ID: 1152391447

View in Genome Browser
Species Human (GRCh38)
Location 17:80006166-80006188
Sequence GAGAGCGCTCCTGGTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152391447 Original CRISPR GAGAGCGCTCCTGGTGCTCT GGG (reversed) Intronic
900204382 1:1425868-1425890 CAGCCAGCTCCTGGTGCTCTGGG - Intergenic
902508841 1:16954729-16954751 CAGAGCGTTCACGGTGCTCTGGG - Exonic
905588647 1:39142819-39142841 AAGAGTGCTCCAGGTGCTCCAGG - Intronic
911153839 1:94620644-94620666 CACAGCGCTCCTGGGGCTGTTGG - Intergenic
912338562 1:108887436-108887458 GACATCGCACTTGGTGCTCTGGG - Intronic
912522002 1:110251987-110252009 GTGAGCGCTCCAGCTGCTCCAGG + Intronic
913690855 1:121278576-121278598 GAGTGCCTTCCGGGTGCTCTGGG - Intronic
914146685 1:145001387-145001409 GAGTGCCTTCCGGGTGCTCTGGG + Intronic
914902436 1:151717994-151718016 GGGGGCTCTCCTGGGGCTCTGGG + Intronic
915030794 1:152879027-152879049 CAGAGCCCTCCTGGTGGTTTGGG + Intronic
917333154 1:173903218-173903240 GACAGGGGTCCTGGGGCTCTAGG - Exonic
920335354 1:205241654-205241676 GAGAGCGCTCCTTCTCATCTGGG - Exonic
920478177 1:206297061-206297083 GAGTGCCTTCCGGGTGCTCTGGG - Intronic
924039144 1:239966341-239966363 GGGAAGGTTCCTGGTGCTCTAGG - Intergenic
924825164 1:247531148-247531170 GGGAGGGCTCCGGGGGCTCTGGG + Exonic
1065189833 10:23199030-23199052 GAGCCCGCTCCTGGGACTCTGGG + Intergenic
1070219280 10:74423497-74423519 CAGAGTGCACCTGGTGCTCCAGG - Intronic
1070688340 10:78506688-78506710 GAGAGCCCTGCAGGTGCTCTGGG - Intergenic
1070826195 10:79391785-79391807 GAGAGCGCTCCGGGAGCTACTGG - Intronic
1071480643 10:86062369-86062391 GACCGAGCTCCGGGTGCTCTGGG - Intronic
1072294110 10:93993630-93993652 GAGAGCGCTCCTGGGGCGCCCGG - Intergenic
1075444691 10:122505251-122505273 CAGTGCTCTCCTGGTCCTCTTGG + Intronic
1076125656 10:127971829-127971851 GAAAGCTCTCCTGGTGCCCATGG - Intronic
1076173404 10:128342251-128342273 GAGATTGCTCGTGGTGCACTGGG + Intergenic
1076189868 10:128475411-128475433 GAGAGAGCCCCTGGGTCTCTGGG + Intergenic
1078070266 11:8104042-8104064 GAGTGCACTCCTGGTGATCCTGG + Exonic
1078269385 11:9780854-9780876 GAGGGAGCTCCTTGTGCTCCAGG + Intronic
1084951026 11:72665519-72665541 CAGAGTGCTCCTGGTGTCCTGGG - Intronic
1085456255 11:76666951-76666973 GACTGTGCGCCTGGTGCTCTTGG - Intronic
1085767884 11:79299379-79299401 GAGTGCGCTCCTGGGGCACTGGG - Intronic
1090985453 11:131762165-131762187 GAGGGCGCTCCTGAGGCGCTAGG - Intronic
1091211905 11:133868523-133868545 GAGAGTGCTCCATGTGCACTTGG + Intergenic
1094620634 12:32077084-32077106 GAGGCCGCTCCTGCTGCTCCAGG - Intergenic
1101011474 12:100454973-100454995 GAGAGCCCTCCTGGTTTTCAAGG + Intergenic
1105304591 13:19159814-19159836 GTGAGAGTTCCTGGTGCTGTAGG - Intergenic
1109628132 13:65005615-65005637 GAAAGCGCTCCTGGACCTGTAGG + Intergenic
1117225426 14:53653659-53653681 GTGACCTGTCCTGGTGCTCTGGG - Intergenic
1117389474 14:55249394-55249416 GTGAGCTCTCCTGTTGTTCTAGG + Intergenic
1117790065 14:59331245-59331267 AAGGGCCCTCCTGGTGCTCCAGG - Exonic
1121091455 14:91185554-91185576 GCCACCGCTCCTGGTGCTCTGGG + Intronic
1122695681 14:103551005-103551027 GAGGGCCCTCCTGGGGCTCTGGG + Intergenic
1125392816 15:39213318-39213340 GAGGGCTCTTCTTGTGCTCTGGG + Intergenic
1128894071 15:71356865-71356887 TACAGTGCTACTGGTGCTCTAGG - Intronic
1130724821 15:86428273-86428295 GAGGGAGTTCCTGTTGCTCTAGG + Intronic
1135065793 16:19308741-19308763 GGGAGCCCTCCTGGAGCCCTGGG + Intronic
1137915567 16:52426211-52426233 GAGAGCTCTCCAGATGCTCCAGG + Intergenic
1139332242 16:66202329-66202351 GAGGGCGTTCCTGGTGTTCAAGG - Intergenic
1143269625 17:5666018-5666040 GAGAGCTCTCCGGCTGCTGTTGG - Intergenic
1143393853 17:6576479-6576501 GAAAGGGCTCCTGGTTCTCTGGG - Intergenic
1146692755 17:34888032-34888054 GACAGAGCTCCTGGTGCTGAGGG - Intergenic
1146756356 17:35434936-35434958 GGAAGCCATCCTGGTGCTCTGGG - Intergenic
1146816593 17:35947469-35947491 GAGAGCTCTCCTGGTGTTGGGGG - Intergenic
1151538160 17:74750075-74750097 GAGAGAGCTCCTGGGGCTCACGG + Intronic
1152391447 17:80006166-80006188 GAGAGCGCTCCTGGTGCTCTGGG - Intronic
1153227361 18:2908993-2909015 GAGACCGCTCCTCCTGCTCCTGG - Intronic
1154980086 18:21496663-21496685 GACAGCGCTGCTGTTGCTCTGGG - Exonic
1158591354 18:58781475-58781497 AAACGCGCTCCTGGTGCTCAGGG - Intergenic
1161379279 19:3956100-3956122 GAGAGGCCTCCTGGTCTTCTGGG + Intergenic
1161698240 19:5782184-5782206 GAGAGCCCTCCTGGGGGTCCAGG - Intergenic
1161887053 19:7005195-7005217 GAAAGCGCTCCTGGTGTCCCCGG - Intergenic
1163187954 19:15652878-15652900 GACAGCGCTCCTGGTATTCCGGG - Exonic
1163192159 19:15685123-15685145 GGCAGCGCTCCTGGTATTCTGGG - Exonic
1163216938 19:15885976-15885998 GGCAGCGCTCCTGGTATTCTGGG + Exonic
1168115702 19:54220457-54220479 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
1168118689 19:54240203-54240225 GAGAGCTCTCCTGGGGGCCTGGG + Intronic
924982997 2:240167-240189 GAGTGGGGTCCTGGTGCTCCTGG - Intronic
926144336 2:10387436-10387458 CACAGCGTTCCTGGTGCTCTGGG + Intronic
927960720 2:27239247-27239269 GAGAGCCCCCCTCCTGCTCTGGG - Intronic
928943331 2:36750285-36750307 GAGAGGGCTGATGGTGCTGTGGG - Intronic
929781464 2:44959935-44959957 GAGAGTCCTCCTGTTGCTCCAGG - Intergenic
931242557 2:60466372-60466394 GAGAGCTCTCCTGTTGCTGGGGG - Intronic
932887460 2:75560644-75560666 GAGAGCGCTCCCTGAACTCTGGG - Intronic
934644311 2:96049542-96049564 GAGAGCCCTCGTGGGGGTCTGGG + Intergenic
936036939 2:109120541-109120563 GAGTGGGCACCTTGTGCTCTAGG + Intergenic
947676502 2:231986036-231986058 CAGTCCGCTCCTGGTGCCCTTGG + Intronic
948592428 2:239059927-239059949 GAGAGCTCTCCGGGGGCCCTTGG + Intronic
948742154 2:240055196-240055218 GAGTGGGCTCCTTCTGCTCTTGG - Intergenic
948755368 2:240156556-240156578 GAGAGCGCTCCTGGACATCGTGG - Intergenic
948845960 2:240682935-240682957 GAGAGGGCACCTGGGCCTCTGGG + Intergenic
948847897 2:240691794-240691816 GAGAGGGCACCTGGGCCTCTGGG - Intergenic
948901263 2:240957914-240957936 GAAAGCCCTCCTGGGGCCCTGGG + Intronic
1170788368 20:19487295-19487317 GAGAGGTCTCTTTGTGCTCTTGG - Intronic
1172788517 20:37486369-37486391 GAGAGGGGCCCTGGAGCTCTGGG + Intergenic
1172791061 20:37505921-37505943 GAGAGGGGCCCTGGAGCTCTGGG - Intronic
1173130572 20:40389124-40389146 CAGAGCTCTCCATGTGCTCTGGG + Intergenic
1175485168 20:59340566-59340588 GAGCACGGCCCTGGTGCTCTGGG + Intergenic
1176947152 21:14996349-14996371 GAGAGCACTGTTGGTGTTCTGGG - Intronic
1179457376 21:41508460-41508482 GGGAGCGCTCCTGGAGTCCTGGG + Intronic
1180856122 22:19046769-19046791 GAGAGGGCTGCAGCTGCTCTGGG + Intronic
1181469898 22:23131830-23131852 GAGACTGCTCCTGGTGGCCTGGG + Intronic
1184239336 22:43203747-43203769 GAGGGCGCTCTTGGTGTCCTGGG + Exonic
1185351648 22:50342875-50342897 GAGCCCGCTCCTGCTGCTCGGGG + Intergenic
950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG + Intergenic
961064610 3:123864643-123864665 AAGAGTGTTCCTGGTGCTTTGGG + Intronic
963069740 3:141293067-141293089 GAGAACGCTTGTGGTGGTCTTGG - Exonic
969263739 4:6050608-6050630 GAGAGCGCTGCTGTGGTTCTCGG + Exonic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
984864065 4:184266189-184266211 GAGTCCTATCCTGGTGCTCTCGG - Intergenic
990808319 5:59692240-59692262 GAGAGAGCTCTTGGTCTTCTTGG + Intronic
992173872 5:74130484-74130506 GAGAGCACCTCTGCTGCTCTTGG + Intergenic
996806040 5:127455049-127455071 TAGAGCCCTCTTGGTGCTCCTGG + Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1005670957 6:28105574-28105596 GAGACCACACCTGGTGCTCAGGG - Intergenic
1005688943 6:28283195-28283217 GAGAGTGCTGCTGTAGCTCTTGG - Intronic
1007340106 6:41185983-41186005 GAGAGTTCTGCTGGTGCTCCTGG - Intergenic
1007484653 6:42172650-42172672 GAGTGTGCGCCTGGTGCCCTGGG - Intronic
1013843649 6:114425638-114425660 GAGAGCGTTCCCGGGGCTCTGGG + Intergenic
1018277652 6:162150010-162150032 GAGATCTGTCCAGGTGCTCTAGG - Intronic
1018899385 6:168043615-168043637 GAGAGACCACCTGGTACTCTTGG + Intronic
1019135993 6:169908001-169908023 GAGACCCCACCTGGTGCTCAGGG + Intergenic
1019918610 7:4149278-4149300 CAGAGAGCTCCTGGTGCCCCAGG + Exonic
1027423488 7:78040155-78040177 GAGACAGCTCGTTGTGCTCTTGG + Intronic
1027677045 7:81172873-81172895 GAGAGAGCTCTTGGTCTTCTTGG - Intergenic
1028754438 7:94419495-94419517 TAGGGTGCTCCTGGTGCTGTAGG + Exonic
1032781049 7:135165522-135165544 GAGATCACTCCTGGACCTCTGGG - Exonic
1035253462 7:157612086-157612108 CAGGTCGCTCCAGGTGCTCTGGG - Intronic
1035582675 8:749780-749802 GAGCGCGCTCTTGGTGCTGGAGG + Intergenic
1036766241 8:11550963-11550985 GAGGGGGCTCCTGGTGGTCTGGG - Intronic
1045501321 8:102746464-102746486 CAGAGGGCTCCTGCTGCTCTGGG + Intergenic
1049755748 8:144310658-144310680 GACCGCGCTCCTGCTGCTCTGGG - Intronic
1049806899 8:144545180-144545202 GAGAGGGCTCCTGCTGTGCTGGG - Intronic
1049834001 8:144721346-144721368 GTGAGCCCAGCTGGTGCTCTGGG - Exonic
1056504174 9:87240956-87240978 GAGACCTTTCCTGGTGCTCCAGG + Intergenic
1057843456 9:98504059-98504081 GGGAGCAATCCTGGTGCCCTGGG - Intronic
1060116916 9:120949030-120949052 GAGAGTGTTCCTGGCACTCTTGG - Intergenic
1061546568 9:131308113-131308135 GCGTGTGCTGCTGGTGCTCTGGG + Exonic
1062657478 9:137611797-137611819 GAGAGGAATCCTGCTGCTCTGGG + Intronic
1203781230 EBV:101937-101959 GAGAGCGCCTCTGGCGCCCTCGG + Intergenic
1189954835 X:46267167-46267189 GAGAGAGCTCCTGGTACACCTGG + Intergenic
1198791945 X:140355488-140355510 GAAAGCTCTCCTGATGTTCTCGG + Intergenic
1200787852 Y:7274809-7274831 GAGAGCGCACGAGGTACTCTAGG - Intergenic