ID: 1152392114

View in Genome Browser
Species Human (GRCh38)
Location 17:80009337-80009359
Sequence CTGTGCTGGCTCTGGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 9, 3: 67, 4: 539}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152392099_1152392114 25 Left 1152392099 17:80009289-80009311 CCACAGCCGGGGCATAGGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 214
Right 1152392114 17:80009337-80009359 CTGTGCTGGCTCTGGGGCTCCGG 0: 1
1: 0
2: 9
3: 67
4: 539
1152392102_1152392114 19 Left 1152392102 17:80009295-80009317 CCGGGGCATAGGAAGGGGCTGTG 0: 1
1: 0
2: 1
3: 40
4: 350
Right 1152392114 17:80009337-80009359 CTGTGCTGGCTCTGGGGCTCCGG 0: 1
1: 0
2: 9
3: 67
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152392114 Original CRISPR CTGTGCTGGCTCTGGGGCTC CGG Intronic
900169794 1:1261313-1261335 CTGTGCTGGTCCTGGGTCTCAGG - Intronic
900183082 1:1320915-1320937 CTGTCCCGGCTCTGAGGCCCAGG + Intronic
900272699 1:1800539-1800561 CTGTGCTGTCCCCGAGGCTCAGG - Intronic
900387422 1:2416924-2416946 CTGGGGGGGCCCTGGGGCTCTGG + Intergenic
900400011 1:2469182-2469204 CTGTGCTGGCCACTGGGCTCAGG + Intronic
900544281 1:3219893-3219915 CTGTGCTAGCTCCGTGGATCCGG - Intronic
900640452 1:3685794-3685816 CTGTGCTGGGGCTGGGGACCTGG + Intronic
900795597 1:4706456-4706478 GTTTACTGGCTCTGGGGCCCAGG - Intronic
901757693 1:11451261-11451283 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
902138859 1:14334676-14334698 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
902552928 1:17229979-17230001 CTGTGCAGCCTCTGGGGTACAGG - Intronic
902659307 1:17890349-17890371 CTGACCTGGCTCTGGGGGACTGG - Intergenic
903208348 1:21799928-21799950 CTGAGCTGGCACTGGGGCACAGG - Intergenic
903261109 1:22132317-22132339 CTGTGCTGGGCCCTGGGCTCTGG + Intronic
903332503 1:22603173-22603195 CTGTGCTGGCTATGGGGAGGGGG - Exonic
903440002 1:23380570-23380592 CTGGGCAGGTTCTGAGGCTCAGG + Intergenic
903446612 1:23426290-23426312 CTGTGATGGGGGTGGGGCTCAGG + Intergenic
903692783 1:25186027-25186049 CTGTGTTTGCTCTGGGGGGCTGG - Intergenic
903793001 1:25906911-25906933 TTGTGCTGTCACAGGGGCTCGGG - Intronic
903959530 1:27047902-27047924 CTGTCCGGGCCCTGGGGGTCTGG - Intergenic
905297152 1:36961507-36961529 CTGTGCTTGCTCGTGGGCTGTGG - Intronic
905358200 1:37399478-37399500 TTGTGCTGGCACTGGGGACCAGG - Intergenic
905733646 1:40312301-40312323 GTGGGCTGGCCCTGGGTCTCTGG + Intronic
906245484 1:44270553-44270575 CTGGGCTTGCTCTGGAGCACAGG - Intronic
907108939 1:51909011-51909033 CTGTGATGGGGCTGGGGCTGGGG - Exonic
907294079 1:53438675-53438697 GTGCACTGGCTCTGGGGCTTGGG + Intergenic
907400779 1:54223562-54223584 CTTTCCTGGCTCTGGGGCAGGGG + Intronic
908858252 1:68453280-68453302 CTGTGCTGCCTTTGGTGTTCTGG + Intergenic
909055008 1:70810573-70810595 CAGTGAAGGTTCTGGGGCTCAGG - Intergenic
911380185 1:97104945-97104967 CTGTGCAGGTGCTGGGGCCCAGG + Intronic
911550232 1:99269502-99269524 CAGTGGTCCCTCTGGGGCTCAGG + Intronic
911644534 1:100324094-100324116 CTGGGCTGGCACAGGGGCTTAGG - Intergenic
912977782 1:114345935-114345957 TTGTGCTTGCTCTGAGGCCCAGG - Intergenic
912993353 1:114510592-114510614 CTGAGCTGGCGCTCCGGCTCGGG + Exonic
913937006 1:125064748-125064770 GTGTCGGGGCTCTGGGGCTCCGG - Intergenic
913937238 1:125065934-125065956 CTGGGCTGTGTCTGGGGCTGGGG - Intergenic
915082392 1:153360971-153360993 CTGTCTTGGCTGTGGGGCTAGGG + Exonic
915110911 1:153564228-153564250 CTGCGCAGGCTCTGGGGAGCAGG + Intronic
915491329 1:156251545-156251567 CTGTTGTGGCTCTGGGGGCCTGG + Intronic
915973615 1:160370865-160370887 CTCTCCCGGCTCTGGGCCTCGGG - Exonic
916172387 1:162010755-162010777 GGGTGCTGGCTCTGGAGATCAGG + Intronic
919757334 1:201074251-201074273 CTGGCCAGGCTCTGAGGCTCTGG + Intronic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
920284373 1:204868971-204868993 CTGTTCTGGCTCTGAGTCTTAGG + Intronic
921284804 1:213599844-213599866 CTGACCTGGCTCAGGTGCTCAGG + Intergenic
922675567 1:227547048-227547070 GTGAGCTGGCTCTGGGGTTCAGG + Intergenic
922717909 1:227886615-227886637 CTTGGCTGGCTCTGCTGCTCAGG - Intergenic
923500433 1:234559660-234559682 CTGGGCTGGCTCTGGGCTTGGGG + Intergenic
924308740 1:242718787-242718809 CTGAGCTGGCTCTGGCGCTAAGG - Intergenic
1062879207 10:964765-964787 CTGTGCTGACTGTGGGGTGCCGG + Intergenic
1064289805 10:14023238-14023260 CAGGGCTGGGTGTGGGGCTCTGG - Intronic
1065183100 10:23146266-23146288 CTGTGCTGGCTAGGGGACGCAGG + Intergenic
1065963107 10:30750271-30750293 AGGTGGGGGCTCTGGGGCTCTGG - Intergenic
1066370640 10:34815543-34815565 CCGTGCTGGCACTGGGGCGAGGG - Intergenic
1067113977 10:43420675-43420697 CTAGTCTGGCTCTGTGGCTCAGG + Intergenic
1067145734 10:43692465-43692487 CTGTGCTGCACATGGGGCTCGGG + Intergenic
1067278196 10:44852462-44852484 CAGTGCTGGCACTGGGGCCTGGG - Intergenic
1067296908 10:44979861-44979883 CTGGGCTGGGGCTGGGGCTGGGG + Intronic
1067703701 10:48591344-48591366 CTCTGCTGGCCCTGTGCCTCGGG - Intronic
1067762500 10:49058752-49058774 ATGTGCTGGCTCTGAGGCTGCGG - Intronic
1068471664 10:57473112-57473134 CTGTTCTTGGTCTGGGGTTCAGG + Intergenic
1068607966 10:59026571-59026593 CTGGGCAGGCTGTGGGACTCCGG - Intergenic
1070324029 10:75376070-75376092 CAGTCCTGACTCTGGGGTTCTGG + Intergenic
1070750339 10:78960342-78960364 CCGTGCTGGCTGTGGGCCCCTGG + Intergenic
1073179417 10:101574851-101574873 GTGCGCTGTGTCTGGGGCTCTGG + Intronic
1073352972 10:102832791-102832813 CAGTAGTGGCTCTGGGGCCCAGG + Intronic
1073454211 10:103626883-103626905 CTGCTCTGTCTCAGGGGCTCAGG - Intronic
1073481327 10:103787843-103787865 CAGTGCTGGCTGAGGGGCTCGGG - Intronic
1073535778 10:104275350-104275372 CTGGGTTTGCTCGGGGGCTCTGG - Intronic
1073585134 10:104702723-104702745 CTGTTCTGGTGCTGGGGTTCAGG + Intronic
1074527194 10:114272904-114272926 CTGTGTTTGCTGTGGGGGTCAGG + Exonic
1074776675 10:116772313-116772335 GTGTTGGGGCTCTGGGGCTCTGG - Intergenic
1075515762 10:123106764-123106786 CCGTCCTGGGTCTGGGGCCCTGG + Intergenic
1075671381 10:124265992-124266014 CTGTGCTGGGGCTGGGAGTCAGG - Intergenic
1076119311 10:127922905-127922927 CTTGGCTGGGTCTGGGGTTCTGG - Intronic
1076198076 10:128534876-128534898 CTGAGCTGACACTGAGGCTCTGG + Intergenic
1076510665 10:131011815-131011837 CTGGGCTGGCTGTAGGGCTTTGG + Intergenic
1076919177 10:133442372-133442394 ATGAGCTCGCTCTGGGGCTTTGG + Intergenic
1077146706 11:1049772-1049794 CAGGTCTGGCTCTGGGGTTCTGG + Intergenic
1077224584 11:1434556-1434578 CTGGGCCGGCTCTGGGTGTCTGG + Intronic
1077224604 11:1434611-1434633 CTGGGCCGGCTCTGGGTGTCTGG + Intronic
1077224622 11:1434666-1434688 CTGGGCCGGCTCTGGGTGTCTGG + Intronic
1077224641 11:1434720-1434742 CTGGGCCGGCTCTGGGTGTCTGG + Intronic
1077235101 11:1478176-1478198 CTGTGGTGGCGGTGGGGCTGTGG - Intronic
1077272571 11:1688441-1688463 GCGTGGTGGCTCTGTGGCTCCGG - Intergenic
1077307097 11:1873301-1873323 CTGTGCCTGCTCTGAGCCTCGGG - Intronic
1077364012 11:2154280-2154302 CTGGGCTGGGTCTGCGGCCCTGG + Intronic
1077462630 11:2718240-2718262 TTGTGCTTGCTCTGGGCTTCAGG + Intronic
1077468773 11:2747041-2747063 GGGTGCTGTCCCTGGGGCTCTGG + Intronic
1077886586 11:6391744-6391766 CTGTGCTGCCGCCGGGGTTCTGG + Exonic
1077988803 11:7382898-7382920 CTGAGCTGGTGCTGGGGCTCCGG - Intronic
1078390299 11:10931162-10931184 CTGCTCTGCCGCTGGGGCTCCGG + Intergenic
1078759664 11:14242149-14242171 CAGTGGTGTCTCTGAGGCTCAGG - Intronic
1078848094 11:15139980-15140002 CATTCCTGGCTCTGGGGCTCTGG - Intronic
1079083617 11:17430356-17430378 CTGTGAGGGCTCAGGGGCTGTGG + Intronic
1079689591 11:23404282-23404304 TTGTGCTGGCTCTAGGCCTGAGG - Intergenic
1082002257 11:47399809-47399831 GCATGCTGGCTCTGGGGCTTTGG + Intergenic
1082632341 11:55557354-55557376 CTGTCCTGGCACTTGGGCTGAGG + Intergenic
1082791245 11:57347994-57348016 TTTGGCTGGGTCTGGGGCTCAGG + Intronic
1083455754 11:62777718-62777740 CAGTGCTTGGTGTGGGGCTCAGG + Intronic
1083665468 11:64271789-64271811 CTCTGCAGGCGCTGGGGCTGTGG - Exonic
1083881747 11:65552340-65552362 GGGTGCTGGCACTGGTGCTCAGG + Exonic
1084179224 11:67438265-67438287 CTGCGCTGCCTCAGAGGCTCTGG + Exonic
1084524441 11:69686924-69686946 CTGGGCTGGCATTGGGGCCCAGG + Intergenic
1084588331 11:70076340-70076362 CTGAGAGGGCTCTGGGGCTTGGG - Intergenic
1085350823 11:75797040-75797062 CTGGGCTAGGTCTGGGGCCCAGG + Intronic
1085713702 11:78853436-78853458 CTGAGCTGGCCCAGGGGCTCAGG + Intronic
1085750416 11:79156180-79156202 CTGGGCTTGCACTGTGGCTCCGG + Intronic
1086395662 11:86412805-86412827 ATGGGCAGGCTGTGGGGCTCTGG + Intronic
1087149253 11:94843920-94843942 CAGTGCTGGACTTGGGGCTCTGG + Intronic
1088174823 11:107040678-107040700 ATGGGATGGCTCTGGGGCTCTGG - Intergenic
1088483386 11:110318083-110318105 CTGTGCTGGCTTTGTTCCTCTGG + Intergenic
1088918900 11:114247388-114247410 CTGAGCTGGCTCTGGGACCTGGG + Intronic
1089255170 11:117190313-117190335 CTGTGCTGGAGCTGAGGCTGCGG - Intronic
1089730066 11:120513736-120513758 CAGTGCTGCCTCTGGGTTTCAGG - Intronic
1090716213 11:129433630-129433652 CTGTGCTGGTTCTGGGGCTGGGG + Intronic
1090722566 11:129489906-129489928 CTGTCCTGCTTCTGGGGATCGGG - Intergenic
1090854799 11:130602072-130602094 GTGTGCTTGCTCTGCTGCTCTGG + Intergenic
1091194520 11:133719914-133719936 CTGTGATGGCTCTAGGCCCCAGG - Intergenic
1091242850 11:134065825-134065847 CTGGTCTGGCTCTGGGGCAGTGG + Intergenic
1091434198 12:460465-460487 CCGTGGTGTCTGTGGGGCTCTGG + Exonic
1091967371 12:4755906-4755928 ATGTGTTCACTCTGGGGCTCAGG + Intronic
1092089384 12:5791651-5791673 ATGAGCTTGCTCTGTGGCTCTGG + Intronic
1092126403 12:6077865-6077887 CTGGGCTGAATCTGGGGCTGTGG - Intronic
1092279644 12:7089667-7089689 AGGTGCTGGCACTGGGGCTGGGG + Exonic
1093111377 12:15156366-15156388 CTTTGCTGGATCTGGAGTTCAGG + Intronic
1095038627 12:37420031-37420053 CTGGGCTGGGGCTGGGGCTGGGG - Intergenic
1095048956 12:37540742-37540764 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
1095570218 12:43675675-43675697 CTGAGCTGGCTCTGTGGCACAGG + Intergenic
1096156486 12:49344260-49344282 CTGGGCTGACTCTGGATCTCTGG + Intergenic
1096516401 12:52157960-52157982 CTGTTCTGCCTCTGGGCCTCTGG + Intergenic
1096972875 12:55681715-55681737 CTGTGCTTCCGCTGGGGCACTGG - Exonic
1098293154 12:68978169-68978191 CTTTGCTGGCTCTGGGTCTCTGG - Intergenic
1098894120 12:76038153-76038175 ATATTCTGGCTCTGGGTCTCTGG + Exonic
1100186367 12:92144958-92144980 CTGAGCTGGCTCCGGGGCAGCGG + Intronic
1101509863 12:105383243-105383265 CTGTGTTAGCGCTGGGGATCAGG - Intronic
1102426769 12:112849928-112849950 CTGGGCTGCCTCTGGGGGTCAGG + Intronic
1102992494 12:117325084-117325106 GTGTCCTGGATCTGGGGCTCTGG + Intronic
1103984777 12:124760012-124760034 CTCTGCTGGCGCTGGGGCTGTGG - Intergenic
1104041802 12:125135560-125135582 CTGGGCTGGGTCTGGGTCCCTGG - Intronic
1104272512 12:127294797-127294819 CTGTGCTGGATGCGGGGTTCAGG - Intergenic
1104595837 12:130119464-130119486 TTGTGTTGGATCTGGGGCCCTGG + Intergenic
1105236264 13:18556081-18556103 CCATGCTGGCTCTAGGGCTTGGG + Intergenic
1105837572 13:24224334-24224356 CTCTGAGGGCTCTGGGGCTTGGG - Exonic
1105874565 13:24540917-24540939 CTGGGCTGGCTGGAGGGCTCAGG + Intergenic
1106304090 13:28495031-28495053 CGGAGCGGGCTCCGGGGCTCGGG - Exonic
1106361494 13:29035438-29035460 CTGGCCTGGCTCAAGGGCTCAGG - Intronic
1106416177 13:29547918-29547940 CTGTCCTGGCACTGGGGTTGTGG - Intronic
1112367600 13:98768918-98768940 CAGGGGTGCCTCTGGGGCTCTGG - Intergenic
1112524382 13:100130200-100130222 TTTTGCTGGCTCTGGCACTCTGG + Intronic
1112770002 13:102784653-102784675 CTTAGCTGACTCTGGGCCTCTGG - Intronic
1112847555 13:103662838-103662860 CTGTGCTGTCTCTGTGGCTGGGG + Intergenic
1113273879 13:108706877-108706899 CTGTGAGGTCTCTGGGGCTAAGG + Intronic
1113782163 13:112982936-112982958 CTGGGCTGGGGCTGGGGCTGGGG + Intronic
1113848673 13:113405861-113405883 CTGTGCGGTCTCCAGGGCTCTGG + Intergenic
1113890201 13:113731585-113731607 GTCTGCTTGCTCTGGGGCACAGG - Intronic
1113913237 13:113854617-113854639 CTGTGCTGGCTCAGGGCCTGTGG - Intronic
1113933738 13:113982241-113982263 CTGGGCTGGCTCATGGGCCCTGG + Intronic
1115554950 14:34538094-34538116 CAGTCCTGGCTCCGTGGCTCAGG + Intronic
1116116414 14:40657269-40657291 CTGTGCTTGCTTTTGGGCCCTGG - Intergenic
1117752556 14:58938975-58938997 TTGTTCTGACTCTGGGGGTCGGG + Intergenic
1118601238 14:67472643-67472665 CTGTGCTGGCTAGGGAGCTGGGG + Exonic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1119613140 14:76080526-76080548 CTGTGCTGAGTTTAGGGCTCAGG - Intronic
1119657654 14:76428926-76428948 CTCTGCACGCTCTGGAGCTCAGG - Intronic
1119753715 14:77098796-77098818 CTGTTCTGGCTCCAGGGCACAGG + Intronic
1119845544 14:77826887-77826909 CAGAACTGGCTCTGGTGCTCAGG - Intronic
1120997765 14:90429313-90429335 ATGTGCTCACTCTGGGGCCCAGG - Intergenic
1121319014 14:92980295-92980317 CTCGGCTGCCTCAGGGGCTCTGG - Intronic
1121664871 14:95664858-95664880 CTGAGCTTGCTCTGGTGCTAGGG + Intergenic
1121950430 14:98166855-98166877 CGGGGCTGGCTCTGAGGCACTGG + Intergenic
1122098666 14:99389642-99389664 CTGTGCTGGCTGTGGGGTGGAGG + Intergenic
1122204986 14:100143817-100143839 CTGTGCGTGCTCTGGTGCACTGG - Exonic
1122985582 14:105210159-105210181 GTGTGCTGGCCCTGTGACTCAGG - Exonic
1123004198 14:105313859-105313881 ACGTGTAGGCTCTGGGGCTCAGG - Exonic
1123031939 14:105456074-105456096 CTGTGCTGGGTCTGGGCCTGTGG + Intronic
1123060241 14:105591130-105591152 CTGAGCTGGAGCTGGGGCTGAGG - Intergenic
1123108357 14:105853375-105853397 CTGTGCTGGCACCGGGGCTTTGG - Intergenic
1123708393 15:22967307-22967329 CCCTGCTGGCTGAGGGGCTCAGG + Intronic
1123801311 15:23823808-23823830 CTGTGCTAGCTCAGTGGCTATGG - Intergenic
1124594373 15:31081088-31081110 CTGTGATGACTCTGGGGCATCGG + Intronic
1125348440 15:38742809-38742831 AGGTTCTGGCTCTGTGGCTCTGG + Intergenic
1125748290 15:42012122-42012144 CTTTGCTGTCTCTGGGGCTCAGG + Intronic
1128075865 15:64825148-64825170 ATGTGCTCGCCCTGGGTCTCGGG - Intronic
1128353547 15:66908333-66908355 CTGTGCTGGCTTTGGGGGCTGGG - Intergenic
1128713010 15:69886003-69886025 CTGAGCAGCCTGTGGGGCTCTGG + Intergenic
1128804226 15:70518633-70518655 CTGGGAAGGCTTTGGGGCTCTGG - Intergenic
1129323239 15:74786438-74786460 CTGTTCTTGGGCTGGGGCTCAGG - Intronic
1129726567 15:77904526-77904548 TGGAGCTGGCTCTGAGGCTCTGG - Intergenic
1130274605 15:82469872-82469894 GCCTGCTGGCTCTGAGGCTCTGG - Intergenic
1130307916 15:82727086-82727108 CTCTGTTGGCCTTGGGGCTCGGG + Intergenic
1130466951 15:84197246-84197268 GCCTGCTGGCTCTGAGGCTCTGG - Intergenic
1130497313 15:84476290-84476312 GCCTGCTGGCTCTGAGGCTCTGG + Intergenic
1130589248 15:85201839-85201861 GCCTGCTGGCTCTGAGGCTCTGG - Intergenic
1130692545 15:86096248-86096270 CTGTGCAGTCTCTGAGCCTCAGG + Intergenic
1130872603 15:87983241-87983263 GAGTGCTGGCGCTGGGGCCCTGG + Intronic
1131109528 15:89756372-89756394 CTGAGTTGGCTCTGGAGCCCAGG - Intergenic
1131189389 15:90301524-90301546 CTGTGTTGTCTTTGGAGCTCAGG - Intronic
1131515009 15:93071576-93071598 CTGAGCTGGCGCTGGGGGCCAGG + Intronic
1131809035 15:96153218-96153240 ATGTGCTGGCTCTGGCTCTATGG - Intergenic
1132079446 15:98852197-98852219 CAGTTCTGGCGCAGGGGCTCCGG + Intronic
1132153187 15:99476573-99476595 CTGTGCAGGCTCCGGGGCTCCGG + Intergenic
1132163574 15:99565162-99565184 CTGTGCTCGCCCCGGGGCACGGG - Intergenic
1132575109 16:660544-660566 ATGTGCAGGCTTTGGGGCACAGG + Intronic
1132629883 16:912055-912077 CTGTGGGGTCTCTGGGGCCCTGG - Intronic
1132684268 16:1155736-1155758 CTGGGCTGGCTGTGTGTCTCAGG + Intronic
1132861355 16:2073299-2073321 CTGGGCTGGTTCTGAGGCGCAGG + Intronic
1133806370 16:9128515-9128537 CTGTCCTGGATCTGGGGTTCTGG + Intergenic
1134131204 16:11651379-11651401 CTGAGCTGGGGCTGGGGCTTTGG - Intergenic
1135422544 16:22314822-22314844 CTCTGCTGGCTCTGGCGCCTGGG + Intronic
1136072310 16:27795136-27795158 CTGTGCTGGGCCAGGGGCTGGGG - Intronic
1136144326 16:28307051-28307073 CTGTGCTGGGGCTGGGGCTGGGG - Intronic
1136251471 16:29008400-29008422 GGCTGCTGGCTCTGGGGCTGTGG + Intergenic
1137521393 16:49198488-49198510 CTGTGCTGGGTCTGAGGCTCAGG - Intergenic
1137586171 16:49665038-49665060 CTGAGCTGGGCCTGGGGCTGGGG + Intronic
1138109680 16:54313650-54313672 CTGTTCAGACTCTGGGGGTCAGG + Intergenic
1138190458 16:55009801-55009823 CTCAGCTGGCTCTGGTCCTCTGG - Intergenic
1138446878 16:57070199-57070221 CTGGGCTGGCTGTGGGAGTCAGG + Intronic
1138515304 16:57532873-57532895 CTGTGCTGGGTATGGGGGCCCGG + Intronic
1139630438 16:68228798-68228820 CTGTGCTAGCTCTTGGGTTGAGG + Exonic
1140323022 16:73972220-73972242 CTCTGCTGGCTCTGGGGTGGGGG + Intergenic
1140479004 16:75252531-75252553 CTGGCCTGGCCCAGGGGCTCTGG - Intronic
1141592593 16:85078492-85078514 GTGTGCTGGCTGAGGGGCTGTGG - Intronic
1141949078 16:87329161-87329183 CTTTCCTGGCTGTGTGGCTCTGG + Exonic
1141949939 16:87333805-87333827 CTGTGCTAGGTGTGGGGCTGGGG + Intronic
1142007693 16:87697481-87697503 CTGGGCTCGCGCCGGGGCTCTGG + Exonic
1142140777 16:88471841-88471863 CTGGGAGGGCTCTGGGCCTCCGG + Intronic
1142176496 16:88647782-88647804 CAGTGCTGGCCCTGGCCCTCTGG + Intronic
1142758408 17:2029121-2029143 CTTTGGGGTCTCTGGGGCTCTGG + Intergenic
1142848540 17:2693564-2693586 CAGTGCAGGCTGTGGGGTTCTGG - Intronic
1143796243 17:9339150-9339172 CTGGGATGGCTCTGGGTCTCAGG - Intronic
1144624434 17:16837610-16837632 CTGTGATGGCTCCAGGGATCTGG + Intergenic
1144769104 17:17749331-17749353 CAGAGCTGTCTCTGGGGCTCAGG - Intronic
1145035961 17:19540897-19540919 CTGTGCTTGCTCTGAAGGTCTGG + Intronic
1145056812 17:19708301-19708323 CTGTGCTGAACCTGGGGGTCAGG - Exonic
1145258900 17:21343157-21343179 TAGTGCTGGCACTGGGTCTCTGG + Intergenic
1145378841 17:22376096-22376118 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145379317 17:22378466-22378488 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145379795 17:22380836-22380858 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145380275 17:22383211-22383233 CTGAGCTGGGACTGGGGCTGGGG + Intergenic
1145380754 17:22385558-22385580 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145381232 17:22387933-22387955 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145383295 17:22398258-22398280 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145383663 17:22399993-22400015 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145383808 17:22400726-22400748 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145384246 17:22402928-22402950 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145385170 17:22407389-22407411 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145385351 17:22408461-22408483 CTGCGCTGGGACTGGGGCTGGGG + Intergenic
1145415432 17:22710357-22710379 CAGAGGTGGCTCTGGGGCTCTGG + Intergenic
1145910079 17:28537292-28537314 CAGTGGTGGCTCCGGGGCACTGG + Exonic
1146403689 17:32519566-32519588 GTGCGCTGGCGCTCGGGCTCGGG - Intronic
1146693028 17:34889712-34889734 CTGTGCTGGGTCAGGGGGTGAGG - Intergenic
1146952797 17:36918485-36918507 CTGAGCTGTCTCTAGGCCTCTGG + Intergenic
1147218163 17:38912832-38912854 CTGAGCTGGCGCCGAGGCTCTGG + Intronic
1147438742 17:40433836-40433858 CTGTGCTGCCTCTGGAGGTGGGG + Intergenic
1147644895 17:42027661-42027683 CTGTGCTGGCTGGAGGGCTTGGG + Exonic
1147887141 17:43691609-43691631 GTTTTCTTGCTCTGGGGCTCAGG + Intergenic
1148186752 17:45649983-45650005 CAGTGCAGGCTCTGGGCCTCTGG - Intergenic
1148209774 17:45801100-45801122 CTGTGCTGGCCCTGGGGGTGGGG + Intronic
1148459167 17:47828314-47828336 CTGTATTGGCTTTTGGGCTCTGG - Intronic
1148461991 17:47844161-47844183 CCTTCCTGGCTTTGGGGCTCTGG + Intergenic
1148759794 17:49993748-49993770 CAGTTCTGGCTCTGGGGCCGCGG - Intronic
1148777051 17:50101799-50101821 CTGGACTGGCTCTGGAGCCCTGG + Intronic
1149519277 17:57306109-57306131 CTTTGCTTGCTCTGGGGGTTGGG + Intronic
1149914927 17:60600216-60600238 CTCTGCTCGCTCCGGCGCTCCGG + Exonic
1150108142 17:62477718-62477740 CTGTCCTGGCTCAGGGGCGCCGG + Intronic
1150265821 17:63831839-63831861 CAGTGGTGGCTCTGGGGCAGTGG + Intronic
1150265952 17:63832571-63832593 CAGAGCTGGCTCTGGGGAGCTGG - Exonic
1150447890 17:65241745-65241767 CTGTGCTCCCTCTGAGGCTAGGG - Intergenic
1150473590 17:65457848-65457870 TTGTGCTGGCAGTGGGGCTGGGG - Intergenic
1151679612 17:75616458-75616480 CTGGGCAGGGCCTGGGGCTCCGG + Intergenic
1151838584 17:76600865-76600887 CTGTGTTGGCACTGGGGAACAGG - Intergenic
1152026696 17:77814299-77814321 CTCGGCTGGCGCTGGGGCTCTGG - Intergenic
1152040688 17:77900765-77900787 CTGTGCTGGCCCCAGGGTTCAGG + Intergenic
1152146627 17:78572469-78572491 CTCTGCAGCCCCTGGGGCTCTGG - Intronic
1152202090 17:78953013-78953035 CTGTGCCTTCGCTGGGGCTCAGG - Intergenic
1152392114 17:80009337-80009359 CTGTGCTGGCTCTGGGGCTCCGG + Intronic
1152525210 17:80884552-80884574 CTGTGCTGGCCCTGGGGTCCGGG - Intronic
1152581153 17:81166129-81166151 CGGTGCGGGCTCTGCGGCTGCGG - Intergenic
1154412298 18:14148076-14148098 CTGGGCAGGATCTGGGGCGCTGG - Intergenic
1154513273 18:15133917-15133939 CCATGCTGGCTCTAGGGCTTGGG - Intergenic
1155437470 18:25827995-25828017 CTCTGCTGCCTCTGGGACCCAGG - Intergenic
1157302112 18:46486545-46486567 CTGGGATGGCTTTGGGTCTCTGG - Intronic
1157599671 18:48886197-48886219 CTGAGCTCCCTCTGAGGCTCTGG - Intergenic
1160221974 18:76984522-76984544 CTGGGCTGGTTCAGGGGCCCTGG - Intronic
1160814467 19:1028752-1028774 CTCTGCCGGCTCAGGGGCCCAGG - Intronic
1161054211 19:2181780-2181802 CTGGGCTGGGGCTGGGGCTGGGG - Intronic
1161808459 19:6458485-6458507 CTGTGGTGGCTGTAGGGATCTGG - Intronic
1162375801 19:10304751-10304773 CTGGGCTGGCACAGGGGCACAGG + Intergenic
1162917027 19:13880246-13880268 CTGTGCTTTGTCTCGGGCTCTGG + Intronic
1162998740 19:14352685-14352707 CTGTGGTGGCCGTGGGGGTCCGG + Intergenic
1163087521 19:14993016-14993038 CTCTGCTCCCTCTGGGGCCCTGG - Intronic
1163153329 19:15427511-15427533 TCGTGCTGGCTCTGGGCCTGAGG + Exonic
1163655108 19:18541410-18541432 GCGTGCTGGCTGTGTGGCTCTGG + Intronic
1164429211 19:28172283-28172305 CTGTGTTGGCTCGGGGTCTCAGG + Intergenic
1164537516 19:29097235-29097257 CTGGGCAGGCTCTGGGGCCAAGG - Intergenic
1165152786 19:33770805-33770827 CTCAGCTGGCTCTGGAGTTCTGG - Intronic
1165246244 19:34500089-34500111 GTCTGCTGACTCTGGGGCTGGGG + Intronic
1165262856 19:34635882-34635904 CTGTGCTGCCTCTGGTGCTAGGG + Intronic
1165325807 19:35114082-35114104 TTGGGCTGGCGCTGGGGCTTGGG - Intergenic
1165636710 19:37346507-37346529 CAGTGGTGCCTCTGGGGCTTGGG - Intronic
1165746761 19:38234089-38234111 CTGGGCAGGGTCTGAGGCTCAGG - Intergenic
1166111016 19:40622896-40622918 CAGGGCTGGGGCTGGGGCTCTGG + Intronic
1166340529 19:42134313-42134335 CTCTGCTGGCTCTAGGGGGCTGG - Intronic
1166510732 19:43407194-43407216 CTGAGCTGGGGCTGGGGCTGTGG + Intronic
1166648759 19:44553900-44553922 CTATGCAGGGTCTGGGGGTCAGG + Intergenic
1166666112 19:44681368-44681390 CTGAGCTGGCTGTGGTCCTCTGG + Intronic
1166729746 19:45052413-45052435 CTCTGCTTCCTCTGGGCCTCTGG - Intronic
1166851096 19:45761709-45761731 CGGTGCAGGCTGTGGGACTCAGG - Exonic
1167254654 19:48419833-48419855 CTGGGCTGGAGCTGGGGCTGGGG + Intronic
1167358990 19:49019948-49019970 GTCTGCAGGCTCTGGGGCTCTGG + Intergenic
1167366674 19:49058185-49058207 GTCTGCAGGCTCTGGGGCTCTGG + Exonic
1167405034 19:49301194-49301216 CAGTGCTGGCTCGGGGGATGGGG - Intronic
1167796625 19:51713637-51713659 CTCTGCTGCCCCTGGCGCTCTGG - Exonic
1168062032 19:53898549-53898571 GTGTGCTGGCGCTGGGGGGCCGG + Exonic
1168119886 19:54246004-54246026 CTGGGAAGGGTCTGGGGCTCAGG - Intronic
1168280220 19:55301790-55301812 CTGTGCTGGACCTTGGGCTGCGG - Intronic
925128948 2:1481014-1481036 CTGTGCTGGTTCCTGGGATCCGG + Intronic
925439837 2:3875933-3875955 CTGTGCTCCCTCTGGGACTCTGG + Intergenic
925631232 2:5895438-5895460 CTGTGTTGGCTCTGGGCCTGGGG + Intergenic
926055576 2:9772042-9772064 CTGTGCTGGGCCTGGGGATGTGG + Intergenic
926120355 2:10238285-10238307 CTGTGCTGCCTGCGAGGCTCAGG - Intergenic
926561313 2:14420315-14420337 TTGTGCTGCCTCTGATGCTCCGG - Intergenic
927847038 2:26477033-26477055 CTGTGCTGGGGCTGGGGGTTGGG + Exonic
927937894 2:27085833-27085855 CTGGGCTGGCTCTCGGCCACCGG - Exonic
929574635 2:43043999-43044021 CAGCTCTGTCTCTGGGGCTCAGG - Intergenic
929610707 2:43268838-43268860 CAGTGCTGGCTGGGGTGCTCAGG + Intronic
929683729 2:44016659-44016681 GTGTGCTGACTCTGAGGATCTGG + Intergenic
930085589 2:47494943-47494965 CTGTGCAGGAGCTGGTGCTCTGG - Intronic
932137481 2:69243810-69243832 CTATGCTGGGCCTGGGGCTGGGG - Intronic
932497055 2:72150922-72150944 CAGTGCTGTGTCTGGGGGTCAGG - Intergenic
932503259 2:72203780-72203802 CTGTACTGGCCCAGAGGCTCTGG + Intronic
934502975 2:94873670-94873692 CCCTGCTGGCTCTGAGTCTCAGG - Intronic
934580333 2:95432770-95432792 CTGTGCACTCTCTGGGGCTCAGG - Intergenic
934599114 2:95643947-95643969 CTGTGCACTCTCTGGGGCTCAGG + Intergenic
934660246 2:96139315-96139337 GTGACCTGGCTCTGGGGCTCAGG - Intergenic
935591871 2:104852485-104852507 CTGGGCTGCCGCTCGGGCTCGGG + Intergenic
935918077 2:107979462-107979484 CTGTGGTGGCTGGGGGGCTGGGG + Intergenic
935950813 2:108326582-108326604 CTGTTCTAGCTCTGGCCCTCGGG + Intergenic
936095207 2:109526027-109526049 TTGTGGTGGCTCTGGTGCTCGGG - Intergenic
936234659 2:110732658-110732680 CGGCGCCGGGTCTGGGGCTCGGG + Exonic
936532461 2:113285942-113285964 GTGTGCACTCTCTGGGGCTCAGG + Intergenic
937146877 2:119655026-119655048 CTGTCCAGGCTCTGGGTGTCTGG - Intronic
937217085 2:120319586-120319608 TTGTGCTGCCTCTGCGACTCTGG - Intergenic
937262430 2:120595173-120595195 CTGGGCTGGCTCTGGGAGTCAGG - Intergenic
937771161 2:125722029-125722051 CTGTGCTCCCTCTGGGGCCCCGG - Intergenic
938229949 2:129649753-129649775 CTGTGCATGGTGTGGGGCTCTGG + Intergenic
938275195 2:130014414-130014436 ATTTGCTGGCTCTGGGGCTGTGG - Intergenic
938293463 2:130162468-130162490 CTGTGCCAGACCTGGGGCTCAGG + Intronic
938326156 2:130405138-130405160 ATTTGCTGGCTCTGGGGCTGTGG - Intergenic
938363783 2:130716321-130716343 ATTTGCTGGCTCTGGGGCTGTGG + Intergenic
938440166 2:131322866-131322888 ATTTGCTGGCTCTGGGGCTGTGG + Intronic
938463090 2:131510493-131510515 CTGTGCCAGACCTGGGGCTCAGG - Intergenic
938513522 2:131978528-131978550 CCATGCTGGCTCTAGGGCTTGGG - Intergenic
941849453 2:170164679-170164701 CTTTCCTGGCTTTGGGGATCAGG + Intergenic
942352310 2:175065493-175065515 CTGTGGTGGCTATGGGGTTATGG + Intergenic
942775039 2:179571465-179571487 CTTTGCTGGCTATGGAGCCCTGG - Intronic
942804037 2:179908861-179908883 CTGTGCTGGCACTGTGCATCAGG + Intergenic
944139921 2:196444826-196444848 CAGTGGTGGCTCTGGGGGTCAGG + Intronic
944219249 2:197285965-197285987 CAGAGTTAGCTCTGGGGCTCAGG - Intronic
946039944 2:216774808-216774830 CAGAGCTGGCCCTGGGGCTGCGG - Intergenic
946459734 2:219858148-219858170 CTGTGGTGACTCTGGGGCATGGG + Intergenic
947307359 2:228762317-228762339 CTGTTCTTGCTCTGGGGCAGAGG + Intergenic
947711222 2:232317274-232317296 CTGTCCTTGCTCTTGGGCACAGG - Intronic
947984449 2:234436812-234436834 CCGTGTGGGGTCTGGGGCTCAGG - Intergenic
948211928 2:236200563-236200585 CTGGGCTGGCTCTTTGCCTCAGG - Intronic
948231348 2:236351650-236351672 CTGTGCTGGCCTTGGGGAGCAGG + Intronic
948650767 2:239442244-239442266 CTGTGCTCCCTCTGGGCATCAGG - Intergenic
948658563 2:239492196-239492218 CTGTGCTCCCTCCGGAGCTCAGG + Intergenic
948676725 2:239601281-239601303 CTTTGCAGACTCTGGGGCACTGG - Intergenic
948696916 2:239737396-239737418 CTGGGCTGGGGCTGGGGCTGGGG - Intergenic
948893689 2:240918743-240918765 CCCTGCTGGCTGTGGGACTCAGG - Intergenic
1168748614 20:266299-266321 CTGTGGCCGCTCTGGGCCTCTGG + Intergenic
1168972027 20:1937671-1937693 CGGTGCAGGCTCTGGGACCCAGG + Exonic
1170893669 20:20396073-20396095 CTGTCCTGGGTCTGGGGTCCAGG - Intronic
1170926117 20:20726000-20726022 CTGTGGTGTCTCTGGGGCTTGGG - Intergenic
1171371636 20:24666063-24666085 CTTTGCTGGCTCTGCTTCTCAGG - Exonic
1171383000 20:24747354-24747376 CTGTGATGGCTGAGGGGATCAGG - Intergenic
1171524475 20:25798448-25798470 GTGTCCGGGCTCTGAGGCTCCGG - Intronic
1171532978 20:25864233-25864255 CTGGGCTGGGTCTGGGGCTGGGG - Intronic
1171533413 20:25866711-25866733 CTGGGCTGGGGCTGGGGCTGGGG - Intronic
1171552352 20:26057435-26057457 GTGTCCGGGCTCTGAGGCTCCGG + Intergenic
1172071155 20:32258127-32258149 CTGTGCTGTCTCTGGTTCACAGG + Intergenic
1172614458 20:36274355-36274377 CTGGGCTGGGGCTGGGGCTGGGG - Intergenic
1172695843 20:36822280-36822302 ATGTTCTGGCTCTGGGCCTTGGG + Intronic
1173115862 20:40242036-40242058 CCTTGCTGGCTCTGGTGCTGAGG + Intergenic
1173249562 20:41357456-41357478 CTGGGCTGGGGCTGGGGCTGAGG + Intronic
1174035359 20:47665410-47665432 CGGTGCTTGCCCTGGGGCCCGGG - Intronic
1174072921 20:47911296-47911318 CTGTCCTAGCTCTGGAGGTCAGG + Intergenic
1174151152 20:48487370-48487392 CTGTCCTAGCTCTGGAGGTCAGG - Intergenic
1174284404 20:49462233-49462255 CTGAACTGGCTCTAGGCCTCAGG - Intronic
1174883195 20:54303269-54303291 TTATTCTCGCTCTGGGGCTCAGG + Intergenic
1175267796 20:57713108-57713130 CTGTGCTGGGTATGGGGCACAGG + Intergenic
1175270980 20:57734060-57734082 CTGCGCTTGCACTGGGGCCCTGG + Intergenic
1175911382 20:62406963-62406985 CTGAGCAGGCCCTGGGGCGCGGG + Exonic
1175925059 20:62467411-62467433 CTGAGGTGCCTCTGGGGCCCTGG - Intronic
1176107927 20:63398284-63398306 CTGCGCTGGGTCTGGGCTTCAGG + Intergenic
1176780258 21:13184366-13184388 CCATGCTGGCTCTAGGGCTTGGG + Intergenic
1176860708 21:14010181-14010203 CTGGGCAGGGTCTGGGGCGCTGG + Intergenic
1177977926 21:27873388-27873410 CCATGCTGGCTCTAGGGCTTGGG + Intergenic
1179052086 21:37896789-37896811 CTCCGCTGCCTCTGGGGCCCGGG - Intronic
1179519863 21:41935549-41935571 CTTTTCTGGCTGTGGGGGTCAGG - Intronic
1179928234 21:44550281-44550303 CTGGCCTGGCTCTGGGGGGCTGG - Intronic
1179939451 21:44628432-44628454 CTGGCCTGGCTCTGGGGGGCTGG + Intronic
1180930343 22:19586302-19586324 ATGGGCAGGCTGTGGGGCTCCGG + Intergenic
1181629906 22:24145273-24145295 CTGGGCTGGGGCTGGGGCTGGGG + Intronic
1181671267 22:24426612-24426634 CTGTGCAGAACCTGGGGCTCTGG + Intronic
1181901626 22:26160791-26160813 CTGTCCTGGCTCTGGGTCCTTGG + Intergenic
1182470286 22:30544186-30544208 CGGTGCAGGCTCTGGGACCCAGG + Intronic
1182503883 22:30768249-30768271 CTGGGCTGGCTCCTGGGCTTGGG - Intronic
1182522545 22:30892529-30892551 CTGCTCTGGCTGTGGGGCCCAGG - Intronic
1183091268 22:35523596-35523618 CAGTCCTGGCACTGGGACTCAGG - Intergenic
1183277280 22:36906840-36906862 CTGTGCAGGCTCTGGAAGTCTGG + Intergenic
1183325312 22:37188262-37188284 CTCTGCTGGGCCTGGGGGTCTGG - Exonic
1183406931 22:37634797-37634819 CTGTGCTGGAGGTGGGACTCTGG - Intronic
1184242888 22:43220726-43220748 CAGGGCTGGCTCGGGGTCTCAGG + Intronic
1184423892 22:44397698-44397720 CTGTGCTGGCTGTGGGGACCTGG + Intergenic
1184551635 22:45207645-45207667 CTGTGCTGACTGGGGGCCTCTGG + Intronic
1185003296 22:48259854-48259876 CCGTGCTGCCTTTGGGCCTCTGG - Intergenic
1185021578 22:48379780-48379802 CTGCTCCAGCTCTGGGGCTCTGG - Intergenic
1185128081 22:49022778-49022800 CGGTGCAGGCTCTGGCCCTCAGG - Intergenic
1185176244 22:49328594-49328616 GTGTGTGGGCCCTGGGGCTCAGG + Intergenic
949921933 3:9009918-9009940 CTGTGCTGGGACTTGGGCACAGG - Intronic
949970629 3:9399928-9399950 AGCTGCTGGCTCTGGAGCTCTGG + Intronic
950122496 3:10491070-10491092 CTGCCCTTGCTCTGGGTCTCAGG + Intronic
950450704 3:13063566-13063588 CTGGGCTGGGGCTGGGGCCCCGG + Intronic
950479914 3:13237859-13237881 CTGCTCTGGCTCTGGGCCCCTGG - Intergenic
950484736 3:13266468-13266490 CTGCGCAGGGTCTGGGCCTCAGG - Intergenic
950529587 3:13545527-13545549 TTGTGCAGGCTTTGGGGGTCAGG + Intergenic
952442175 3:33341860-33341882 AGGTGAAGGCTCTGGGGCTCTGG + Intronic
953873331 3:46646677-46646699 CTCCGCAGGCTCTGGGGCACAGG + Intergenic
954187809 3:48932623-48932645 CTGGGCTTTGTCTGGGGCTCTGG - Intronic
954260168 3:49433025-49433047 CTGTGCAGGATCTGTGTCTCTGG - Intergenic
954529607 3:51307637-51307659 CTGTGCTGACCTTGAGGCTCTGG - Intronic
954628567 3:52036073-52036095 CTGCCCTGGCACTGGGTCTCAGG - Intergenic
954673089 3:52301056-52301078 CTGTGCTGGGCCTGGGGTCCTGG + Intergenic
954716614 3:52529983-52530005 CAGAGCTGGGACTGGGGCTCAGG + Intronic
955921224 3:63957619-63957641 CAGTGCTGGCTCTGAGCCTGAGG + Intronic
956952714 3:74300571-74300593 CTGTGCTTGCCCTGGTGTTCTGG - Intronic
957350071 3:79013140-79013162 CTGTGGTTGCTCTTAGGCTCTGG - Intronic
958798794 3:98733094-98733116 CTTTGCAGCCTCTGAGGCTCAGG + Intronic
959125371 3:102284216-102284238 CTGGGCCCCCTCTGGGGCTCAGG - Intronic
959267314 3:104158798-104158820 CTGTGATAGGTCTGGTGCTCTGG + Intergenic
960950687 3:122996770-122996792 CTGTCCTTGCCCTGGGCCTCTGG + Intronic
961374066 3:126450832-126450854 CTGTGCTGGCACTGCAGCTCAGG - Intronic
961677861 3:128578475-128578497 CGGTGCTGGCTCTGGAACCCTGG - Intergenic
962284854 3:134077020-134077042 CTGTGCAGGCTGTGGGGGTGGGG - Intronic
962669492 3:137690354-137690376 GTGGGCTGGCCCTGTGGCTCAGG + Intergenic
965300653 3:167001524-167001546 CCGTGATTGCCCTGGGGCTCAGG + Intergenic
965517121 3:169633579-169633601 CTGTGCTGGCTGTGGGAAACAGG - Intronic
967752742 3:193132856-193132878 CAATGCTGACTGTGGGGCTCAGG - Intergenic
967946338 3:194807095-194807117 CTGGGCTGGCCCAGGGCCTCAGG + Intergenic
967952561 3:194852366-194852388 CTGGGCTGGTTCTGTGGCTGTGG + Intergenic
968604899 4:1530501-1530523 TGGTGCTGGGGCTGGGGCTCTGG + Intergenic
968660844 4:1798141-1798163 CTTTGGTGGCTCTGGGGAGCTGG + Intronic
968956302 4:3721506-3721528 CTGCTCTGGCCCTGGGGCACTGG - Intergenic
969035100 4:4247118-4247140 CTGTGCTGGAACTAGAGCTCTGG - Intronic
969056433 4:4405652-4405674 CTGTGCAGACTCTGGAGCTGGGG - Intronic
969297700 4:6279485-6279507 CTGTGCTCACTATGGGCCTCAGG + Intronic
969398579 4:6938807-6938829 CTGTGCAGGGGCTGTGGCTCGGG + Intronic
969593102 4:8133023-8133045 CAACGCAGGCTCTGGGGCTCTGG + Intronic
969595162 4:8144601-8144623 CTGGGCTGGCACTGGAGCTCAGG - Intronic
969662252 4:8537118-8537140 CTGTGCTGCCTCTGCGTCCCAGG - Intergenic
971319888 4:25596990-25597012 CTCTGCTGGTTTTGCGGCTCAGG - Intergenic
972211064 4:36838124-36838146 CTGTGAGGGCTCTGGGGGACTGG - Intergenic
972663903 4:41145328-41145350 CTTTGCTGGCTGTGTGGCTGAGG - Intronic
973615806 4:52676763-52676785 CTGTGCAGGATCTGAGGCTATGG + Intergenic
976380406 4:84392231-84392253 CTGTGCTGGATCTGTGGCCTTGG + Intergenic
978319909 4:107482048-107482070 CTGTGCTGGCTCTGTGGAGGAGG + Intergenic
982899295 4:160978399-160978421 CTGTGCTGACTCTGAGGCTGTGG - Intergenic
983998985 4:174217806-174217828 CTTGCCTGGCCCTGGGGCTCTGG - Intergenic
984085708 4:175308706-175308728 TTGTGTTGGTTCTGGGGATCAGG - Intergenic
984802306 4:183726372-183726394 CAGTGCTGGTGCTGGTGCTCTGG - Intergenic
985823539 5:2177327-2177349 CTGGGCTGCCTCTGGAGCTGGGG - Intergenic
985946913 5:3192891-3192913 CTGCTCTGGCTTTGGGTCTCAGG - Intergenic
988688179 5:33546072-33546094 CTGTGCTGTCACTGGGCCACTGG - Exonic
990881142 5:60540585-60540607 CTGTGCTGCTTCTGGGGCTTGGG - Intergenic
992141144 5:73798471-73798493 CGGAGCTGGTTCTGGGGCACCGG - Intronic
992290539 5:75274972-75274994 CAATGCAGGCTCTGGGACTCTGG + Intergenic
993634273 5:90325706-90325728 GAGTGCTGGCTGTGGGTCTCAGG + Intergenic
994131157 5:96229529-96229551 CTGTTGTGGCTATCGGGCTCAGG - Intergenic
994452959 5:99967124-99967146 CTCTGCAGGCTCTGTTGCTCTGG - Intergenic
994744459 5:103661777-103661799 CTGTGCTGGATCTGAGGGTAAGG + Intergenic
995998748 5:118332775-118332797 CAGTTCTGGCTATGGGGTTCCGG - Intergenic
996050263 5:118924343-118924365 CTTTGCTGGATCTGGTTCTCAGG - Intronic
997319273 5:132963972-132963994 ATATGCCGGTTCTGGGGCTCAGG + Intergenic
998252888 5:140564422-140564444 CTGGGCGGGCTGTGCGGCTCAGG - Intronic
1001111443 5:168899851-168899873 CTGTGATGTCCCTGAGGCTCTGG + Intronic
1001514802 5:172347933-172347955 CTGCCCTGGCTCTGGGTCTCAGG + Intronic
1002201838 5:177533172-177533194 CTGAGCAGACTCTGGTGCTCTGG + Intronic
1002339264 5:178504348-178504370 AGCTGCTGGCTCTGGGACTCAGG + Intronic
1002913713 6:1511269-1511291 CTGGGCTGGAGCTGGGGCTATGG - Intergenic
1003092787 6:3118477-3118499 CGGTGCTGGCTCTGGCTCCCGGG - Intronic
1003441363 6:6145713-6145735 GTGTGCCGGCCCTGGGTCTCTGG - Exonic
1003853117 6:10244928-10244950 ATGTGCTGGCTCTGTGCCTCAGG + Intergenic
1003860095 6:10315085-10315107 CTCTTCTGGCCCTGGGGCACTGG - Intergenic
1003904415 6:10686054-10686076 CTGCGCTCGCTCTGTTGCTCAGG + Intronic
1006260509 6:32865118-32865140 CTCTGCTGGCTCTGGGGCACTGG + Intergenic
1006794090 6:36721310-36721332 CTGAGGTGGCTCTTGGGGTCGGG - Exonic
1007478266 6:42133588-42133610 CTGTGGTCCATCTGGGGCTCAGG - Intronic
1010853807 6:80812818-80812840 CTCTCCTGGCTCTCGGGCTTTGG - Intergenic
1012865554 6:104614262-104614284 CAGTGATGGCTCTGGCTCTCAGG - Intergenic
1013036666 6:106391718-106391740 CTTTGCTGGCCCTGGGCCTAGGG + Intergenic
1016775075 6:147896356-147896378 CTGAGCTGGGGCTGGGGCTGGGG + Intergenic
1017522809 6:155216741-155216763 CTGAGCTGGCTCTGAGGCTCAGG + Intronic
1019420626 7:949123-949145 CTGTGCAGTCACTGGGGCTCAGG - Intronic
1019647556 7:2139233-2139255 CATTGCTGGCTCAGGGGGTCGGG - Intronic
1019666264 7:2253648-2253670 CTGTGCTGACTCGGTGGCTGTGG - Exonic
1020098655 7:5382321-5382343 CTGGGCTGGGGCTGGGCCTCTGG - Intronic
1022195500 7:28062607-28062629 GTTTGCTGGCTTTGGGGCACAGG - Intronic
1024015673 7:45312064-45312086 GTGTGGTGGCTCTGTGGCTGTGG + Intergenic
1024251497 7:47508972-47508994 CAGTTCTGGCTCAGGGTCTCTGG - Intronic
1024473770 7:49789890-49789912 CTGCACTGGCCCTGGTGCTCCGG + Intronic
1025284266 7:57649683-57649705 CTGGGCTGGGTCTGGGGCTGGGG - Intergenic
1025294868 7:57769323-57769345 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
1025301716 7:57823617-57823639 CTGGGCTGGGTCTGGGGCTGGGG + Intergenic
1027644396 7:80779034-80779056 CTGTGCTGGAGCTGGAGATCTGG - Intronic
1029351402 7:100015663-100015685 GGGAGCTGACTCTGGGGCTCAGG - Exonic
1031122537 7:117738180-117738202 CTGTGCTGGGCCTGGGGCACTGG + Intronic
1032037190 7:128530252-128530274 CTGTCCTGGCTCAGGGGAGCCGG + Intergenic
1032405470 7:131652524-131652546 CAGTGCAGGTCCTGGGGCTCAGG - Intergenic
1033219180 7:139516748-139516770 CTTTGCTGGTGCTGGGGTTCTGG - Intergenic
1033531804 7:142271752-142271774 GTGAGCTGGGTCAGGGGCTCTGG - Intergenic
1034700875 7:153094744-153094766 CTGTGCTGGCAGTGGGGCAGTGG + Intergenic
1035066182 7:156106472-156106494 CTGTGCTGCCTCCGAGCCTCAGG - Intergenic
1035398200 7:158548803-158548825 CTGCGCTGGCTTTGGTGGTCAGG - Intronic
1035573637 8:690332-690354 CTGTCCTGGCTTTTGGGCACAGG + Intronic
1035840560 8:2808396-2808418 CTGTGGTGGCTCCAGTGCTCAGG - Intergenic
1036221986 8:6928985-6929007 TTGTGCTGGCTGCGGGGCTGAGG + Intergenic
1036535948 8:9652811-9652833 CTGTGGTCGCTCTGAGGGTCAGG - Intronic
1037321181 8:17644830-17644852 ATGAGCTGGCTCTGGGGCTCTGG + Exonic
1037448063 8:18987735-18987757 CACTGCTGCCTCTTGGGCTCAGG - Intronic
1037736494 8:21571120-21571142 CTGTTCTGGCTCTGGCTCTCAGG + Intergenic
1038039582 8:23713113-23713135 CTGTGCCGGCCATGGGGCTTTGG - Intergenic
1038186212 8:25277481-25277503 CTGTGCTGTATCTGGGAGTCTGG - Intronic
1040413964 8:47181227-47181249 CTGTGCTGGCTAGGGAGCTGGGG - Intergenic
1040610179 8:48976378-48976400 GTGTACAGGCTCTGGAGCTCTGG - Intergenic
1041201611 8:55455151-55455173 CTGGGCGGGCTCCGCGGCTCGGG + Intronic
1041210485 8:55545541-55545563 ATGTGCTGGTTTTGCGGCTCAGG + Intergenic
1042617231 8:70663333-70663355 TTTTGTTGGCTCTGGGTCTCAGG - Intronic
1045473774 8:102536358-102536380 CTGACCTGGCCCTGGGACTCGGG + Intronic
1045938461 8:107710702-107710724 ATGGGCAGGCTGTGGGGCTCCGG + Intergenic
1046670745 8:117053528-117053550 CTGGGCTGGGGCTCGGGCTCGGG - Intronic
1048288170 8:133158574-133158596 ATGTGCTACCTCTGTGGCTCTGG + Intergenic
1048899209 8:139021955-139021977 CTCTCCTGGCCCTGGGGCTGTGG - Intergenic
1049190545 8:141285042-141285064 CGGAGCTGGCAGTGGGGCTCGGG + Intronic
1049223948 8:141440844-141440866 CTGTCCTGCCTGTGGGACTCAGG - Intergenic
1049259126 8:141629433-141629455 CTGTGCCCTCTCTGGGCCTCAGG + Intergenic
1049274429 8:141712747-141712769 CTGTGGTGGCCCTGGGGGTTGGG + Intergenic
1049332875 8:142064578-142064600 CTGTGCTTGCTCTGTGCCTGAGG - Intergenic
1049361229 8:142213281-142213303 CTGTGCGGACTCCGGGGCTGGGG + Intronic
1049758559 8:144321593-144321615 AGGTGCAGGCTCTGGGGGTCCGG - Intronic
1050458476 9:5856522-5856544 CTCTGCTGGCTCTGGTACTCTGG + Intergenic
1051243770 9:15088030-15088052 CTGTTCTGACTCGGGAGCTCTGG + Intergenic
1051968970 9:22863747-22863769 CTGTGTTGGGTGTGTGGCTCTGG - Intergenic
1052857415 9:33415897-33415919 CTGAGCTGGTTCCCGGGCTCAGG + Intergenic
1053161548 9:35816908-35816930 CTGTGGTGCCTCTGGGACACTGG + Intronic
1053785039 9:41647274-41647296 CTGGGCTGGGGCTGGGGCTGGGG - Intergenic
1054159978 9:61666908-61666930 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
1054172629 9:61855658-61855680 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
1054173766 9:61861225-61861247 CTGGGCTGGGGCTGGGGCTGGGG - Intergenic
1054447480 9:65384669-65384691 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
1054447705 9:65385682-65385704 GTGTCCAGGCTCTGAGGCTCCGG + Intergenic
1054448623 9:65390290-65390312 CTGGGCTGGGGCTGGGGCTGGGG - Intergenic
1054663774 9:67719556-67719578 CTGGGCTGGGGCTGGGGCTGGGG + Intergenic
1054664911 9:67725143-67725165 CTGGGCTGGGGCTGGGGCTGGGG - Intergenic
1055136210 9:72831979-72832001 CTGGTCTGGCTCTGTGGCCCAGG + Intronic
1056292996 9:85162605-85162627 ATTTGCTGGCTCTGAGTCTCTGG - Intergenic
1056406911 9:86283323-86283345 CTGTGCAGTGTCTGGTGCTCAGG - Intergenic
1056534945 9:87519122-87519144 CTTTCCTGGGGCTGGGGCTCTGG + Intronic
1057220753 9:93256504-93256526 CTGTGCTGGCCCCTGGGCCCAGG + Intronic
1057547971 9:96032169-96032191 GGGTGCTGGCTTTGGGGCTCAGG - Intergenic
1057702685 9:97375231-97375253 CTGTGCACGGTCTGGGGTTCTGG - Intronic
1057739462 9:97699026-97699048 CTGTACAGGCACGGGGGCTCTGG + Intergenic
1057845384 9:98518692-98518714 CTGGGCTGGCTGTGGGGCTGAGG - Intronic
1058588130 9:106532276-106532298 TTGTGCTGGCTCTAGTGCTTTGG - Intergenic
1058699620 9:107589574-107589596 CTGCACAGGCTCTGGGGCTGTGG - Intergenic
1058895838 9:109399908-109399930 TTGTGCTGGGTTTGGAGCTCTGG - Intronic
1058897314 9:109411497-109411519 CTGTGCTGGGCCTGTGGCTCCGG - Intronic
1059256789 9:112938156-112938178 CAGGGCTGGCTCTGAGGCTGAGG - Intergenic
1059499461 9:114738706-114738728 CTGAGCTGGGTCAAGGGCTCAGG + Intergenic
1060757491 9:126223859-126223881 GTGTGCTGGCACCGGAGCTCTGG + Intergenic
1061230482 9:129312941-129312963 ATGTGTTGGCTGTGGGGCCCTGG + Intergenic
1061638099 9:131928250-131928272 CTGCACTGGCTCTGTGGCTTGGG + Intronic
1061780671 9:132994409-132994431 CTTTGCTGGCTCTGGTGCTCTGG - Intergenic
1061847376 9:133395264-133395286 CTGGGCTGGGGCTGGAGCTCAGG - Intronic
1062038868 9:134395158-134395180 CTGTGCTGGCTCTGCAACCCCGG + Intronic
1062247421 9:135576304-135576326 CTGTGGCGTCTCTGGGGCACAGG - Intergenic
1062263946 9:135678288-135678310 ATGTGCTGGGACTGGGGCTGGGG + Intergenic
1062323211 9:136000687-136000709 CAGATCTGGCTCTGGGGGTCTGG - Intergenic
1062349745 9:136133054-136133076 CGGGGCAGGCTCTGGGGCGCGGG - Intergenic
1062391487 9:136335739-136335761 CTGGGCTGTGTCTGGGGCACAGG - Intronic
1062447033 9:136599424-136599446 CTGGGCTGGACCTAGGGCTCTGG - Intergenic
1062580132 9:137225767-137225789 GTGGGTTGGCTCTGGGGCACAGG - Exonic
1062731887 9:138114522-138114544 CTGTGATGCCTCCGAGGCTCTGG + Intronic
1062732882 9:138119460-138119482 CAGGGCTGGCACGGGGGCTCCGG - Intronic
1186276052 X:7939170-7939192 CTGTGCTGTCTCTGCTGGTCTGG - Intergenic
1187247680 X:17567608-17567630 CTGTTCTTTCCCTGGGGCTCAGG - Intronic
1188274507 X:28183052-28183074 CTGTTTTTGCTCTGGGGGTCAGG + Intergenic
1188811263 X:34656735-34656757 CTGTCCTGGCAGTGGGGCGCGGG + Intronic
1190059543 X:47201978-47202000 CTGAGCTGAGTCTGGGGCACAGG + Intronic
1190282020 X:48937253-48937275 CTGTGCGGGCTCTGTGGTCCTGG - Intronic
1190329387 X:49226378-49226400 CTGGGCTGGGTCAGGGGCTGGGG + Intronic
1192194241 X:69018055-69018077 CTGTGCTGGATGTGGGCCCCAGG - Intergenic
1192362289 X:70447466-70447488 CTGGGCTGGCTCTGCAGCTGTGG - Intronic
1195094855 X:101493083-101493105 CTGGGCTGGCACTGGGGACCAGG + Exonic
1195393702 X:104388845-104388867 CTGTGGTGGCTCTTGGGCTTTGG + Intergenic
1198081710 X:133246227-133246249 TTGTGCTGTGTCTGTGGCTCAGG - Intergenic
1198373606 X:136015783-136015805 CTTTGCTGGCTGTGTGGCTTTGG - Intronic
1199597815 X:149522032-149522054 CTGTGGTGCCTGTGGGGCACTGG - Intronic
1199738801 X:150711870-150711892 CTGTGCTTGCTCTGGGTCCAAGG + Intronic
1200053932 X:153448877-153448899 ATGTGCTGCCCCTGGGGCTTGGG - Intronic
1200270303 X:154676445-154676467 CAGAGCTGGCTGTGGGGCTTAGG + Intronic
1202258524 Y:22944841-22944863 TTGTCCTGGCCCTGTGGCTCTGG - Intergenic
1202411513 Y:24578599-24578621 TTGTCCTGGCCCTGTGGCTCTGG - Intergenic
1202459269 Y:25091473-25091495 TTGTCCTGGCCCTGTGGCTCTGG + Intergenic