476017 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1102031428 12:109742054-109742076 CCACAGAAAGAGGCTGGGGCAGG + Intronic
1102151379 12:110690772-110690794 CCACAGAGTGAGACTGTTGCCGG - Intronic
1102454828 12:113065020-113065042 TGGCAGAGGGAGGCTGTGATGGG + Intronic
1103567970 12:121826622-121826644 CAGCAGAGGGAGGTTGTGAGAGG + Intronic
1103780802 12:123397637-123397659 CAGCAGTGGGAGGCTGTGCTAGG + Intronic
1103825101 12:123731794-123731816 GAGGAGAGGGAGGATGTGGCTGG - Intronic
1103846012 12:123902517-123902539 CCTTAGAGGGTGGCTCTGGCTGG + Intronic
1103965673 12:124637901-124637923 CACCCGAGGTAGGCTGTGGCAGG + Intergenic
1104137188 12:125951836-125951858 CAACACTGGGAGGCTGTGGCAGG - Intergenic
1105491235 13:20890550-20890572 GCGCTTAGGGAGGCTGAGGCAGG + Intronic
1108011996 13:46025416-46025438 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1109262762 13:60163681-60163703 CCGCGGAGAGAGGCTGAGGAAGG + Exonic
1109478738 13:62919626-62919648 CCGGAGAGGGATGAGGTGGCAGG + Intergenic
1110068467 13:71141411-71141433 GCGCATTGGGAGGCTGAGGCTGG + Intergenic
1110430693 13:75419648-75419670 CCACAGAGGGAGGCTGAAGTGGG + Intronic
1111922319 13:94425244-94425266 CTGCTGAGGGAGGCTGTGTGAGG + Intergenic
1112280170 13:98056024-98056046 GTACAGAAGGAGGCTGTGGCTGG + Intergenic
1112554051 13:100450280-100450302 AGGCTGAGGGAGGCTGAGGCAGG + Intronic
1112996824 13:105584646-105584668 CTGCTTAGGGAGGCTGAGGCGGG + Intergenic
1113248073 13:108420816-108420838 GCGCTTAGGGAGGCTGAGGCAGG - Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113371346 13:109728219-109728241 GCGCAGAGGGAGGCGGACGCAGG + Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113755978 13:112811274-112811296 CGGCAGAGGGAGGGTGTGTGTGG - Intronic
1113857205 13:113453814-113453836 CCGCAGCGGGCGGCAGTGACAGG - Intergenic
1114493431 14:23117433-23117455 CCGCAGAGTTAGGCCGTGCCAGG + Exonic
1114555996 14:23562654-23562676 GCGCATTGGGAGGCTGAGGCGGG + Intronic
1115784124 14:36805153-36805175 ACGCTGAGGGAGGCTGTGTTTGG + Intronic
1116326169 14:43535634-43535656 CCGCAGGGGGAGCCTGTGGCAGG - Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117137194 14:52747743-52747765 CCTCAATGGGAGGCTGAGGCAGG + Intronic
1117175790 14:53145250-53145272 GCGCTGTGGGAGGCTGAGGCAGG + Intronic
1117378817 14:55139512-55139534 CCACTGTGGGAGGCTGAGGCAGG + Intronic
1117551647 14:56843108-56843130 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1119268610 14:73280938-73280960 CCCAACAGGGAGGCTGAGGCAGG - Intronic
1119459769 14:74790993-74791015 GCGCTGTGGGAGGCTGAGGCAGG + Intronic
1120289182 14:82545231-82545253 CCACTCAGGGAGGCTGAGGCAGG + Intergenic
1120340022 14:83207864-83207886 CCACTTAGGGAGGCTGAGGCAGG + Intergenic
1120535450 14:85689620-85689642 AGGCTGAGGGAGGCTGAGGCAGG + Intergenic
1120839962 14:89076885-89076907 CTGCAGAGGTAGGCAGGGGCTGG + Intergenic
1121546915 14:94769621-94769643 CCGCAGTGGGCGGCAGAGGCCGG + Intronic
1121732314 14:96195173-96195195 TTCCAGAGGGTGGCTGTGGCTGG + Intergenic
1121756375 14:96406163-96406185 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1123986584 15:25651700-25651722 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1124103494 15:26716902-26716924 CCCCAGAGCTAGGCTGTGGTTGG - Intronic
1124581849 15:30962822-30962844 CTGCAGAGAGAGGCCGGGGCAGG + Intronic
1125565025 15:40670607-40670629 GCGCATGGGGAGGCTGAGGCAGG - Intergenic
1125578735 15:40771303-40771325 CGGGAAAGGGAGGCTGTGCCGGG + Exonic
1126339186 15:47620827-47620849 TGGCAGAGGGAAGCTGAGGCAGG + Intronic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1127588267 15:60398018-60398040 TCGCCTAGGGAGGATGTGGCGGG - Intronic
1127859694 15:62983009-62983031 CTGCTGGGGGAGACTGTGGCGGG + Intergenic
1127927065 15:63557180-63557202 CCCCCTTGGGAGGCTGTGGCAGG - Intronic
1128240247 15:66096600-66096622 CAGCAGAGGGGTGCTGTGACAGG + Intronic
1128715832 15:69907450-69907472 GCACTGAGGGAGGCTGAGGCAGG - Intergenic
1128828806 15:70747353-70747375 CCTAAAAGGGAGGCTGAGGCGGG - Intronic
1129305271 15:74656291-74656313 CCACATTGGGAGGCTGAGGCAGG + Intronic
1129814417 15:78539633-78539655 CCGCTTTGGGAGGCTGAGGCAGG - Intergenic
1130447099 15:84013526-84013548 GTGCAGTGGGAGGCTGAGGCGGG + Intronic
1130526244 15:84709275-84709297 CTGCTCAGGGAGGCTGAGGCAGG - Intronic
1130552076 15:84895636-84895658 CAGGAGAGGGAGGTTGTGGAGGG + Intronic
1131201991 15:90406409-90406431 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1131387808 15:92021836-92021858 CGCCCGAGGGAGGCTGTGGGAGG + Intronic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1132027868 15:98418136-98418158 CCCCACAGAGCGGCTGTGGCTGG - Intergenic
1132612575 16:824640-824662 CGGGAAAGGGATGCTGTGGCAGG + Intergenic
1132669400 16:1096496-1096518 AGGCAGATGGAAGCTGTGGCTGG + Intergenic
1132682996 16:1151522-1151544 CCGTGGAGGGAGGCTGGAGCAGG - Intergenic
1132912317 16:2320643-2320665 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133171659 16:3985819-3985841 CCAGAGGGGGAGGCTGTGGCAGG - Intronic
1133214553 16:4283682-4283704 ACAGAGAGGGAGGCAGTGGCGGG - Intergenic
1133296894 16:4758311-4758333 CCTGAGAGGGAAGCTGTGTCTGG + Intronic
1133302548 16:4791626-4791648 CAGGAGGAGGAGGCTGTGGCAGG - Intronic
1134167204 16:11940490-11940512 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1134274749 16:12766144-12766166 CCCCAAAGGGAGGCAGAGGCGGG + Intronic
1134283750 16:12841826-12841848 CAGCTCAGGGAGGCTGAGGCAGG - Intergenic
1134386606 16:13779373-13779395 GCCCAGTGGGAGGCTGAGGCGGG - Intergenic
1134581685 16:15376668-15376690 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135312599 16:21417949-21417971 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135327699 16:21537780-21537802 GCGCTGTGGGAGGCTGAGGCAGG - Intergenic
1135365547 16:21850402-21850424 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1135446292 16:22520934-22520956 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1136054849 16:27680692-27680714 TTGCAGAGGGAGGGTGGGGCGGG + Intronic
1136230100 16:28880711-28880733 CCGCTGAGTAAGGCGGTGGCAGG + Intronic
1136309301 16:29396901-29396923 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136322719 16:29498457-29498479 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1136376448 16:29868326-29868348 CTCGGGAGGGAGGCTGTGGCAGG + Intergenic
1136383102 16:29906073-29906095 TCGCAGGGAGAGGCTGGGGCAGG + Intronic
1136437401 16:30238425-30238447 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1137521594 16:49199825-49199847 CCGCTTTGGGAGGCTGAGGCGGG - Intergenic
1137608226 16:49801181-49801203 ACAGAGAGGCAGGCTGTGGCAGG - Intronic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138402752 16:56760835-56760857 CTACAGGGGGAGGCTGAGGCAGG + Intronic
1138594510 16:58022638-58022660 CCCCTGGGGGAGGATGTGGCTGG + Intergenic
1138812508 16:60167259-60167281 GCTACGAGGGAGGCTGTGGCAGG + Intergenic
1139364837 16:66427053-66427075 CCGCCGAGGGGGGCCGGGGCCGG + Intergenic
1139851032 16:69951709-69951731 ACGCCGAGGGGCGCTGTGGCTGG + Intronic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140206846 16:72940156-72940178 CAACACAGGGAGGCTGAGGCAGG - Intronic
1140822972 16:78680161-78680183 GCACTGAGGGAGGCTGAGGCTGG + Intronic
1140825663 16:78703505-78703527 ACTCAGAGGGAGGCTGAAGCAGG + Intronic
1140838089 16:78814136-78814158 CGGCAGCGGGAGGATCTGGCCGG - Intronic
1141627742 16:85270215-85270237 CCGCAGAGTTGTGCTGTGGCAGG - Intergenic
1141852813 16:86658928-86658950 CAGCAGGTGGAGGCTGTGGCAGG + Intergenic
1142217173 16:88835551-88835573 CAGCAGAGGAGGGCTGTGGTGGG - Intronic
1142264821 16:89058817-89058839 CTGCCCAGGGAGGCTGAGGCTGG - Intergenic
1142279040 16:89138187-89138209 CCACAGGGAGAGGCTGTGGGAGG - Intronic
1142523240 17:519586-519608 CTGCACAGGGAGGATGGGGCAGG - Intronic
1142594608 17:1023378-1023400 CTGCACAGGGAGGCAGTGGTGGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142708292 17:1709940-1709962 GCGCACAGGGAGACTGCGGCCGG - Intronic
1142737527 17:1910751-1910773 CCGGAGGTGGAGGCTGAGGCTGG - Intergenic
1143065407 17:4243443-4243465 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1143109134 17:4543782-4543804 CCCAGGAGGGAGGCGGTGGCAGG - Intronic
1143465127 17:7131390-7131412 CCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1143522226 17:7451386-7451408 CCGGGGAGGGAGGCTGAGGCAGG - Intronic
1143575133 17:7787902-7787924 CCGCAGCGGGATACAGTGGCCGG - Exonic
1143642840 17:8209257-8209279 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1143988272 17:10934380-10934402 CCCCAGAGGTATGCTGTGGGGGG + Intergenic
1144992625 17:19244210-19244232 CAGCACTGGGAGGCTGAGGCTGG + Intronic
1145416658 17:22718881-22718903 GAGCAGAGGGAGTGTGTGGCTGG - Intergenic
1145797196 17:27662583-27662605 GCGCTGAGGGAGGCTGTTTCAGG - Intergenic
1146043669 17:29483322-29483344 CCACTGCGGGAGGCTGAGGCAGG - Intronic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1146656071 17:34636016-34636038 CCGCTGACGGAGGCTGTGCTCGG + Exonic
1146841862 17:36161904-36161926 GCGCTGAGGGAGGCTGTTTCAGG + Intergenic
1146854172 17:36249864-36249886 GCGCTGAGGGAGGCTGTTTCAGG + Intronic
1146870076 17:36373756-36373778 GCGCTGAGGGAGGCTGTTTCAGG + Intronic
1146877433 17:36424837-36424859 GCGCTGAGGGAGGCTGTTTCAGG + Intronic
1146941310 17:36846119-36846141 TTGGAGAGGGGGGCTGTGGCAGG - Intergenic
1146991680 17:37279534-37279556 AGGCTGAGGGAGGCTGAGGCAGG + Intronic
1147072957 17:37974380-37974402 GCGCTGAGGGAGGCTGTTTCAGG + Intergenic
1147084479 17:38053918-38053940 GCGCTGAGGGAGGCTGTTTCAGG + Intronic
1147100426 17:38177884-38177906 GCGCTGAGGGAGGCTGTTTCAGG + Intergenic
1147460553 17:40565431-40565453 CCACACAGGAAGGCTGTGCCCGG + Exonic
1147665946 17:42148160-42148182 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG + Intergenic
1148027046 17:44595566-44595588 CAGCAGAGGGAGGTGGTGCCTGG + Intergenic
1148109745 17:45137712-45137734 GCCCAGAGGGAAGCTGTGGAGGG - Exonic
1148272102 17:46269418-46269440 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1149997591 17:61412915-61412937 CCTCCGAAGGGGGCTGTGGCTGG + Exonic
1150488326 17:65559272-65559294 GCGCAGAGGGAGGGGGTGGGTGG - Intronic
1150493432 17:65589819-65589841 CAGCACTGGGAGGCTGAGGCGGG + Intronic
1150555328 17:66249018-66249040 AGGCTGAGGGAGGCTGAGGCAGG + Intronic
1150764610 17:67993495-67993517 CCGCAGAGGGACGCGGAGCCCGG - Exonic
1150774994 17:68074153-68074175 ACTCAGGGGGAGGCTGAGGCAGG + Intergenic
1150988215 17:70224020-70224042 CCGCTTTGGGAGGCTGAGGCTGG + Intergenic
1151554658 17:74840647-74840669 CCTGGGAGGAAGGCTGTGGCAGG - Intergenic
1151565872 17:74897995-74898017 CTGCTGAGGGAGGCTGAGGCAGG - Intergenic
1151815392 17:76469163-76469185 ACGGAGATGAAGGCTGTGGCAGG - Exonic
1151898014 17:76993427-76993449 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1151966681 17:77435163-77435185 GCTCAGAGGGAGGCTTGGGCAGG - Intronic
1152207046 17:78979867-78979889 CTGCAGAGGGATCCTGTGGCTGG - Exonic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152468678 17:80478790-80478812 CCGCAGAGGAAGGGAGTGGACGG + Intergenic
1152560417 17:81075835-81075857 CCTCATATGGAGCCTGTGGCTGG - Intronic
1152569489 17:81115444-81115466 CCTCACTGGGAGGTTGTGGCTGG + Intronic
1152605630 17:81288284-81288306 CGGCAGAGTGAGGAGGTGGCGGG - Intronic
1152606607 17:81294760-81294782 CCGCAGAGGGGGCGTCTGGCTGG - Intronic
1153649590 18:7228340-7228362 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1153891902 18:9524770-9524792 ATGCAGAGGCAGGCTGTGGCAGG - Intronic
1154118480 18:11632603-11632625 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155271280 18:24143780-24143802 ACACTGTGGGAGGCTGTGGCAGG - Intronic
1155536262 18:26821360-26821382 CTGCTGTGGGAGGCTGAGGCAGG + Intergenic
1157314421 18:46576005-46576027 CTGCAGAGGGATGTTGAGGCTGG - Intronic
1157384123 18:47247701-47247723 GCGCCGAGGGCGGCTGAGGCGGG + Intronic
1157413248 18:47481519-47481541 AGGCAGAGGTGGGCTGTGGCTGG - Intergenic
1157485155 18:48081568-48081590 ACTTAGAGGGAGGCTGAGGCAGG - Intronic
1157830150 18:50850167-50850189 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1157843405 18:50980196-50980218 TCCCAGTGGGAGGCTGAGGCAGG + Intronic
1158954044 18:62523256-62523278 CCGGCGAGGGGGGCGGTGGCCGG - Exonic
1159946180 18:74446372-74446394 CCACAGTGGGAGGCAGAGGCCGG - Intronic
1160633339 18:80262615-80262637 CCCCAGAGGGGAGGTGTGGCTGG - Intergenic
1160797814 19:953825-953847 GCGCTGTGGGAGGCTGAGGCAGG + Intronic
1160906529 19:1454023-1454045 CAGCAGAGGGAGGCAGGGTCTGG + Intronic
1161324900 19:3658905-3658927 CCGACGAAGGAGGCTGTGGGGGG - Intronic
1161327687 19:3671410-3671432 CCACAGAGGGAAACTGAGGCAGG - Intronic
1161349746 19:3785139-3785161 CCCCAGAGGGAAACTGAGGCAGG + Intronic
1161840856 19:6679480-6679502 CCGCAGAGGAAAGCTGTACCCGG - Exonic
1162088460 19:8262316-8262338 CAGCAGCTGGATGCTGTGGCTGG + Exonic
1162426560 19:10600287-10600309 CAGCAACGGGAGGCTGAGGCAGG + Intergenic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162686299 19:12387611-12387633 CCGCTTTGGGAGGCTGAGGCAGG - Intronic
1162690616 19:12427131-12427153 CCGCTTTGGGAGGCTGAGGCAGG - Intronic
1162796052 19:13088284-13088306 CCCGGGAGGGAGGCTGTGGTTGG - Intronic
1162873172 19:13600973-13600995 CTCAAGAGGGAGGCTGAGGCAGG - Intronic
1163507961 19:17719497-17719519 CCGAAGATGGCGGCGGTGGCTGG + Exonic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1163803479 19:19382349-19382371 CCACACTGGGAGGCTGAGGCGGG + Intergenic
1163931460 19:20397155-20397177 CTACACAGGAAGGCTGTGGCAGG + Intergenic
1164226208 19:23248746-23248768 CCACTTAGGGAGGCTGAGGCCGG + Intronic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164521406 19:28982811-28982833 CCGGAGGTGGAGGCTGTGGTGGG + Intergenic
1164976870 19:32580377-32580399 CTGCAGTGGGCAGCTGTGGCTGG - Intergenic
1165002524 19:32776683-32776705 CAGGAGAGAGAGGCTGTGGCAGG + Intronic
1165023526 19:32942993-32943015 CAGCAGCTGGAGGCTGAGGCAGG - Intronic
1165023532 19:32943031-32943053 CGGCAGCTGGAGGCTGAGGCAGG - Intronic
1165089041 19:33373203-33373225 GCGCCGAGGGAGGCCGAGGCGGG - Intergenic
1165724644 19:38104250-38104272 CCGCTGAAGGAGGCTGTAGGAGG + Intronic
1165770583 19:38377739-38377761 AGGCTGAGGGAGGCTGAGGCAGG - Intronic
1165796268 19:38521582-38521604 CCTGAGTGGGAGGCTGAGGCAGG + Intronic
1165842428 19:38797188-38797210 TCGCAGAGGGGGGATTTGGCAGG + Intergenic
1165911919 19:39234437-39234459 GTCCAGAGGGAGGCTGTGCCTGG - Intergenic
1166075936 19:40413787-40413809 CCGCAAAGAGAAGCTGTGACTGG - Intergenic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1166333006 19:42089528-42089550 CCGGAGGGGGCGGCTGGGGCAGG - Intronic
1166765657 19:45251284-45251306 CGGCGGAGGGAGGCGGTGGAGGG - Exonic
1166793215 19:45410131-45410153 CAGCACTGGGAGGCTGAGGCAGG - Exonic
1166843689 19:45713405-45713427 CCGCAGAAGGCGGGCGTGGCTGG + Exonic
1167059093 19:47132207-47132229 CCACTTTGGGAGGCTGTGGCGGG - Intronic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167156146 19:47740499-47740521 CAGCATTGGGAGGCTGAGGCGGG + Intronic
1167232294 19:48292597-48292619 AGGCTGAGGGAGGCTGAGGCAGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1168373907 19:55859679-55859701 CCACTGTGGGAGGCTGAGGCAGG + Intronic
1202675331 1_KI270711v1_random:229-251 GCGCTTAGGAAGGCTGTGGCAGG + Intergenic
925375015 2:3378024-3378046 CCGCGGAGGCCGGCTGTGGGTGG + Intergenic
926127695 2:10282066-10282088 CAGCAGAGGGAAGCTGGGGAGGG + Intergenic
926128487 2:10286114-10286136 CAGCAGAGGGAAGCTGAGGAGGG + Intergenic
926196460 2:10766285-10766307 TGGCAGAGCGAGGCTGAGGCGGG - Intronic
926975132 2:18507700-18507722 CTACAGCGGGAGGCTGAGGCAGG - Intergenic
927514002 2:23661462-23661484 ACGCAGGGGGAGGCTATGCCAGG - Intronic
927707210 2:25303788-25303810 CCGCAGAGGGAACCTCAGGCAGG - Intronic
927711962 2:25331804-25331826 CCCCAGGGGGAGGCTGAGCCAGG - Intronic
927754519 2:25698059-25698081 GAGGAGAGGGAGGCTGGGGCCGG + Intergenic
927820557 2:26260326-26260348 CCGCTTTGGGAGGCTGAGGCAGG - Intronic
927911323 2:26901948-26901970 CCTCTGAAAGAGGCTGTGGCAGG + Intronic
927915104 2:26930574-26930596 CAGCACTGGGAGGCTGCGGCAGG + Intronic
928510274 2:31996430-31996452 CAGCTGAGGGAGGCTAAGGCAGG + Intronic
928551854 2:32380478-32380500 CAGCTGAGGGAGGCTGAGGCGGG + Intronic
929514265 2:42592148-42592170 CAGCTAAGGGAGGCTGAGGCAGG + Intronic
929524856 2:42692671-42692693 GCGCTTTGGGAGGCTGTGGCAGG - Intronic
929660977 2:43784549-43784571 TCCCAGCGGGAGGCTGAGGCAGG - Intronic
929784488 2:44979482-44979504 CTCCGGAGGGAGGCTGAGGCAGG - Intergenic
931267583 2:60674195-60674217 CTGCAAAGGGAGGCTGAGGCAGG + Intergenic
931841879 2:66159980-66160002 AAGCAGAGGGAGGCTGAGGCAGG + Intergenic
932531382 2:72537353-72537375 CAGCACTGGGAGGCTGAGGCAGG + Intronic
933852797 2:86384661-86384683 CTACTGAGGGAGGCTGAGGCAGG + Intergenic
934650763 2:96090118-96090140 CCTGAGAGAGGGGCTGTGGCAGG + Intergenic
934883830 2:98007377-98007399 CCTGAGAAGGGGGCTGTGGCTGG + Intergenic
934987201 2:98896086-98896108 CGGGAGTGGGGGGCTGTGGCAGG + Intronic
935636653 2:105254318-105254340 CCTCACAGGCAGGCTGTGTCAGG + Intergenic
936115356 2:109698104-109698126 CAGCACAAGGAGGCTGAGGCAGG - Intergenic
936267663 2:111022754-111022776 CAGCAGAGGGAGGCGAGGGCAGG + Intronic
936704387 2:115054664-115054686 CCACTTAGGGAGGCTGAGGCAGG + Intronic
937123101 2:119454237-119454259 CGGCAGAGTGGGGCTGGGGCAGG + Intronic
937245215 2:120488123-120488145 CCTCAGAGGGAGGGTGGGCCTGG - Intergenic
937291465 2:120784680-120784702 CAGCAGATGGAGGCTGTGTCTGG - Intronic
937851396 2:126639440-126639462 GCACAGAGGGAGGTTGGGGCAGG - Intergenic
937944410 2:127319262-127319284 CCTGAGAGAGAGGCTGAGGCTGG + Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938293455 2:130162451-130162473 GCACAGAGGAAGGCTGTGGAGGG - Intronic
938414164 2:131090838-131090860 CCACTGGGGGAGGCTGAGGCAGG - Intronic
938463098 2:131510510-131510532 GCACAGAGGAAGGCTGTGGAGGG + Intergenic
938715166 2:134012835-134012857 CCACTCAGGGAGGCTGAGGCAGG + Intergenic
938792639 2:134690530-134690552 CAGCACTGGGAGGCTGAGGCTGG - Intronic
939065066 2:137473329-137473351 CTGTAGTGGGAGGCTGAGGCAGG - Intronic
939925815 2:148172479-148172501 AGGCAGAGGGTGGCTGGGGCAGG + Intronic
940353740 2:152717600-152717622 ACGCCGAGTGAGGCTGAGGCTGG - Exonic
940536158 2:154947634-154947656 ACGCTGCGGGAGGCTGAGGCAGG - Intergenic
941898085 2:170650926-170650948 GCGCAGTGGGAGGCTGAGGCGGG - Intronic
941932172 2:170953107-170953129 CCGCTTTGGGAGGCTGAGGCGGG + Intronic
942419940 2:175797273-175797295 CAGCAGAGGGACGCTGGGCCCGG - Intergenic
942443932 2:176065880-176065902 CTGCTCAGGGAGGCTGAGGCAGG + Intergenic
944894570 2:204150963-204150985 CAGCAGAGGGAAGCTGCGGCAGG + Intergenic
945737192 2:213615342-213615364 CAGCACTGGGAGGCTGAGGCGGG + Intronic
946301131 2:218824577-218824599 CTGCAGAGGGTGGTTGTGGGGGG + Intronic
946401804 2:219472256-219472278 CCGCAGGTGGTGGCTGTGACGGG + Exonic
946622232 2:221572793-221572815 TGGCAGAGGGTGGCGGTGGCAGG - Intronic
946631348 2:221672457-221672479 CCACAGAGGAAGGGTGGGGCGGG - Intergenic
947454862 2:230244836-230244858 AGGCAGAGCAAGGCTGTGGCGGG + Intronic
947591885 2:231390558-231390580 CCAGAGAGAGAGGCTGTGGAGGG + Intergenic
947624552 2:231611626-231611648 GGGCAGAGAGAGGCTGGGGCAGG + Intergenic
947676829 2:231989588-231989610 GCACTGAGGGAGGCTGAGGCCGG + Intronic
948403069 2:237698364-237698386 CCCAAGCTGGAGGCTGTGGCTGG + Intronic
948405880 2:237718493-237718515 CCACATAGGGAGGCTGCGGAAGG + Intronic
948458069 2:238116459-238116481 ACGGAGAGTGGGGCTGTGGCAGG + Intronic
948957645 2:241306371-241306393 CAGCTGTGGGAGGCTGAGGCAGG - Intronic
1168927084 20:1590735-1590757 CCGCACAGTGAGGCTGTGGCAGG + Intronic
1168935284 20:1659818-1659840 CCTCATAGTGAGGCTGGGGCAGG + Intergenic
1168938478 20:1688492-1688514 CCCCACAGTGAGGCTGGGGCAGG + Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1170003418 20:11640068-11640090 GCGCTGTGGGAGGCTGAGGCAGG + Intergenic
1170711736 20:18797604-18797626 GGGCAGAGTGAGGCTGTGGGAGG + Intergenic
1171005454 20:21461085-21461107 TAGTAGAGGGAGGCTGAGGCGGG - Intergenic
1171013749 20:21522390-21522412 CCGCGCCGGGCGGCTGTGGCAGG + Intergenic
1171032849 20:21692445-21692467 CCGCAGAGGGAAGCAAAGGCAGG - Intergenic
1171382216 20:24742508-24742530 TCTCAGAGGGAGACTTTGGCAGG + Intergenic
1171502427 20:25604031-25604053 CCCCACAGGGTGGCTGTGTCAGG + Intergenic
1172635610 20:36407829-36407851 CCGCAGAAGTAGGCAGGGGCAGG + Intronic
1172849214 20:37948511-37948533 CAGGAGAGGGAGGCTGAGGCAGG + Intergenic
1172963929 20:38819396-38819418 CTGCTTAGGGAGGCTGAGGCGGG + Intronic
1173234533 20:41232699-41232721 CCCCCGCGGGAGGCTGAGGCAGG - Intronic
1173529779 20:43760414-43760436 GCACAGTGGGAGGCTGAGGCGGG + Intergenic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1173831183 20:46089723-46089745 CCGGACGGGGAGGCTGAGGCGGG - Intronic
1173839006 20:46144818-46144840 CCTCAGAAGGTGGGTGTGGCTGG + Intergenic
1174346389 20:49933205-49933227 CAGCAGGAGGAGGCTGAGGCGGG - Intergenic
1175145561 20:56893466-56893488 GCTCACAGGAAGGCTGTGGCAGG - Intergenic
1175429762 20:58892422-58892444 CGCCAAAGGGAGGCTTTGGCGGG + Intronic
1175522593 20:59611692-59611714 CCGGAGAGGGAGGCAGGGGTAGG - Intronic
1175814077 20:61874527-61874549 CCCCAGAGGGAGGCCCTGGGCGG + Intronic
1176062607 20:63178902-63178924 CCGCAGAGGGCGGCGGGGCCCGG + Intergenic
1176125704 20:63473560-63473582 CCCCAGAAGGGGCCTGTGGCAGG + Intergenic
1176192443 20:63818427-63818449 CTGCAGAGGGAGGGTGGGCCAGG + Intronic
1176230712 20:64031426-64031448 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1176367569 21:6043159-6043181 CCGCAAAGGGAAGCTGGGGCGGG + Intergenic
1176429020 21:6564815-6564837 CCGCAGAAGGAGGCCAGGGCTGG - Intergenic
1177006731 21:15682556-15682578 CAGCAGAGGGAGGTTGTGGTCGG - Intergenic
1177732898 21:25051943-25051965 TCCCAGCGGGAGGCTGAGGCAGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178704383 21:34861320-34861342 CCGCAGAGGGAGGCAGGTCCTGG + Intronic
1178916426 21:36707934-36707956 CGGCAGTGGGGGGCTGGGGCTGG + Intronic
1178932255 21:36829814-36829836 CCGCAGAGGGAAGGAGGGGCAGG + Intronic
1179458997 21:41521066-41521088 ACCCAGAGGGAGGCAGTTGCAGG + Intronic
1179704509 21:43173131-43173153 CCGCAGAAGGAGGCCAGGGCTGG - Intergenic
1179755950 21:43495383-43495405 CCGCAAAGGGAAGCTGGGGCGGG - Intergenic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180758267 22:18178360-18178382 GTGCAGATGGAGGCAGTGGCTGG - Intergenic
1180768555 22:18362152-18362174 GTGCAGATGGAGGCAGTGGCTGG - Intergenic
1180777755 22:18500239-18500261 GTGCAGATGGAGGCAGTGGCTGG + Intergenic
1180810481 22:18757550-18757572 GTGCAGATGGAGGCAGTGGCTGG + Intergenic
1180826430 22:18865376-18865398 GTGCAGATGGAGGCAGTGGCTGG - Intergenic
1180893326 22:19307799-19307821 GCGCATTGGGAGGCTGTGGCAGG - Intergenic
1181138099 22:20783503-20783525 CTGGGGAGGGAGGCTGAGGCAGG + Intronic
1181196625 22:21191805-21191827 GTGCAGATGGAGGCAGTGGCTGG + Intergenic
1181212902 22:21301319-21301341 GTGCAGATGGAGGCAGTGGCTGG - Intergenic
1181424299 22:22823001-22823023 ACGCGGAGGGAGGCTGAGTCAGG - Intronic
1182478885 22:30593527-30593549 CTGGAGAGGGTGGCAGTGGCTGG + Intronic
1182578904 22:31291945-31291967 CCACAGAAGGAGGCTGGGGAAGG + Intronic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1183465830 22:37980005-37980027 CCGCAGAGGAATGCTGCTGCCGG - Intronic
1183484738 22:38082817-38082839 CCCCAGACGGCGGCTGGGGCTGG - Exonic
1183486202 22:38088952-38088974 CTGTAGAGCGAGGCTGTGGGCGG + Exonic
1183535648 22:38398988-38399010 CCGGAGGCGGAGTCTGTGGCGGG - Intergenic
1183729227 22:39608001-39608023 TCCCAGCGGGAGGCTGAGGCAGG + Intronic
1183797347 22:40130669-40130691 CCCCCGCGGGAGGCTGAGGCAGG + Intronic
1183916142 22:41121055-41121077 CCGCTTTGGGAGGCTGAGGCAGG + Intronic
1184410995 22:44326395-44326417 CAGCAGAGGGAGGGGATGGCCGG - Intergenic
1184425986 22:44409601-44409623 TCGCAGAGGAAGGCTGGTGCTGG - Intergenic
1184454393 22:44600938-44600960 CCCCAGAGAGAGGAGGTGGCCGG - Intergenic
1184515192 22:44957423-44957445 CCCCAGAGGAAGGCTGTGAGGGG - Intronic
1185001021 22:48245842-48245864 CAGCAGTAGGAGGCTGAGGCGGG + Intergenic
1185346611 22:50313351-50313373 CTGGAGCAGGAGGCTGTGGCTGG - Intronic
1203230173 22_KI270731v1_random:103040-103062 GTGCAGATGGAGGCAGTGGCTGG - Intergenic
1203276573 22_KI270734v1_random:91282-91304 GTGCAGATGGAGGCAGTGGCTGG - Intergenic
949359546 3:3216984-3217006 CCTCACAGGGAGGCAGTTGCGGG - Intergenic
950158804 3:10743635-10743657 CCCTAGAGGGAGACTGAGGCTGG + Intergenic
950182846 3:10927272-10927294 TGGCAGAGGGAGGCAGGGGCTGG + Intronic
950476235 3:13216549-13216571 TTGCAGAGGGGAGCTGTGGCTGG + Intergenic
950710634 3:14810766-14810788 CCGCGGAGGGAGGCGGTGTGCGG + Intergenic
950843699 3:15993675-15993697 AGGCTGAGGGAGGCTGAGGCAGG - Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951738905 3:25898514-25898536 CAGCTGCGGGAGGCTGAGGCAGG - Intergenic
951780677 3:26359972-26359994 CCAAATAGGGAGGCTGAGGCAGG - Intergenic
951908805 3:27728947-27728969 CCGCAGAGAGCGGCTGTCGAGGG + Intergenic
952255054 3:31687823-31687845 CAACAGTGGGAGGCTGAGGCAGG + Intronic
952944329 3:38467329-38467351 CCCAGGAGGGAGGCTGAGGCAGG + Intronic
953289957 3:41650506-41650528 GCGCTGTGCGAGGCTGTGGCTGG - Intronic
953324975 3:42005335-42005357 CCACTTTGGGAGGCTGTGGCAGG - Intergenic
954028005 3:47798389-47798411 CGGCACTGGGAGGCTGAGGCGGG - Intergenic
954185350 3:48912797-48912819 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
954658309 3:52211529-52211551 CCGCACAGGGATGATGTGGCTGG - Exonic
954685868 3:52369870-52369892 CCACAGCGGGAGACTGTAGCTGG - Exonic
954707877 3:52490665-52490687 GGACAGAGGGAGGCGGTGGCAGG - Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955283276 3:57614728-57614750 TAGCAGAGGGAGGCCGAGGCGGG + Intergenic
956707440 3:72011509-72011531 CCACCCAGGGAGTCTGTGGCTGG - Intergenic
956822101 3:72963324-72963346 CAGCACTGGGAGGCTGAGGCGGG + Intronic
957053673 3:75428668-75428690 GCACATAGGGAGGCTGAGGCAGG - Intergenic
957417998 3:79930249-79930271 GCTCTGAGTGAGGCTGTGGCTGG - Intergenic
957445243 3:80308029-80308051 CTGCAGGGGGAGCCTCTGGCAGG - Intergenic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
958012606 3:87899614-87899636 CAGCTGTGGGAGGCTGAGGCGGG + Intergenic
958416534 3:93881074-93881096 CAGCACTGGGAGGCTGAGGCAGG + Intronic
958531346 3:95335439-95335461 TCCCAGAGGGAGGCTGAAGCGGG - Intergenic
960493380 3:118345790-118345812 ACACTGTGGGAGGCTGTGGCAGG + Intergenic
960662736 3:120078796-120078818 TCCCAGAGGGAGGCTGAGGCTGG - Intronic
960706338 3:120485486-120485508 CCACAGAGGATGGATGTGGCTGG + Intergenic
961364921 3:126393590-126393612 CTGCAGAGGTAGGCTGGGGCCGG + Intergenic
961381631 3:126499486-126499508 GCCCAGAGGGAGGCTGGGGAAGG + Intronic
961387556 3:126530923-126530945 GCGCAGAGGGGGCCTGAGGCAGG + Intronic
961453776 3:127014458-127014480 CAGCTGAGGGAGGCAGAGGCTGG - Exonic
961505730 3:127369563-127369585 CTGCAGAGGGAGGTGGTGGGAGG - Intergenic
961542269 3:127608185-127608207 TCCCAGAGGGATGGTGTGGCAGG + Intronic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
962518559 3:136176576-136176598 CAGCATTGGGAGGCTGAGGCAGG + Intronic
962586446 3:136847063-136847085 AGGCTGAGGGAGGCTGAGGCAGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
964101125 3:152989705-152989727 TCGCTTTGGGAGGCTGTGGCGGG - Intergenic
964216500 3:154290522-154290544 TCCCAGTGGGAGGCTGAGGCAGG + Intronic
967339627 3:188382032-188382054 CCACACTGGGAGGCTGAGGCAGG - Intronic
968403019 4:315062-315084 CAGCAGAGGGACGCTGGGCCTGG + Intergenic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
969457340 4:7307530-7307552 CAGCAGAGCCAGGCTGGGGCAGG + Intronic
969658841 4:8514521-8514543 GCACATAGGGAGGCTGAGGCGGG - Intergenic
971729638 4:30361050-30361072 CAGCAGTAGGAGGCTGTGGTGGG + Intergenic
971753285 4:30678187-30678209 CAGCAGAGGGAGCCTGGGCCCGG - Intergenic
972548822 4:40108422-40108444 ACTCAGGGGGAGGCTGAGGCAGG - Intronic
972667422 4:41180534-41180556 GGGCAGAGGGAGGGTGAGGCTGG + Intronic
973015768 4:45135117-45135139 CAGCAGAGGGAGCCTGGGCCTGG + Intergenic
973283653 4:48390184-48390206 ACTAAGAGGGAGGCTGAGGCAGG - Intronic
973328168 4:48885095-48885117 ACTGAGAGGGAGGCTGAGGCAGG - Exonic
975570839 4:75816209-75816231 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
975661127 4:76689726-76689748 ACGGAGAGGGAGGCGGGGGCCGG + Intronic
976753288 4:88472105-88472127 CCACAGAGGGAGGCTGAGACAGG - Intronic
976790287 4:88870651-88870673 CTGCAGAGGCAGGCTGCGGTAGG - Intronic
977442981 4:97093765-97093787 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
977901845 4:102431241-102431263 ACGCTGAGGGAGGCTGAGGCGGG + Intronic
979576993 4:122304455-122304477 CCACATTGGGAGGCTGAGGCAGG - Intronic
980161960 4:129175357-129175379 CCACTGTGGGAGGCTGAGGCAGG + Intergenic
981877744 4:149568538-149568560 CCACTTAGGGAGGCTGCGGCAGG + Intergenic
982116856 4:152105204-152105226 CTGCAGAGCCAGGCTGGGGCCGG + Intergenic
982206001 4:152997579-152997601 CCACTGTGGGAGGCTGAGGCGGG - Intergenic
982701914 4:158666167-158666189 CCAGCGAGGGAGGCTGAGGCAGG + Intergenic
983026500 4:162743869-162743891 ACTCAGTGGGAGGCTGAGGCAGG + Intergenic
983373918 4:166899616-166899638 AGGCTGAGGGAGGCTGAGGCAGG - Intronic
984616083 4:181899810-181899832 CCACACTGGGAGGCTGAGGCGGG - Intergenic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
984910793 4:184672666-184672688 CAGCAGAGGATGGCTGTGGCTGG + Intronic
985256397 4:188074347-188074369 CCGCTTTGGGAGGCTGAGGCAGG + Intergenic
985666106 5:1182258-1182280 CCTCTTAGGGAGGCTGAGGCAGG - Intergenic
986504486 5:8434522-8434544 CCACTGTGGGAGGCTGAGGCGGG - Intergenic
986787179 5:11125213-11125235 CTAGAGAGAGAGGCTGTGGCTGG - Intronic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
988075168 5:26342973-26342995 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
989331266 5:40261701-40261723 CCACATTGGGAGGCTGAGGCAGG + Intergenic
989612391 5:43307317-43307339 CCACTTTGGGAGGCTGTGGCGGG - Intronic
990431581 5:55740279-55740301 TCGCTGAGGGAGGTTGAGGCAGG - Intronic
991143608 5:63274857-63274879 GAGCTGAGGGAGGCTGAGGCAGG + Intergenic
991577012 5:68115212-68115234 CCACTTAGGGAGGCTGAGGCAGG - Intergenic
992551220 5:77862151-77862173 CCACAGAGGTGGGCTGGGGCTGG - Intronic
992820168 5:80488204-80488226 CCGCAAAGGGAGGGTACGGCCGG - Intronic
992939483 5:81749959-81749981 CCGAGGAGGGCAGCTGTGGCGGG - Intronic
993186675 5:84630633-84630655 GCACAGGGGGAGCCTGTGGCAGG + Intergenic
993968990 5:94393958-94393980 CAGCTGAGGGAGGCTGAGACAGG - Intronic
995396625 5:111693875-111693897 CAGCTGAGAGAGGCTGAGGCAGG + Intronic
995807612 5:116070922-116070944 CCTCAAAGGGAGGCTTTGGGTGG + Intergenic
996770460 5:127080292-127080314 CCTCAGAGACAGGCTGGGGCAGG + Intergenic
997961203 5:138323175-138323197 CCGCTTTGGGAGGCTGAGGCAGG - Intronic
998039515 5:138943642-138943664 CCGCCTGGGGAGGCTGTGGAAGG - Intergenic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
998149241 5:139747537-139747559 CGGCTGAGGAAGGCTGTTGCCGG + Intergenic
998225487 5:140323284-140323306 GAGCAGAGGGAGGCAGTGTCAGG + Intergenic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
1000029718 5:157391090-157391112 CAGGAGAGGGAGGCTGTGTCTGG + Intronic
1001133976 5:169087214-169087236 CTGCAGGGGGTGGCTGTGGCAGG + Intronic
1001821254 5:174712200-174712222 CCGCTTTGGGAGGCTGAGGCAGG - Intergenic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002119790 5:176993759-176993781 CCACATTGGGAGGCTGAGGCAGG + Intronic
1002292295 5:178208187-178208209 CTGCAGTGGCAGGGTGTGGCAGG + Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002450465 5:179315555-179315577 CCGGAGGTGGAGACTGTGGCTGG - Intronic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002611444 5:180421134-180421156 ACTCAGCGGGAGGCTGAGGCAGG + Intergenic
1002912318 6:1499538-1499560 TCCCAGTGGGAGGCTGAGGCAGG - Intergenic
1003093262 6:3122031-3122053 GCGCTTAGGGAGGCTGAGGCAGG + Intronic
1005576798 6:27197573-27197595 CCACTGTGGGAGGCTGAGGCGGG - Intergenic
1006055000 6:31377691-31377713 CCTCAGCGGGAGGCTGCAGCAGG - Intergenic
1006353673 6:33540736-33540758 AGGCTGAGGGAGGCTGAGGCAGG + Intergenic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007353706 6:41294603-41294625 CCACAGAGGGAGGGTGTGGTGGG - Intergenic
1007366309 6:41396548-41396570 GCGCACAGGGAGCCTGGGGCAGG - Intergenic
1007724550 6:43907178-43907200 GCTCTGAGGGAGGCTGTGGGAGG - Intergenic
1008760392 6:54846677-54846699 CCGCGGAGGGAGGCTGATTCCGG - Intergenic
1008944772 6:57086050-57086072 CTGTAGAGAGAGGCTGAGGCGGG - Intergenic
1010732338 6:79404446-79404468 CAGCAGAGGGAAGAAGTGGCTGG + Intergenic
1011350205 6:86414714-86414736 CTGTAGAAGGAGACTGTGGCAGG + Intergenic
1012253666 6:97008177-97008199 CAGCAGAGGGAGGTTGTGGTGGG + Intronic
1013538878 6:111087943-111087965 CCCCCGAGGGCGGCTGGGGCTGG + Exonic
1013809580 6:114029234-114029256 CAGCTTTGGGAGGCTGTGGCAGG - Intergenic
1013819079 6:114134011-114134033 CGGTAGTGGGAGGCGGTGGCTGG + Intronic
1016746909 6:147590657-147590679 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1017493299 6:154962840-154962862 CCACAGTGGGAGGCGGGGGCTGG - Intronic
1017608074 6:156154303-156154325 TCCCAGTGGGAGGCTGAGGCAGG + Intergenic
1018226818 6:161636645-161636667 CCACTGTGGGAGGCTGAGGCAGG + Intronic
1018242883 6:161795478-161795500 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1018255399 6:161913060-161913082 CCTCCCAGGGAGGCTGAGGCAGG + Intronic
1018272669 6:162096976-162096998 AGGCTGAGGGAGGCTGAGGCAGG - Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018775312 6:167009275-167009297 CCACATTGGGAGGCTGAGGCGGG + Intronic
1019261274 7:83434-83456 GCGTAGAGAGAGGCTCTGGCAGG + Intergenic
1019352917 7:563329-563351 CTGCAGAGGCAGCCTGTGGAGGG - Intronic
1019355974 7:579156-579178 CTCCAGAGGGAGGGTGAGGCGGG + Intronic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1019919076 7:4151287-4151309 CTGCAGAGGGTGACTGTGCCAGG - Intronic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020543559 7:9493497-9493519 CAGTAGCGGGAGGCTGTGGGTGG + Intergenic
1021162925 7:17298638-17298660 CGGCGGCGGGAGGCAGTGGCTGG + Exonic
1021466751 7:20952743-20952765 CTACTGAGGGAGGCTGAGGCAGG + Intergenic
1022103411 7:27182438-27182460 CAGTAGAGGGAGGGTGTGGTGGG + Exonic
1022652410 7:32289296-32289318 ACTCAGAGGCAGGCTGAGGCAGG + Intronic
1022715010 7:32891455-32891477 CCGGGGAGGAGGGCTGTGGCGGG - Intronic
1022715959 7:32898785-32898807 GCACATAGGGAGGCTGAGGCAGG - Intergenic
1022989590 7:35694820-35694842 GCGCGGAGGGCGGCGGTGGCGGG - Exonic
1023176763 7:37443064-37443086 CCCCAGAGGAAGGGTGTGTCAGG + Intronic
1023918572 7:44608607-44608629 CCTCAGCAGGAGGCTGAGGCAGG + Intronic
1024313303 7:47990416-47990438 TCGGAGAGGGGGGATGTGGCAGG - Intronic
1024930466 7:54663190-54663212 CCGAACAGGGAGGCTATGGACGG - Intergenic
1025097294 7:56106281-56106303 ACGCAGAGGGAGGCCGCGGGCGG - Intronic
1025257671 7:57396407-57396429 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1025729546 7:64097842-64097864 CAGCACTGGGAGGCTGAGGCAGG + Intronic
1025941380 7:66078163-66078185 CCGCTGGGGGAGGCGGTGCCAGG + Intronic
1026047677 7:66918689-66918711 CAACAGTGGGAGGCTGAGGCAGG - Intergenic
1026262909 7:68771193-68771215 CCTTAAAGGGAGGCTGAGGCAGG + Intergenic
1026290093 7:68998405-68998427 TCGCATTGGGAGGCTGAGGCAGG - Intergenic
1026315686 7:69225245-69225267 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1027121080 7:75520869-75520891 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1027884654 7:83889419-83889441 CCACATTGGGAGGCTGAGGCAGG + Intergenic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1029172540 7:98641233-98641255 GCGCACTGGGAGGCTGAGGCCGG - Intergenic
1029479081 7:100802203-100802225 CTGGAGAGGGAGGCTGGGGCAGG - Intergenic
1032197191 7:129796285-129796307 ACGCAGAGGGAGGCTGAGGAGGG - Intergenic
1033155262 7:138951225-138951247 CTCCAGAGGGAGGATGCGGCTGG - Intronic
1033325117 7:140371285-140371307 CAGCTGAGGGAGGCTGAGGCAGG - Intronic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1034135604 7:148765517-148765539 CTGCACAGGGAGGCTGAGGCAGG + Intronic
1034172330 7:149071899-149071921 CTGCTGCGGGAGGCGGTGGCTGG + Exonic
1034206765 7:149323235-149323257 CAGCTGTGGGAGGCTGAGGCAGG - Intergenic
1034278190 7:149833456-149833478 GCGCATTGGGAGGCTGAGGCAGG - Intergenic
1034418346 7:150976766-150976788 GCCCAGGGGGAGGCTGTGGGCGG - Intronic
1034458634 7:151186157-151186179 GGGTGGAGGGAGGCTGTGGCAGG - Intronic
1034885367 7:154794578-154794600 CCGCTGGGGGAGGCTGTCGGCGG - Intronic
1034972990 7:155430772-155430794 CCGCACAGGAAGGCTGTGGAGGG + Intergenic
1035428710 7:158800634-158800656 ACACAGGGGGAGGCTGAGGCAGG - Intronic
1035917083 8:3636422-3636444 CCACTGTGGGAGGCTGAGGCGGG - Intronic
1036382764 8:8248614-8248636 ACTCACAGGGAGGCTGAGGCAGG + Intergenic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1037805873 8:22057649-22057671 GTGAAGAGTGAGGCTGTGGCAGG + Intronic
1037865873 8:22441525-22441547 GGGCGGAGGGAGGCTGGGGCCGG + Intronic
1038370266 8:26981928-26981950 CCGCACTGGGAGGATGGGGCAGG + Intergenic
1038443492 8:27587302-27587324 CTCCATAGGGAGGCTGAGGCAGG - Intergenic
1038748918 8:30278341-30278363 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1038785620 8:30612636-30612658 CAGGAGAGGGAGGCTGAGGCAGG - Intronic
1040443164 8:47465622-47465644 CTACTGAGGGAGGCTGAGGCAGG + Intronic
1040582037 8:48705952-48705974 CCGCAGAGGGATGCTGAGGAAGG + Intergenic
1040989139 8:53330451-53330473 CTACACAGGGAGGCTGAGGCAGG - Intergenic
1042307360 8:67345416-67345438 CAGCACTGGGAGGCTGAGGCAGG - Intergenic
1043423687 8:80126727-80126749 GCACATAGGGAGGCTGAGGCGGG - Intronic
1043937994 8:86165079-86165101 CCCGATAGGGAGGCTGAGGCAGG - Intergenic
1045211679 8:100106094-100106116 CCGCCCAGGGAGGCCGAGGCCGG + Exonic
1045537842 8:103049688-103049710 GCACATTGGGAGGCTGTGGCAGG + Intronic
1047602868 8:126444335-126444357 CTCCAGAAGGAGGCTGAGGCAGG - Intergenic
1047969576 8:130073141-130073163 CCACATTGGGAGGCTGAGGCGGG + Intronic
1048301587 8:133255228-133255250 CCACACAGCTAGGCTGTGGCAGG - Intronic
1048359879 8:133688597-133688619 CCTCAGAGGGGGGCCATGGCAGG + Intergenic
1048804909 8:138231129-138231151 CAGCACTGGGAGGCTGAGGCAGG - Intronic
1049434249 8:142579190-142579212 GCGCAGAGGGAGGCCATTGCCGG + Intergenic
1049613214 8:143565388-143565410 CCCCAGATGGGGGCTGAGGCGGG - Intergenic
1049621118 8:143598685-143598707 CCGGGGCGGGGGGCTGTGGCCGG + Exonic
1049750462 8:144280734-144280756 TCACAGCGGGAGGCTGAGGCAGG + Intronic
1050527951 9:6562669-6562691 CTACTGAGGGAGGCTGAGGCAGG - Intronic
1050550989 9:6748052-6748074 CCTATGAGGGAGGCTGAGGCAGG + Intronic
1052318275 9:27139099-27139121 CTCCGGAGGGAGGCTGAGGCAGG + Intronic
1052760699 9:32588120-32588142 AGTCAGAGGCAGGCTGTGGCTGG - Intergenic
1052962699 9:34314000-34314022 CCGCTTTGGGAGGCTGAGGCAGG - Intronic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1054260879 9:62864106-62864128 ACACTGTGGGAGGCTGTGGCTGG - Intergenic
1054800889 9:69347207-69347229 CAGCAGAAGGAGGCTGGGCCTGG + Intronic
1054914380 9:70482359-70482381 TCACAGGGGGAGGCTGAGGCAGG - Intergenic
1055030670 9:71769094-71769116 CCGCAGCGGGGGGCGCTGGCTGG - Intronic
1055824716 9:80309548-80309570 CCCCAGAGGGTGGCTGAGTCTGG + Intergenic
1056236936 9:84604043-84604065 CCACAGTGGGAGGCCGAGGCAGG - Intergenic
1056755365 9:89378698-89378720 ACGCAGATGGAGACTGAGGCCGG - Exonic
1057497487 9:95572318-95572340 CCACTTAGGGAGGCTGAGGCAGG - Intergenic
1057854452 9:98591826-98591848 TCACAGAGTGAGGCAGTGGCAGG - Intronic
1058862161 9:109126976-109126998 CAGCACTGGGAGGCTGAGGCGGG + Intergenic
1059154435 9:111977283-111977305 CCTAAGTGGGAGGCTGAGGCAGG + Intergenic
1059277592 9:113109097-113109119 CCGCAGACCGAGGGTGTGGCTGG + Intergenic
1059278659 9:113115454-113115476 CCGCAGACCGAGGGTGTGGCTGG - Intergenic
1059777400 9:117489169-117489191 CAGCACTGGGAGGCTGAGGCAGG + Intergenic
1060184857 9:121558148-121558170 GCACAGAGGGAGGATGTGACAGG - Intergenic
1060299036 9:122363274-122363296 CAGCTCAGGGAGGCTGAGGCGGG - Intergenic
1060863768 9:126978495-126978517 CTGAATAGGGAGGCTGAGGCAGG + Intronic
1060924832 9:127449071-127449093 CAGCACTGGGAGGCTGAGGCGGG - Intronic
1061059926 9:128245182-128245204 CCCCAGAGGGCGGCTGGGGGAGG - Intronic
1061418556 9:130461296-130461318 CGGCTGCGGGAGGCTGTTGCAGG - Intronic
1061460554 9:130734766-130734788 CCGCTTTGGGAGGCTGAGGCGGG - Intronic
1062017435 9:134297831-134297853 CCTCATGGGGAGGCTGAGGCTGG + Intergenic
1062076392 9:134592297-134592319 CCGCAGAGAGAGGCCGAGGCTGG - Intergenic
1062089848 9:134669761-134669783 CCGCAGAGGTGGGGTGTGGATGG + Intronic
1062120425 9:134831145-134831167 CCACCCAGGGAGGCTGGGGCTGG - Intronic
1062617966 9:137406743-137406765 CCGCCCACTGAGGCTGTGGCCGG - Intronic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1185583609 X:1229028-1229050 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1186159847 X:6765705-6765727 CCAAAGAGGGAGGCTAGGGCTGG - Intergenic
1186638125 X:11427739-11427761 CGGCAGCGGGACGCTGTGCCAGG - Intronic
1188252066 X:27908925-27908947 CCGCTTTGGGAGGCTGAGGCGGG + Intergenic
1188543009 X:31270314-31270336 CCCCAGAGGGTGGCTTTGGCTGG - Intronic
1189301990 X:39958725-39958747 GGGCAGAGGCAGGCTGTGGGTGG - Intergenic
1189392388 X:40587021-40587043 GCACATAGGGAGGCTGAGGCGGG + Intronic
1189808917 X:44762950-44762972 AGGCTGAGGGAGGCTGAGGCAGG + Intergenic
1189821096 X:44871272-44871294 CTGCAAAGGGAGGCCGAGGCGGG - Intergenic
1189832687 X:44990436-44990458 AGGCTGAGGGAGGCTGAGGCAGG + Intronic
1190297699 X:49038280-49038302 CCTCAGGGGCAGGCAGTGGCTGG + Exonic
1191911269 X:66152967-66152989 CCACTGTGGGAGGCTGAGGCAGG + Intergenic
1193233256 X:79074230-79074252 GCTCTGAGGGAGGCTGAGGCAGG + Intergenic
1193713997 X:84915466-84915488 GCGCATTGGGAGGCTGTGGTGGG - Intergenic
1194451288 X:94047464-94047486 GCACATAGGGAGGCTGAGGCGGG + Intergenic
1195302619 X:103545704-103545726 GCACATAGGGAGGCTGAGGCGGG + Intergenic
1197266819 X:124383191-124383213 CAGCATTGGGAGGCTGAGGCAGG - Intronic
1198137960 X:133773166-133773188 TCCCAGTGGGAGGCTGAGGCAGG - Intronic
1198275469 X:135094823-135094845 GGGCTGGGGGAGGCTGTGGCAGG - Intergenic
1198311048 X:135425874-135425896 GGGCTGGGGGAGGCTGTGGCAGG + Intergenic
1198444673 X:136700276-136700298 CAGGATTGGGAGGCTGTGGCAGG + Intronic
1198942191 X:141968185-141968207 ACGCAGGGGGAGGCTGAGGCAGG - Intergenic
1199830547 X:151545376-151545398 CTGCTCAGGGAGGCTGAGGCAGG - Intergenic
1200091237 X:153637112-153637134 TCCCGGTGGGAGGCTGTGGCAGG - Intergenic
1200316483 X:155137649-155137671 TCGCTGTGGGAGGCTGAGGCAGG - Intronic
1202303920 Y:23447605-23447627 CAGCACTGGGAGGCTGAGGCGGG - Intergenic
1202566890 Y:26222986-26223008 CAGCACTGGGAGGCTGAGGCGGG + Intergenic