ID: 1152392124

View in Genome Browser
Species Human (GRCh38)
Location 17:80009386-80009408
Sequence ACGAGGGCCCTCATGGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152392124_1152392140 26 Left 1152392124 17:80009386-80009408 CCCAAGGCCATGAGGGCCCTCGT 0: 1
1: 0
2: 2
3: 36
4: 343
Right 1152392140 17:80009435-80009457 GAAGGTCTCTTTGGGTTCCAAGG 0: 1
1: 0
2: 0
3: 20
4: 156
1152392124_1152392137 17 Left 1152392124 17:80009386-80009408 CCCAAGGCCATGAGGGCCCTCGT 0: 1
1: 0
2: 2
3: 36
4: 343
Right 1152392137 17:80009426-80009448 CCCACTCAGGAAGGTCTCTTTGG 0: 1
1: 0
2: 2
3: 12
4: 147
1152392124_1152392132 8 Left 1152392124 17:80009386-80009408 CCCAAGGCCATGAGGGCCCTCGT 0: 1
1: 0
2: 2
3: 36
4: 343
Right 1152392132 17:80009417-80009439 GCAACCCTCCCCACTCAGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 192
1152392124_1152392131 4 Left 1152392124 17:80009386-80009408 CCCAAGGCCATGAGGGCCCTCGT 0: 1
1: 0
2: 2
3: 36
4: 343
Right 1152392131 17:80009413-80009435 CCATGCAACCCTCCCCACTCAGG 0: 1
1: 0
2: 2
3: 26
4: 248
1152392124_1152392139 18 Left 1152392124 17:80009386-80009408 CCCAAGGCCATGAGGGCCCTCGT 0: 1
1: 0
2: 2
3: 36
4: 343
Right 1152392139 17:80009427-80009449 CCACTCAGGAAGGTCTCTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152392124 Original CRISPR ACGAGGGCCCTCATGGCCTT GGG (reversed) Intronic
900492072 1:2955332-2955354 AGGTGGGCCTCCATGGCCTTGGG + Intergenic
900546279 1:3231015-3231037 AAGAGGGCACTCATGTCCTTGGG - Intronic
900738271 1:4313976-4313998 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
900852350 1:5153958-5153980 AGGTGGGCTCTCATAGCCTTGGG - Intergenic
900901480 1:5519469-5519491 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
906938523 1:50235424-50235446 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
908715803 1:67068114-67068136 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
909105248 1:71398374-71398396 AGGTGGGCTCCCATGGCCTTAGG - Exonic
909574619 1:77159592-77159614 ACGTGGGCTCCCATGTCCTTGGG - Intronic
910512836 1:88025507-88025529 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
911798965 1:102109959-102109981 AGGTGGCCTCTCATGGCCTTGGG + Intergenic
912153079 1:106882895-106882917 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
912206120 1:107511068-107511090 ACATGGGCTCCCATGGCCTTGGG - Intergenic
912267657 1:108174733-108174755 AAGTGGGCTCCCATGGCCTTGGG - Intronic
917152063 1:171956462-171956484 AAGTGGGCTCCCATGGCCTTGGG + Intronic
918935547 1:190916239-190916261 AGGTGGGCCCCCATGGCCTTGGG - Intergenic
919273794 1:195385533-195385555 AGGTGGGCTCTGATGGCCTTGGG - Intergenic
920594470 1:207255271-207255293 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
921338494 1:214111396-214111418 TGGAGGGCACACATGGCCTTGGG - Intergenic
921716083 1:218418229-218418251 AAGTGGGCTCCCATGGCCTTGGG - Intronic
923179117 1:231499062-231499084 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
923428084 1:233891868-233891890 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
924152370 1:241142110-241142132 ACGTGGGTCCCCATGGTCTTGGG + Intronic
924767453 1:247047033-247047055 AAGTGGACTCTCATGGCCTTGGG + Intronic
1063014643 10:2064032-2064054 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1068404303 10:56570225-56570247 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1068454671 10:57238937-57238959 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1069339931 10:67398245-67398267 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1071327848 10:84534529-84534551 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1072825167 10:98598981-98599003 ATGATGGCCCCCATGGCCTAAGG - Intronic
1073628047 10:105119601-105119623 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1073990900 10:109261373-109261395 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1077541422 11:3148255-3148277 CCGATGCCCCTCATGACCTTGGG - Intronic
1078379648 11:10828860-10828882 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1078884494 11:15486472-15486494 ACGTGGGCTCTGATGGCCTGCGG + Intergenic
1078923926 11:15857450-15857472 AGGTGGGCCCTCAAGGCCGTGGG + Intergenic
1079088114 11:17461623-17461645 GTGAGGGCCCTCATGGCGATGGG + Exonic
1080359270 11:31493901-31493923 AGGTGGGCACCCATGGCCTTGGG + Intronic
1080843284 11:36004444-36004466 AGGTGGGCTCTCAAGGCCTTGGG + Intronic
1081021972 11:37958517-37958539 AGGTGGGTCCCCATGGCCTTGGG + Intergenic
1081033908 11:38117714-38117736 AGGTGGGCTCACATGGCCTTGGG - Intergenic
1081236607 11:40654371-40654393 AAGTGAGCTCTCATGGCCTTGGG - Intronic
1081246286 11:40770846-40770868 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1081689935 11:45071014-45071036 TCCAGGGCCCTCCTGGGCTTGGG + Intergenic
1081769093 11:45636243-45636265 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1083121810 11:60520623-60520645 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1084252482 11:67911224-67911246 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1085235221 11:75009446-75009468 CCCAGGGCCCTGAAGGCCTTGGG - Exonic
1086765890 11:90694303-90694325 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1086904266 11:92401302-92401324 AAGAGGACCCTCATGGCTCTGGG + Intronic
1086991914 11:93313172-93313194 AGGTGGACTCTCATGGCCTTGGG + Intergenic
1087341863 11:96916450-96916472 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1087571024 11:99928147-99928169 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1091932151 12:4404577-4404599 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1092422739 12:8346025-8346047 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1092618125 12:10234216-10234238 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1092662602 12:10755203-10755225 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
1093192521 12:16091647-16091669 ACGTTGGCTCACATGGCCTTGGG + Intergenic
1093753760 12:22830110-22830132 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1095689221 12:45068787-45068809 AGAAGGGCCCCCATAGCCTTGGG + Intergenic
1096969223 12:55652011-55652033 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1097617196 12:61898130-61898152 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1098327286 12:69316080-69316102 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1098578409 12:72070680-72070702 AGGTGGGCTCTCATGGCCTTCGG + Intronic
1098944338 12:76573492-76573514 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1100072178 12:90734650-90734672 GGGTGGGCCCTCAAGGCCTTGGG + Intergenic
1100336201 12:93632763-93632785 AGGTGGGCTCTCAAGGCCTTGGG - Intergenic
1100898847 12:99215548-99215570 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1104588022 12:130063021-130063043 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1106618958 13:31355697-31355719 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
1106718841 13:32418707-32418729 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1106942855 13:34796359-34796381 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1108828861 13:54452369-54452391 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1108885725 13:55178783-55178805 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1109086046 13:57972848-57972870 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1110492434 13:76124862-76124884 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1110929160 13:81194067-81194089 AGGTGGACTCTCATGGCCTTGGG + Intergenic
1110955287 13:81546224-81546246 AGGTGGGCTCTCATGGCCTTGGG + Intergenic
1111036111 13:82676942-82676964 ACGTGGGCTCCCATGGCCTCGGG + Intergenic
1112568156 13:100568999-100569021 AGGTGGGCTCTCATGGCCTTGGG + Intronic
1112623687 13:101078417-101078439 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1113284995 13:108836638-108836660 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1114948462 14:27716278-27716300 AGGTGGGTTCTCATGGCCTTAGG - Intergenic
1115309659 14:31966392-31966414 AGCAGTGCCCTCATGGCCTTGGG + Intergenic
1116528388 14:45935207-45935229 AGGTGGGCTCCCATGGCCTTAGG - Intergenic
1116714108 14:48406698-48406720 AGGTGGGTTCTCATGGCCTTGGG + Intergenic
1125246535 15:37647341-37647363 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1125687102 15:41570021-41570043 AGGAGGGCCCTGCTGGCCTGTGG - Exonic
1127051084 15:55084929-55084951 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1127071018 15:55289032-55289054 ACCTGGGCCCACATGGCCTCAGG - Intronic
1129628980 15:77236305-77236327 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1130778470 15:87009707-87009729 AAGTGGGCTCCCATGGCCTTGGG - Intronic
1131459533 15:92608640-92608662 ACGTGGGCCTTCCTGGCCTTGGG + Intergenic
1133375520 16:5283540-5283562 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1133504520 16:6398670-6398692 AAGTGGGCCCCCATGGCCTTGGG + Intronic
1135918981 16:26631459-26631481 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1137951995 16:52792277-52792299 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1138198419 16:55071409-55071431 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1139166146 16:64567040-64567062 AGGAGGGCTCCCATGGCCTTGGG - Intergenic
1140489741 16:75325170-75325192 ACTAGGGCCCTCAAGGCTGTTGG - Intronic
1141273118 16:82558641-82558663 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1142214188 16:88822751-88822773 ACGAGGCCCCTCACGGCCGCAGG - Intronic
1145262261 17:21361460-21361482 TCGGGGGGCCTCAAGGCCTTGGG - Intergenic
1146476272 17:33165102-33165124 AGGAGGCCCCACATGGCCCTGGG + Intronic
1148905246 17:50907834-50907856 ACCAGGGCCCTCATGGCTCATGG + Intergenic
1151363233 17:73600957-73600979 AAGAGAGGCCTCAGGGCCTTTGG + Intronic
1151915027 17:77111545-77111567 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1152392124 17:80009386-80009408 ACGAGGGCCCTCATGGCCTTGGG - Intronic
1153371424 18:4320846-4320868 ACTAGGGCACTATTGGCCTTTGG - Intronic
1154178583 18:12108924-12108946 ATGTGGGCTCCCATGGCCTTGGG + Intronic
1156344234 18:36241472-36241494 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1158124132 18:54083132-54083154 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1159070106 18:63613544-63613566 AGGCGGGCTCCCATGGCCTTGGG + Intergenic
1159138087 18:64360924-64360946 AGGTGGGCACCCATGGCCTTGGG + Intergenic
1159261265 18:66016076-66016098 AGGTGGGCCCCCATGGCCTTGGG + Intergenic
1159652638 18:70996053-70996075 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1159717698 18:71847356-71847378 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1159718739 18:71858821-71858843 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1160258190 18:77265347-77265369 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1160573822 18:79837267-79837289 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
1160797470 19:952710-952732 AGGTGGGGCCTCATGGACTTTGG + Intronic
1160989427 19:1854450-1854472 ACGAGGGCCCTACAGGCCTGCGG + Exonic
1162199256 19:9009085-9009107 ACGAGGGGCCTCAAGGGGTTGGG - Intergenic
1165120792 19:33557135-33557157 GCTAGGTCCCACATGGCCTTTGG + Intergenic
1167444359 19:49528546-49528568 ACGCAGGCCCTCATGGCCAGGGG + Exonic
1168255182 19:55161120-55161142 ACGGGGCCCTTCGTGGCCTTCGG - Exonic
925291989 2:2754170-2754192 AGGTGGGTTCTCATGGCCTTGGG - Intergenic
926147294 2:10404558-10404580 AGGAGGGACCTCATGCCCTGAGG + Intronic
926280527 2:11442352-11442374 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
926526817 2:13991788-13991810 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
926653328 2:15370593-15370615 GGGTGGGCTCTCATGGCCTTAGG - Intronic
927660818 2:24991329-24991351 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
930230184 2:48835346-48835368 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
930419730 2:51135371-51135393 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
930560040 2:52949727-52949749 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
930939704 2:56998746-56998768 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
931006545 2:57856087-57856109 ACGTGGGCTTCCATGGCCTTTGG + Intergenic
931096176 2:58943267-58943289 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
931150358 2:59566294-59566316 ATGGGAGCCCTCAGGGCCTTAGG - Intergenic
932799165 2:74724157-74724179 TCCAGGGCCCTCTTGGCCCTGGG - Intergenic
932849594 2:75171649-75171671 AGGAGGGCTCCCATGGTCTTGGG - Intronic
935322985 2:101906704-101906726 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
936794953 2:116194009-116194031 AGGTGGGCCCTCACAGCCTTGGG + Intergenic
937358734 2:121214353-121214375 GGGAGGGCCTTCAAGGCCTTGGG - Intergenic
939037450 2:137149592-137149614 AGGTGGGCTCTCATGGCCTTGGG - Intronic
942380578 2:175386385-175386407 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
943004687 2:182375497-182375519 AGGTGGGCTTTCATGGCCTTGGG + Intronic
944304008 2:198158055-198158077 AGGTGGGCTCCCATGGCCTTGGG - Intronic
945457149 2:210063547-210063569 AGGTGGGCTCCCATGGCCTTGGG - Intronic
945730306 2:213524566-213524588 AGGTGGGCTCCCATGGCCTTGGG - Intronic
948953690 2:241271986-241272008 CCGCGGGCCCTCGTGGCCTGTGG - Intronic
1170065223 20:12303441-12303463 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1170750287 20:19139235-19139257 AGGTGGGCTCCCATGGCCTTAGG + Intergenic
1173098535 20:40061472-40061494 AGGTGGGCTCTCAAGGCCTTGGG - Intergenic
1173201339 20:40957439-40957461 ACCAGGTCCCTCATGGCCCTGGG - Intergenic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1176315368 21:5237508-5237530 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
1176358684 21:5974152-5974174 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1176687367 21:9862680-9862702 ACGTGGGCTCCCATGGCCTTGGG - Intergenic
1176883820 21:14230114-14230136 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1177317107 21:19476869-19476891 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1177367154 21:20153288-20153310 ACGTGGGCTCCCAAGGCCTTGGG + Intergenic
1177803297 21:25849038-25849060 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1177854269 21:26383875-26383897 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1177990452 21:28030070-28030092 AGGTGGGCACCCATGGCCTTGGG + Intergenic
1179613876 21:42569408-42569430 ACGGGGGCCAGCCTGGCCTTCGG - Intronic
1179764834 21:43564398-43564420 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1180393152 22:12303463-12303485 AGGTGGGATCTCATGGCCTTGGG - Intergenic
1180406597 22:12561305-12561327 AGGTGGGATCTCATGGCCTTGGG + Intergenic
1181514642 22:23403658-23403680 AGGAGGGCCATCAAGGCCTCAGG - Intergenic
1182877654 22:33706314-33706336 ACGAGGTCCCTCTTGGCCATTGG - Intronic
1184157681 22:42679081-42679103 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1185264955 22:49896453-49896475 ATAAGGGCTCACATGGCCTTGGG - Intergenic
950869761 3:16218687-16218709 ACGAGGGGCCTCATGGAGTCAGG - Intronic
952022531 3:29040611-29040633 ACGTGGGCCCCCATGGCCTTGGG - Intergenic
952096458 3:29960330-29960352 AGGTGGGCTCCCATGGCCTTGGG + Intronic
954087428 3:48256408-48256430 AACAGGGCGTTCATGGCCTTGGG - Intronic
954393248 3:50278602-50278624 ATCAGAGCCCTCATGGCATTGGG + Intergenic
954611074 3:51944889-51944911 ACCATGGCCCTCATGGACCTGGG + Exonic
954792685 3:53144720-53144742 AGGAGGCACCTCCTGGCCTTGGG + Intergenic
955465194 3:59230052-59230074 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
956947027 3:74234723-74234745 ACGTGGACTCTGATGGCCTTGGG + Intergenic
957716571 3:83936020-83936042 ACCAGGGCCCCCAAAGCCTTGGG - Intergenic
957909558 3:86604015-86604037 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
957978260 3:87474651-87474673 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
958475008 3:94569311-94569333 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
958611828 3:96436406-96436428 AGGTGGGTCCCCATGGCCTTGGG + Intergenic
958687995 3:97425026-97425048 AGGTGGGCTCCCATGGCCTTAGG + Intronic
959742505 3:109737131-109737153 AGGTGGGCACCCATGGCCTTGGG + Intergenic
960021879 3:112964411-112964433 AGGAGGGTCCCCATGGTCTTGGG - Intronic
960134205 3:114089366-114089388 GAGAGGGGCCTCCTGGCCTTGGG + Intergenic
960858066 3:122123264-122123286 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
961151342 3:124641036-124641058 ATGGGGGATCTCATGGCCTTTGG - Intronic
961201369 3:125048363-125048385 ACCATGGTCCTCATGGCCCTGGG + Intronic
961286607 3:125810386-125810408 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
962461073 3:135613060-135613082 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
965101890 3:164309315-164309337 AAGTGGGCTCTTATGGCCTTAGG + Intergenic
969011143 4:4063729-4063751 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
969742927 4:9046169-9046191 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
970302133 4:14692489-14692511 AGGTGGGCTCTGATGGCCTTGGG - Intergenic
970756910 4:19437691-19437713 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
970758075 4:19450595-19450617 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
970997483 4:22283548-22283570 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
971119702 4:23689834-23689856 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
971546341 4:27891464-27891486 AGGTGGGCACCCATGGCCTTGGG - Intergenic
971744895 4:30566763-30566785 ACATGGGCTCCCATGGCCTTGGG - Intergenic
972839523 4:42914309-42914331 AGGTGGGCTCCCATGGCCTTGGG - Intronic
974125733 4:57693345-57693367 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
974214459 4:58827758-58827780 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
974679804 4:65146610-65146632 AAGTGAGCTCTCATGGCCTTGGG + Intergenic
974973923 4:68866395-68866417 AGGAGGGCTCTCAAGGCTTTGGG - Intergenic
976952528 4:90850481-90850503 AAGTGGGCTCCCATGGCCTTGGG - Intronic
977952776 4:102993427-102993449 AGGTGGGCTCCCATGGCCTTGGG + Intronic
978145480 4:105366526-105366548 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
978904119 4:113985815-113985837 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
978991306 4:115085062-115085084 AGGTGGGCTCCCATGGCCTTGGG - Intronic
979699962 4:123656387-123656409 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
980579671 4:134732928-134732950 AGGTGGGCTTTCATGGCCTTGGG - Intergenic
981380208 4:144062942-144062964 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
981829714 4:148985766-148985788 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
982301264 4:153881431-153881453 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
982477166 4:155867972-155867994 AGGTGGGCTCCCATGGCCTTGGG + Intronic
983297979 4:165890643-165890665 AGGTGGGCTCCCATGGCCTTGGG + Intronic
983478319 4:168242450-168242472 AGGTGGGCTCCCATGGCCTTGGG - Intronic
984318509 4:178160959-178160981 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
985394372 4:189526014-189526036 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
985431765 4:189888065-189888087 AGTTGGGCTCTCATGGCCTTGGG + Intergenic
985474180 5:68904-68926 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
987541490 5:19261462-19261484 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
987650349 5:20732905-20732927 AAGTGGGCTCTCAAGGCCTTAGG + Intergenic
987675101 5:21063857-21063879 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
987918508 5:24248395-24248417 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
988473822 5:31565340-31565362 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
988745202 5:34128562-34128584 AAGTGGGCTCTCAAGGCCTTAGG - Intergenic
989399349 5:40992630-40992652 AGGTGGGCTCCCATGGCCTTAGG + Intergenic
989726791 5:44597036-44597058 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
989787012 5:45344711-45344733 AGGTGGGCTCGCATGGCCTTGGG + Intronic
990903526 5:60779083-60779105 AGGTGGGCTCCCATGGCCTTGGG + Intronic
991355690 5:65766950-65766972 GGGTGGGCCCCCATGGCCTTGGG + Intronic
991764348 5:69958454-69958476 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
991843580 5:70833526-70833548 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
991875421 5:71160020-71160042 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
992885042 5:81150129-81150151 ACGTGGGCCATAAGGGCCTTAGG + Intronic
993037034 5:82769663-82769685 AAGTGGGCTCCCATGGCCTTAGG - Intergenic
993531085 5:89026701-89026723 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
993967116 5:94372111-94372133 AGGTGGGCTCCCATGGCCTTGGG + Intronic
994464743 5:100112156-100112178 AGGTGGGCTCTCATGACCTTTGG + Intergenic
995055466 5:107754143-107754165 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
995627176 5:114092330-114092352 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
995703535 5:114961685-114961707 AGGGGGGCTCACATGGCCTTGGG + Intergenic
995828569 5:116329148-116329170 AGGTGGGCACCCATGGCCTTGGG + Intronic
995971184 5:117973474-117973496 AGGCGGGCCCCTATGGCCTTGGG + Intergenic
996122843 5:119691117-119691139 AGGTGGGCTCTCATGGTCTTGGG + Intergenic
996255937 5:121403023-121403045 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
997088271 5:130826678-130826700 AGGTGGGCCCTCATGGCCTTGGG + Intergenic
999492680 5:152066931-152066953 ACAAGGGCTCTCATGGGGTTTGG + Intergenic
999504358 5:152179810-152179832 GGGTGGGCCCCCATGGCCTTAGG + Intergenic
1000515940 5:162236545-162236567 AAGTGGGCCCCCATGGTCTTGGG + Intergenic
1000581094 5:163035954-163035976 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1001560159 5:172663726-172663748 ACCAAGGCCCTGCTGGCCTTGGG - Intronic
1001857509 5:175025649-175025671 ACTGGGGCCCTACTGGCCTTTGG + Intergenic
1001943898 5:175761587-175761609 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1002869890 6:1157189-1157211 AGGTGGGCTCTGATGGCCTTGGG - Intergenic
1002958173 6:1888963-1888985 AGGTGGGCCCCCATGGCCTTGGG + Intronic
1005543326 6:26836311-26836333 AAGTGGGCTCTCAAGGCCTTAGG - Intergenic
1005783466 6:29217968-29217990 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1007717601 6:43866248-43866270 AAGGGAGACCTCATGGCCTTGGG + Intergenic
1008283876 6:49626468-49626490 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1009014150 6:57878481-57878503 AAGTGGGCTCTCAAGGCCTTAGG - Intergenic
1010458128 6:76082564-76082586 AGGTGGGCCCCCATAGCCTTGGG + Intergenic
1010515011 6:76762069-76762091 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1010606008 6:77890281-77890303 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1011343712 6:86346416-86346438 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1011429956 6:87274954-87274976 ATGATGGCCCTCATGTCCCTAGG + Intergenic
1011933108 6:92738342-92738364 AGGTGGGCTCCCATGGCCTTTGG - Intergenic
1013213617 6:108008029-108008051 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1014154222 6:118092667-118092689 AGGTGGGCTCTCATGGCCTCGGG - Intronic
1014951263 6:127558585-127558607 AGGTGGGCTCTCATGACCTTGGG - Intronic
1015419229 6:132987086-132987108 TAGAGGTCCCTCATGGCCTGTGG - Intergenic
1015487619 6:133790226-133790248 AGGTGGGCTCCCATGGCCTTTGG + Intergenic
1016143576 6:140643577-140643599 ACGTGGGTTCCCATGGCCTTGGG + Intergenic
1017133703 6:151129897-151129919 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1018358311 6:163040597-163040619 AGGTGGGCTCCCATGGCCTTAGG - Intronic
1018416287 6:163604982-163605004 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1018511201 6:164526463-164526485 ATGTGGGCTCCCATGGCCTTGGG - Intergenic
1019039415 6:169091173-169091195 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1019756483 7:2774467-2774489 ACAAGGGCCCTGATGGCGCTGGG + Intronic
1020151084 7:5682107-5682129 GCGTGGGCCCGCATGGCCTCAGG - Intronic
1021380106 7:19956053-19956075 AGGTGGGCTCTCAAGGCCTTAGG - Intergenic
1022502699 7:30892584-30892606 AGGAGGGACCTCTTGGCCATGGG + Intergenic
1022595922 7:31713361-31713383 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1023236920 7:38099487-38099509 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1025221571 7:57114850-57114872 GGGTGGGCCCTCATGGCCTTGGG + Intergenic
1025267395 7:57474942-57474964 GGGTGGGCCCTCATGGCCTTTGG - Intergenic
1025632354 7:63286518-63286540 GGGTGGGCCCTCATGGCCTTGGG + Intergenic
1025650208 7:63459714-63459736 GGGTGGGCCCTCCTGGCCTTGGG - Intergenic
1025721617 7:64020808-64020830 GGGTGGGCCCTCATGGCCTTAGG - Intergenic
1026096706 7:67352180-67352202 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1027506424 7:79021433-79021455 AAGTGGGCTCACATGGCCTTTGG - Intronic
1027937894 7:84632649-84632671 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1029070430 7:97891752-97891774 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1029948245 7:104556025-104556047 AGGTGGGCTCCCATGGCCTTAGG + Intronic
1029961513 7:104693019-104693041 AGGTGGGCTCTCACGGCCTTGGG - Intronic
1031172446 7:118308825-118308847 ATGTGGGCTCCCATGGCCTTGGG + Intergenic
1031608296 7:123795008-123795030 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1033871816 7:145763007-145763029 AGGTGGGCTCCCATGGCCTTAGG - Intergenic
1033998675 7:147385629-147385651 AGGTGGGCCCCCATGGCCTTGGG + Intronic
1034997454 7:155587167-155587189 ATGAGGACCCCCATGACCTTGGG + Intergenic
1035363488 7:158329369-158329391 AGGAGGAGCCTCATGGGCTTGGG - Intronic
1036364826 8:8111096-8111118 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1036893728 8:12614104-12614126 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1037206070 8:16321193-16321215 AGGTGGGTCCTCATGCCCTTGGG - Intronic
1038455794 8:27671192-27671214 TCCAGGGCCCTCAGGGCCTCAGG + Exonic
1039197905 8:35052735-35052757 AGGTGGGCTCCCATGGCCTTAGG + Intergenic
1039309291 8:36298060-36298082 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1039610386 8:38914549-38914571 CAGAGGGCCTTCATGGGCTTGGG + Intronic
1040741394 8:50580071-50580093 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1041430731 8:57778100-57778122 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
1041852136 8:62403967-62403989 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1042180998 8:66087783-66087805 AGGTGGGCCCTCACAGCCTTGGG + Intronic
1043065663 8:75567552-75567574 ATGTGGGCCCCCAAGGCCTTGGG + Intergenic
1043266224 8:78270665-78270687 AGGTGGGCCCCCAGGGCCTTTGG + Intergenic
1043518617 8:81019947-81019969 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1043591080 8:81834741-81834763 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1044877262 8:96681796-96681818 AAGTGGGCTCCCATGGCCTTGGG - Intronic
1045931569 8:107633259-107633281 AGGGGGGCACTCATGCCCTTGGG - Intergenic
1045977184 8:108142770-108142792 TCTAGGGTCCTCATTGCCTTAGG - Intergenic
1046180070 8:110633519-110633541 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1046358409 8:113117718-113117740 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1046532999 8:115471896-115471918 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1049345098 8:142134489-142134511 ACGCGGGTCCTGGTGGCCTTGGG - Intergenic
1050945458 9:11511296-11511318 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1051102924 9:13542808-13542830 AGTAGGGCCTTCATGGCCCTAGG - Intergenic
1051267596 9:15323692-15323714 AAGTGGGCTCTCATGGCCTTGGG - Intergenic
1052053905 9:23882358-23882380 AAGTGGGCCCCTATGGCCTTGGG + Intergenic
1053574568 9:39345460-39345482 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1053625694 9:39868161-39868183 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1053720932 9:40946104-40946126 AGGTGGGCTCTCATGGCCTTGGG + Intergenic
1053839134 9:42173703-42173725 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1054096132 9:60904150-60904172 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1054117595 9:61180089-61180111 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1054218194 9:62382540-62382562 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1054345060 9:63906052-63906074 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
1054590159 9:67002477-67002499 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1054868259 9:70025234-70025256 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1055174289 9:73298869-73298891 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1055848390 9:80594799-80594821 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1056695504 9:88846839-88846861 AGGTGGGCCTTCAAGGCCTTGGG - Intergenic
1057626646 9:96684074-96684096 ACGCTTGCCTTCATGGCCTTAGG + Intergenic
1058393599 9:104524682-104524704 AGGTGGGCTCTCATGGCCTTGGG + Intergenic
1059045539 9:110862092-110862114 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1062463801 9:136672529-136672551 CTGAGGGCCCACCTGGCCTTGGG - Exonic
1062712631 9:137985027-137985049 ACGTGGGCCAGCATGGACTTTGG + Intronic
1186053381 X:5624009-5624031 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1188134960 X:26483830-26483852 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1188587898 X:31799964-31799986 AGGTGGGCTCCCATGGCCTTGGG + Intronic
1189176500 X:38963131-38963153 AGGTGGGCCCCCATGGCCTTGGG + Intergenic
1189604294 X:42660175-42660197 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1191052238 X:56206593-56206615 AGGTGGACTCTCATGGCCTTGGG + Intergenic
1191083996 X:56545321-56545343 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1192131838 X:68559107-68559129 ACGTGGGCTCCCATAGCCTTGGG + Intergenic
1192279012 X:69663792-69663814 AGGTGGGCTCCCATGGCCTTGGG - Intronic
1193455804 X:81730002-81730024 AAGTGGGCTCTCATGGCCTTGGG - Intergenic
1193795994 X:85874388-85874410 ATGAGGTGCCTCATGGTCTTGGG - Intronic
1194032682 X:88835902-88835924 AAGTGGGCTCCCATGGCCTTGGG + Intergenic
1194092799 X:89599809-89599831 AGGTGGGCTCTCATGGCCTTGGG + Intergenic
1194499233 X:94659165-94659187 AGGTGGGCTCTCATGGCCTCAGG - Intergenic
1194542338 X:95190058-95190080 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1194560377 X:95412181-95412203 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
1194582885 X:95697894-95697916 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1195243155 X:102972937-102972959 AGGTGGGCTCTCATGGCCTTGGG - Intergenic
1196173706 X:112617313-112617335 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1196582474 X:117393587-117393609 ACGAGTGCCCTGATGGGTTTTGG - Intergenic
1197109427 X:122755629-122755651 AGGTGGGCTCCCATGGCCTTGGG + Intergenic
1197223217 X:123932776-123932798 AAGTGGGCTCCCATGGCCTTGGG - Intergenic
1197464342 X:126784489-126784511 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1199060498 X:143350597-143350619 ATGAGGGCTCCCATGGCCTTGGG + Intergenic
1199113215 X:143959119-143959141 ATGTGGGCTCTCATGGTCTTGGG + Intergenic
1199170879 X:144733314-144733336 AGGTGGGCCCCCATAGCCTTGGG + Intergenic
1199476798 X:148254914-148254936 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1199566155 X:149217502-149217524 AGGTGGGCTCCCATGGCCTTGGG - Intergenic
1199999379 X:153049814-153049836 AGGTGGGCTCACATGGCCTTGGG - Intergenic