ID: 1152395313

View in Genome Browser
Species Human (GRCh38)
Location 17:80029358-80029380
Sequence TCAGCTCCAACCCAACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152395313 Original CRISPR TCAGCTCCAACCCAACAGCC TGG (reversed) Intronic
900781853 1:4623727-4623749 TGAGCCCAAACCCCACAGCCAGG + Intergenic
900920916 1:5669833-5669855 TCAGCTGCACCGCAACATCCAGG + Intergenic
902450092 1:16491298-16491320 TCAGCCCCCACCCCAGAGCCTGG - Intergenic
902859895 1:19237631-19237653 TCAGGTCTAACCCCACAGCCTGG - Intronic
903254164 1:22081493-22081515 TCTGCTCTACCCCAGCAGCCTGG - Intronic
903836156 1:26204492-26204514 TCCGGGCCAACCTAACAGCCTGG + Intergenic
904453174 1:30629709-30629731 TCAGCACCAAGCCAACTGGCAGG + Intergenic
905462149 1:38128999-38129021 TCAGGTCCAAGCCCACAGCCAGG - Intergenic
905547102 1:38808531-38808553 TGTGCTCCAAGCCAATAGCCTGG - Intergenic
908891826 1:68857794-68857816 GCAGCTCTACCCCAACAGTCAGG - Intergenic
909533980 1:76713068-76713090 GCAGCTCCAACCCAACAAACTGG + Intergenic
909599040 1:77441951-77441973 ACAGCTACAACCCAACCTCCTGG - Intronic
909712887 1:78672734-78672756 TCAGCTCTACCCCAACAGTCAGG - Intergenic
916072313 1:161177444-161177466 TCACCGCCACCCCAACAGCCGGG + Exonic
917227127 1:172796262-172796284 TCAGATCCATCCCAACACCAAGG - Intergenic
917702420 1:177594724-177594746 TCAGCTCCAGGCCAATTGCCTGG - Intergenic
919491784 1:198213357-198213379 GCAGCTCTACCCCAACAGTCAGG + Intronic
920040064 1:203089845-203089867 TCAGCTCCAACCTGACAGCAGGG + Intergenic
921052919 1:211523872-211523894 CCAGCTCCAAGCCTAGAGCCTGG + Intergenic
923043140 1:230333950-230333972 TCAGCTGCTCCCCAGCAGCCTGG + Intronic
923669081 1:236024815-236024837 TCAGCTCCTTCCCGACAGCTGGG + Intronic
1062824282 10:556968-556990 TCAGCTTTAAGACAACAGCCAGG + Intronic
1064868956 10:19915966-19915988 TCAGCTCAAGCCTAACAGCCAGG + Intronic
1065260819 10:23921703-23921725 TAACCTGCAACCAAACAGCCAGG - Intronic
1065313065 10:24434694-24434716 TCTGTTCCAACCAAACAACCTGG + Intronic
1067461584 10:46462189-46462211 TCATCATCAACCCAACAGGCTGG - Exonic
1067625610 10:47922412-47922434 TCATCATCAACCCAACAGGCTGG + Intergenic
1067675161 10:48368425-48368447 TCACCTCCAAGCCAACATGCGGG - Intronic
1071106902 10:82108744-82108766 TCATCTCCTACCCAACAATCAGG - Intronic
1072675234 10:97460695-97460717 TCAGCTCCTGCCTTACAGCCCGG - Exonic
1075426885 10:122348957-122348979 TCAGCCGTGACCCAACAGCCAGG - Intergenic
1075603457 10:123787759-123787781 TCACCTGCAACCCAGAAGCCCGG + Intronic
1076221905 10:128740466-128740488 TCAGCTCCCACTCAACAGTTGGG - Intergenic
1076673605 10:132136411-132136433 TCCTCTCCTCCCCAACAGCCGGG - Intronic
1077270288 11:1674631-1674653 TCAGCCCCAAGGCACCAGCCTGG + Intergenic
1077332077 11:1988216-1988238 GCAGCTGCAGCCCCACAGCCTGG + Intergenic
1077470657 11:2758843-2758865 TGATCTCCATCCCTACAGCCTGG - Intronic
1077907260 11:6544265-6544287 TCAGGTCTCACCCATCAGCCTGG - Intronic
1079011082 11:16828828-16828850 GCAGCTCCAACCCAAGTCCCAGG - Intronic
1081569530 11:44280936-44280958 CCAGCTGAAATCCAACAGCCAGG - Intronic
1081990918 11:47337172-47337194 TCAGCTCCACCCCAACCAGCTGG + Intronic
1085766919 11:79291421-79291443 TCAGCTACAACCAAACAGCATGG + Intronic
1088743941 11:112788785-112788807 TGAGCCCCAAGCCACCAGCCAGG - Intergenic
1088835742 11:113576749-113576771 TCAGCTCCCAGCCCAGAGCCTGG - Intergenic
1090251156 11:125252788-125252810 CCACCTCCAACCCAAAGGCCGGG - Intronic
1090929492 11:131282529-131282551 GTAGCTCCAGCCCAAAAGCCAGG - Intergenic
1202815058 11_KI270721v1_random:43392-43414 GCAGCTGCAGCCCCACAGCCTGG + Intergenic
1093599233 12:21001794-21001816 GCAGCTCTAACCCAACAGTCAGG - Intergenic
1093827535 12:23712472-23712494 TCAGGACAAACCCAGCAGCCAGG + Intronic
1094663466 12:32494771-32494793 TCAGCTCCAAACCCACAGGTTGG - Intronic
1095985413 12:47995984-47996006 TCTTCTCCCAGCCAACAGCCCGG + Intronic
1096106690 12:49000143-49000165 TCACCTCCAATCCAGAAGCCAGG + Intergenic
1096197352 12:49657204-49657226 TCAGCTCCCACCTGACTGCCTGG - Intronic
1097081379 12:56433716-56433738 TCAGCTCAAACACCAAAGCCTGG + Intronic
1097935240 12:65241930-65241952 TCAACTCAAACCCATCACCCAGG - Intronic
1097977768 12:65706863-65706885 TCAGCTACAACTAAAAAGCCTGG - Intergenic
1102049183 12:109849893-109849915 TCAGCTCCCACCAGGCAGCCTGG + Intergenic
1102164334 12:110794750-110794772 TCAAACCCAACCCAGCAGCCCGG + Intergenic
1102370964 12:112382132-112382154 TCAGCGCCAAGCCTTCAGCCGGG - Intronic
1104057363 12:125240673-125240695 TCAGCTCCAACACTACTTCCTGG + Intronic
1104807810 12:131600679-131600701 GCAGCACCAACCCCACAGGCAGG - Intergenic
1113809472 13:113129630-113129652 TGAGCTCCTTACCAACAGCCAGG - Intronic
1113922706 13:113922929-113922951 TCAGATCCACCCCAACCTCCAGG + Intergenic
1118768661 14:68927336-68927358 TCAGCTCCACACCCCCAGCCTGG + Intronic
1121526672 14:94624149-94624171 TCAGCTCCACCCCAAGATCTGGG + Intronic
1122298045 14:100716560-100716582 TCTGCCCCATCCCAGCAGCCAGG + Intergenic
1124177777 15:27442212-27442234 TCAGCTCCTACTCCCCAGCCAGG + Intronic
1124855374 15:33382463-33382485 TCAGGTGCAAGCCACCAGCCCGG + Intronic
1125356058 15:38818454-38818476 TCCGCTGCCACCCAACAGGCCGG + Intergenic
1126318791 15:47399493-47399515 TCAGATCCAAGGCATCAGCCAGG - Intronic
1129678841 15:77646669-77646691 TCATCTCCATCCCCACAACCTGG + Intronic
1130120923 15:81046889-81046911 TCAGCTTCCACCCAGCAGGCTGG - Intronic
1131265388 15:90912415-90912437 TCAGCTCCAGCCTGACAGCATGG + Intronic
1132469196 16:92512-92534 TCAGATCAGAACCAACAGCCAGG + Intronic
1132604686 16:788789-788811 GCAGCTCCTCCCCAACGGCCGGG - Intronic
1133707256 16:8366593-8366615 TCAGTTACAACACACCAGCCTGG + Intergenic
1134076852 16:11297942-11297964 TCAGCTGCAGCCCCACGGCCTGG + Intronic
1140564915 16:76030759-76030781 TCAGCCCCATCCCACCATCCAGG - Intergenic
1142142528 16:88478941-88478963 TCACGTCCAACCCATCACCCCGG - Intronic
1143495841 17:7312232-7312254 TGAGCACCACCCCAACAGACTGG + Exonic
1143769758 17:9161181-9161203 CCCGCTCCACCCCACCAGCCTGG - Intronic
1144653792 17:17022659-17022681 CCAGGTCCAACCCAGCAGCCTGG + Intergenic
1144732643 17:17537426-17537448 CCAGCTCCAGCCCAACACACCGG + Intronic
1148744113 17:49908847-49908869 TTAGCTTCACCACAACAGCCAGG + Intergenic
1148996868 17:51718320-51718342 TCAGCTCCACCTCAACCTCCAGG + Intronic
1149173114 17:53836554-53836576 GCAGCCCCTACCCAACAGCTAGG - Intergenic
1151428785 17:74048740-74048762 TCAGCTCCTAGCCAAGTGCCTGG + Intergenic
1152395313 17:80029358-80029380 TCAGCTCCAACCCAACAGCCTGG - Intronic
1152684944 17:81689308-81689330 TGAACTCCAGCCCAACAGCCTGG - Intronic
1157093232 18:44661035-44661057 TTATCACCAACCCAATAGCCAGG - Intergenic
1157322113 18:46642564-46642586 TCAACCCCAAACCAACAGCCAGG + Intronic
1160898598 19:1415270-1415292 ACTGCACCCACCCAACAGCCAGG - Intronic
1161979400 19:7622727-7622749 GCAGCCCCCACCCCACAGCCTGG + Intronic
1163488146 19:17601683-17601705 TCATCCCCAACCACACAGCCAGG - Exonic
1163791442 19:19308687-19308709 TCAGCTTGAACCCACCAGCAGGG - Intronic
1165219463 19:34303338-34303360 TCAGATCCGACCCAAAAGACTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
926555113 2:14348540-14348562 TCAACTACAAGCCCACAGCCAGG + Intergenic
929299471 2:40286738-40286760 TCAGCTGCAACCAAACAACCAGG + Intronic
932570165 2:72934358-72934380 CCAGCTCCAGCCCCAGAGCCTGG + Exonic
934735080 2:96685964-96685986 TCAGCCCAAAGCCACCAGCCTGG + Intergenic
937357403 2:121206756-121206778 ACAGGTCGTACCCAACAGCCTGG - Intergenic
938810129 2:134845256-134845278 GCAGCTCCAACACCACAGCAAGG + Exonic
944370296 2:198974411-198974433 TCAGCTCTACCCCAACAGTCAGG + Intergenic
946200699 2:218069212-218069234 TCAGTCCCAGCCCAGCAGCCTGG - Intronic
946326695 2:218988294-218988316 TCAGCCTCCACCTAACAGCCTGG + Intergenic
946371555 2:219284645-219284667 TCAGCTCCAAGCCCAGTGCCAGG - Exonic
948592377 2:239059773-239059795 CCAGCTACCACCCACCAGCCTGG + Intronic
948729805 2:239955769-239955791 GCAGCTCCAAACCCACGGCCAGG + Intronic
1168878578 20:1186883-1186905 CCAGCTCCACCCCCACAGCTGGG + Intronic
1175202766 20:57289618-57289640 TCAGCTGCACCACCACAGCCTGG + Intergenic
1179975759 21:44865029-44865051 TCTGCTGCAGCCCGACAGCCTGG + Intronic
1180967583 22:19798615-19798637 CCAGCTCCTGCCCAGCAGCCTGG + Intronic
1181505524 22:23353792-23353814 TCCTCTCCATCCCACCAGCCAGG - Intergenic
1182648521 22:31830362-31830384 TCTGCTCCAACCCAACATTTGGG - Intronic
1184657254 22:45948127-45948149 TCAGCTCCACCACAACTCCCCGG + Intronic
1184843949 22:47069725-47069747 TCCGCTCCAACCAAACAACCGGG - Intronic
1184843977 22:47069868-47069890 TCCGCTCCAACCAAACAACAGGG - Intronic
1184843984 22:47069917-47069939 TCTGCTCCAACCAAACAACAGGG - Intronic
1184844004 22:47070012-47070034 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844018 22:47070085-47070107 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844039 22:47070205-47070227 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844053 22:47070278-47070300 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844072 22:47070373-47070395 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844086 22:47070446-47070468 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844095 22:47070494-47070516 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844108 22:47070567-47070589 TCCGCTCCAACCAAACAACAGGG - Intronic
1184844184 22:47070903-47070925 TCCGCTCCAACCAAACAACAGGG - Intronic
952057230 3:29462502-29462524 TCAGCTCCAAGTCCACAGCCAGG - Intronic
953541805 3:43826247-43826269 CCAGCACCAACCCACCAGCCAGG - Intergenic
954084115 3:48230599-48230621 ACAGCTTCAACACAACATCCTGG + Intergenic
954130040 3:48556277-48556299 TCAGTTCCAGTCCAACAACCCGG + Intronic
954660437 3:52224189-52224211 TGAGCTCCAGCCCCACGGCCTGG - Exonic
954836330 3:53472278-53472300 TCAGCAGAAACCCTACAGCCAGG - Intergenic
954860377 3:53683335-53683357 GTAGCTCCAACCCTAAAGCCTGG - Intronic
954896596 3:53980175-53980197 TCATCTCCACCCCCACATCCAGG - Intergenic
956762765 3:72458547-72458569 ACTGGTCCAACCCCACAGCCAGG + Intergenic
957254129 3:77814556-77814578 TCAGCTCCATGCCAGCACCCTGG + Intergenic
961647384 3:128399913-128399935 TCAGCTGCACCACAACTGCCAGG + Intronic
964630280 3:158802321-158802343 TCAGCCCCAACCCACCCGGCCGG - Intronic
967666834 3:192182735-192182757 TCAGATCAATCCCAACATCCAGG + Intronic
968596233 4:1487284-1487306 TCATCTCCAACCCATTATCCAGG + Intergenic
968816452 4:2824149-2824171 TCAGCGCAAACCCCACATCCTGG + Intronic
971061767 4:22979296-22979318 GCAGCTCTACCCCAACAGTCAGG + Intergenic
973308967 4:48686156-48686178 TAATCTCCAACCCAACAGAAAGG + Intronic
981716035 4:147753185-147753207 CCAGCTCCAACACAGCAGTCAGG - Intronic
981923781 4:150116335-150116357 GCACCTCTACCCCAACAGCCAGG - Intronic
983286914 4:165751641-165751663 TCAATTCCGACACAACAGCCAGG + Intergenic
985528214 5:418545-418567 TCATCTCCAACCCCGCAGTCAGG - Intronic
991038841 5:62155477-62155499 TCACCTCCAAACCTGCAGCCAGG - Intergenic
991386255 5:66093555-66093577 TCAGCTTCAACTCAATGGCCAGG + Intergenic
993332554 5:86618206-86618228 TCATCTCCCACGCCACAGCCCGG - Intronic
996618531 5:125471389-125471411 TGAGCTCTAACCCAGCAGTCTGG - Intergenic
997884735 5:137620063-137620085 TCAGCTTCCAACCCACAGCCAGG + Exonic
998141430 5:139701653-139701675 TCACCTCCTACCCACCAGCTTGG + Intergenic
1001640341 5:173239308-173239330 GCATCTCAAATCCAACAGCCTGG - Intergenic
1003116588 6:3287598-3287620 TCAACTCCACCCACACAGCCTGG + Intronic
1003164141 6:3661480-3661502 TCAACTCCTGCCCTACAGCCAGG + Intergenic
1005385069 6:25278329-25278351 TCATCTTCAGCCCCACAGCCAGG - Intergenic
1006749842 6:36370107-36370129 TCATTTCCAACCCAAAAGCCAGG + Intronic
1007952198 6:45882357-45882379 CCAGCTGAAACCCAACAGGCAGG - Intergenic
1009529231 6:64788624-64788646 TCAGCTCCATCCACACAACCTGG + Intronic
1013495090 6:110690042-110690064 GCAGCTCTACCCCAACAGTCAGG + Intronic
1016629985 6:146217626-146217648 TCAGCTCCTACCCCAGTGCCTGG - Intronic
1017916060 6:158832377-158832399 TCAGCTCCAGCGGAGCAGCCTGG - Intergenic
1018432275 6:163731489-163731511 TCAGCTGCCATCCACCAGCCAGG + Intergenic
1019614797 7:1954353-1954375 TCAGCTTGGACCCCACAGCCTGG - Intronic
1023514483 7:40987290-40987312 TCTCCTCCACCCCACCAGCCTGG - Intergenic
1029478202 7:100797625-100797647 TGAGAACCAACCCCACAGCCCGG + Intronic
1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG + Intergenic
1030107228 7:105997345-105997367 TCTGCTCCAGCCCTGCAGCCTGG + Intronic
1030385336 7:108861352-108861374 TCAGCTCCAACTAAAAAGCAAGG - Intergenic
1030808532 7:113946188-113946210 GCAGCTCTACCCCAACAGTCAGG + Intronic
1032152242 7:129439086-129439108 TCAGCACCACCCCCACATCCAGG - Intronic
1033209828 7:139452630-139452652 TCAGCACCAAGCCAACACGCAGG + Intergenic
1034179436 7:149126261-149126283 TCCGCCCCAACCCAACTCCCAGG + Exonic
1036011114 8:4725795-4725817 TCAGTTCCAACCGAGCAGCTAGG - Intronic
1037135225 8:15452042-15452064 TCAGCACCATCCCCACTGCCTGG + Intronic
1040882523 8:52222383-52222405 ACAGCTTCCACTCAACAGCCCGG + Intronic
1042872365 8:73410540-73410562 TCAGCTCCAAACTCACCGCCGGG - Intergenic
1044831903 8:96258890-96258912 TCAGTTACAAACCAACAGACAGG + Intronic
1044939047 8:97321893-97321915 TCAGCTCCACCTCAATAGGCAGG - Intergenic
1045476431 8:102556702-102556724 TCAGTATCAACCCAAAAGCCTGG + Intronic
1047830683 8:128626572-128626594 TCTGCTCCAACTTCACAGCCAGG - Intergenic
1048440946 8:134458549-134458571 TCATCCACAACCCAGCAGCCAGG - Intergenic
1049252399 8:141596317-141596339 TCAGCTCCACCCAAGCAGCTGGG - Intergenic
1049377625 8:142296563-142296585 TCAGCCCCATCCCCAGAGCCTGG - Intronic
1049389619 8:142361028-142361050 ACAGCTCCAGCCCCTCAGCCTGG + Intronic
1049778491 8:144416995-144417017 GCAGATCCTCCCCAACAGCCTGG + Intergenic
1053106817 9:35416535-35416557 GCAGCTCTACTCCAACAGCCGGG + Intergenic
1053141961 9:35688174-35688196 TCAGCTCCCTCCCAAGTGCCAGG + Intronic
1053311835 9:37025408-37025430 TCCCCCCCATCCCAACAGCCTGG - Intronic
1055797620 9:79992376-79992398 TCTGCTCCAACACCAAAGCCTGG + Intergenic
1056544968 9:87605935-87605957 TCGCCTCCATCCCAAAAGCCCGG - Intronic
1057904920 9:98975859-98975881 TCAGCTGCACCCCAACACACGGG - Intronic
1061101366 9:128494961-128494983 TCAGCTCCACACCCACAGCTGGG + Intronic
1062066038 9:134526862-134526884 ACAGCTCCACCCCACCAGCTGGG - Intergenic
1062398067 9:136360525-136360547 GCAGCCCCAATCCCACAGCCAGG - Intronic
1186915490 X:14215061-14215083 GCAGCTTCTTCCCAACAGCCGGG - Intergenic
1187429538 X:19209616-19209638 TGAACTCCCAGCCAACAGCCAGG - Intergenic
1193006687 X:76626687-76626709 GCACCTCTACCCCAACAGCCAGG + Intergenic
1193154570 X:78158747-78158769 CCAGCTCCAACCCAACCGAAGGG - Intergenic
1194049803 X:89054509-89054531 TCAGCACCAACCTGCCAGCCAGG - Intergenic
1194102506 X:89723561-89723583 TCAGGTCCACCCCATCAGGCTGG - Intergenic
1194241690 X:91457237-91457259 GCAGGTCTAACCCAACAGTCAGG + Intergenic
1194268220 X:91780104-91780126 TCAGCTCCAATCTCTCAGCCGGG - Intronic
1197819580 X:130530543-130530565 GCAGCACCACCCCCACAGCCTGG + Intergenic
1200455093 Y:3380838-3380860 TCAGGTCCACCCCATCAGGCTGG - Intergenic
1200585422 Y:5001025-5001047 TCAGCTCCAATCTCTCAGCCGGG - Intronic