ID: 1152395723

View in Genome Browser
Species Human (GRCh38)
Location 17:80031633-80031655
Sequence AAGGGTGCACAAATGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152395723_1152395729 21 Left 1152395723 17:80031633-80031655 CCATCTGCCATTTGTGCACCCTT 0: 1
1: 0
2: 1
3: 17
4: 245
Right 1152395729 17:80031677-80031699 ATTTCCCCCGCAAAGAGCCAAGG 0: 1
1: 0
2: 0
3: 4
4: 99
1152395723_1152395730 24 Left 1152395723 17:80031633-80031655 CCATCTGCCATTTGTGCACCCTT 0: 1
1: 0
2: 1
3: 17
4: 245
Right 1152395730 17:80031680-80031702 TCCCCCGCAAAGAGCCAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 92
1152395723_1152395735 29 Left 1152395723 17:80031633-80031655 CCATCTGCCATTTGTGCACCCTT 0: 1
1: 0
2: 1
3: 17
4: 245
Right 1152395735 17:80031685-80031707 CGCAAAGAGCCAAGGAGGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152395723 Original CRISPR AAGGGTGCACAAATGGCAGA TGG (reversed) Intronic
901001297 1:6150140-6150162 ATGGGTGGACAAATGGATGATGG + Intronic
901439400 1:9268461-9268483 AGGGGCCCATAAATGGCAGAAGG + Exonic
902679142 1:18030831-18030853 ACAGGTGCGCAAATGGCAGTTGG + Intergenic
903004471 1:20289621-20289643 AAGGGAGCACAGATGTCAGGTGG - Intergenic
903216420 1:21846029-21846051 CAGGGGGCAGAACTGGCAGAAGG - Intronic
903457478 1:23497710-23497732 AAGGCTGCACAGCAGGCAGAAGG - Intergenic
903685883 1:25131678-25131700 CAGGTGGCACATATGGCAGATGG - Intergenic
903862663 1:26374287-26374309 GAGGGAGCACAGCTGGCAGATGG - Intronic
904449604 1:30602337-30602359 GAGGGTTCATAAATGGCAGAAGG - Intergenic
905366109 1:37452484-37452506 AAGGGTCCACAGATGGCTGGGGG + Intergenic
907576044 1:55526573-55526595 GAGGCTGCACAATGGGCAGAAGG + Intergenic
908039725 1:60097579-60097601 AATGGAGCACAAAAGGCACAAGG + Intergenic
908341733 1:63187703-63187725 AAGGGAGTACAAGTGTCAGACGG + Intergenic
912418612 1:109528782-109528804 AGAGGTGTACAAAGGGCAGAAGG - Intergenic
913077054 1:115349196-115349218 AAAGCTGCAGAAATGGAAGAAGG + Intergenic
913494720 1:119417834-119417856 CAGGGTACAAAAATGGCAGGTGG + Intronic
914327602 1:146635534-146635556 AAGGAGGCCCAAATGGAAGATGG - Intergenic
915779655 1:158532662-158532684 AAGGGTGCAGAAGGGGAAGAGGG - Intergenic
916324262 1:163539598-163539620 AAAGGTTCACAAACGGGAGATGG + Intergenic
916488411 1:165279655-165279677 AGGACTGCACAAATGGCATAGGG + Intronic
916928742 1:169551542-169551564 AAGGGATCAGAAATGGAAGAAGG + Intronic
919523527 1:198619319-198619341 TGGAGTTCACAAATGGCAGAAGG - Intergenic
921038710 1:211408167-211408189 AAGGGGGGACAAATGGCACCTGG - Intergenic
1062840224 10:664222-664244 GAGTTTGCACAAAAGGCAGATGG - Intronic
1062893202 10:1081516-1081538 AAGTGAGGACAAACGGCAGAAGG - Intronic
1066625171 10:37398624-37398646 GAGTATGCACAAATGGCAGGTGG + Intergenic
1067692761 10:48512709-48512731 AAGGCTGCACAAACAGTAGATGG + Intronic
1068077245 10:52271550-52271572 CAGTGAGCACAAGTGGCAGAGGG - Intronic
1070347341 10:75557731-75557753 AAGGGTGGACAAATCGCAGCTGG - Intronic
1070563197 10:77583327-77583349 ACGGGGGCACAAATGGCTGCTGG + Intronic
1071581489 10:86775436-86775458 AAGGGTGGACACAAGGCTGATGG + Intronic
1071700549 10:87928599-87928621 AAAGATACACAAATGGCAAATGG - Intronic
1074846127 10:117399630-117399652 AAGGGTGCACAGAAGAAAGATGG - Intergenic
1075472039 10:122698325-122698347 AGGGGTACACAAATAGCACAAGG + Exonic
1076444974 10:130508048-130508070 AAGGGTGCAGAAAAGACAGATGG - Intergenic
1076468513 10:130702513-130702535 ATGTGTGCACAGCTGGCAGAGGG + Intergenic
1076629040 10:131841783-131841805 ACCGGTGCACACATGGCTGAGGG - Intergenic
1077280561 11:1743180-1743202 AAGAATGGACAAATGGAAGATGG + Intronic
1077280566 11:1743218-1743240 AAGAATGGACAAATGGAAGATGG + Intronic
1077417926 11:2433497-2433519 ACAGGTGCACATATGCCAGATGG - Intergenic
1078416709 11:11172080-11172102 AAGGGTGTGAAAATGACAGAAGG + Intergenic
1079423512 11:20317555-20317577 GAGGTTGAAAAAATGGCAGATGG - Intergenic
1080855599 11:36109058-36109080 AAGGGTGAGCATGTGGCAGATGG + Intronic
1081453329 11:43194673-43194695 AAGGGTACAAAAATGGGAAATGG + Intergenic
1083083891 11:60122721-60122743 AAGGGGGAAAGAATGGCAGAGGG + Intergenic
1083446374 11:62710298-62710320 AAGGGTGCACAGAGGCGAGATGG + Intronic
1084093429 11:66894349-66894371 AAGGGTGTTCTAATGGTAGAGGG - Intronic
1085016194 11:73175608-73175630 AAGGCCGCACAGATGGTAGATGG + Intergenic
1085140474 11:74136233-74136255 ACTTGTGCACAAATGGGAGAGGG - Intronic
1085148900 11:74231758-74231780 AATGGTGGAGAAATGGAAGATGG + Intronic
1086301638 11:85432297-85432319 AAGGGTGCAGAACTGGACGAAGG + Intronic
1087566377 11:99864432-99864454 AAGGGTGCACAAATAAGATATGG - Intronic
1089117721 11:116109576-116109598 GGGTGTGCACAAATGGCAGAAGG + Intergenic
1089125556 11:116174199-116174221 AAGGAAACACAAATGGCAGAGGG - Intergenic
1091236725 11:134027045-134027067 AAAGGAGCACAAAGGGCAAAAGG + Intergenic
1093071725 12:14712740-14712762 AAGGATGAACAAATGTCTGATGG + Intergenic
1094384145 12:29875594-29875616 AAGAGTCCACAAATGTAAGATGG + Intergenic
1094387398 12:29910145-29910167 AAGGGGGGACAAATGGCACCTGG + Intergenic
1095870267 12:47018825-47018847 GAGGGGGCAGAAATGGGAGACGG + Intergenic
1097205697 12:57318886-57318908 AAGGGCACACAACTGGCATATGG + Intronic
1099617479 12:84955880-84955902 AAGGGTACACAAGTGGCATCAGG - Intergenic
1101636069 12:106542470-106542492 AAGCTTGCAAACATGGCAGAAGG + Intronic
1102868135 12:116390609-116390631 AACAGTGCACAAGTGGCAGAGGG + Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1106297215 13:28426380-28426402 AATGCTGCACAATTAGCAGAGGG + Intronic
1110069778 13:71159859-71159881 AAGGGTGCAGAAACAGCACAAGG - Intergenic
1111600946 13:90473223-90473245 AAGAGTTCACAAAGGGCAGTTGG - Intergenic
1113881191 13:113627592-113627614 AAGTGTGCACTTAGGGCAGAAGG + Intronic
1115006752 14:28494864-28494886 AATAGTGCAATAATGGCAGAGGG + Intergenic
1115736410 14:36335206-36335228 AGGGGAGAACAATTGGCAGAAGG - Intergenic
1115928703 14:38467012-38467034 AAGGGTGCAGAAATGGACAAAGG - Intergenic
1117797551 14:59409693-59409715 AAGGGGGGACAAATGGCAGCTGG + Intergenic
1117903503 14:60560396-60560418 AAGGGTGCAGAAAAGGAAGCTGG + Intergenic
1118430180 14:65710876-65710898 AAGCTTGCACTCATGGCAGATGG + Intronic
1118661216 14:68015036-68015058 AAGATTGCACAGATGGCAGGAGG - Intronic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1119552503 14:75525234-75525256 AAGGGTTCCCAGATGGCGGAGGG - Intronic
1119894714 14:78210259-78210281 ATGTGTGCTCACATGGCAGAAGG + Intergenic
1120506816 14:85362983-85363005 AAGGGAGCACAAAGGAAAGAGGG + Intergenic
1122179952 14:99947550-99947572 ACTGGTCCACAAATCGCAGATGG + Intergenic
1122704456 14:103611419-103611441 AAGGGGGTAAAAATGGAAGATGG + Intronic
1128559980 15:68658372-68658394 AAGGAGGCACAGATGGCAGGCGG - Intronic
1129181802 15:73882413-73882435 AAGGGTGAACCAAGGACAGAGGG - Intronic
1130154325 15:81336608-81336630 AAGGTTGCCCAGATGGTAGAAGG - Exonic
1130560731 15:84956233-84956255 AAGGGAGGACAAATGGAATATGG - Intergenic
1132151502 15:99464883-99464905 AAGGCTGCAGTACTGGCAGAGGG + Intergenic
1133449465 16:5891570-5891592 GAGGTGGCAAAAATGGCAGAGGG + Intergenic
1136474612 16:30505053-30505075 AAGACTGCACAAATGGCAGTAGG + Intronic
1137831952 16:51552520-51552542 GAGGGTAGACAAATGTCAGAGGG - Intergenic
1140005957 16:71075406-71075428 AAGGAGGCCCAAATGGAAGATGG + Intronic
1140032303 16:71348492-71348514 AATGGTGCACGATTGTCAGAGGG + Intergenic
1141227669 16:82134205-82134227 TAAGGTGCACCAATGCCAGAGGG + Intergenic
1142128657 16:88422405-88422427 ATGGGTGGACAAATGGTAAAAGG + Intergenic
1142506122 17:364380-364402 AATGGAGCACAAATGCTAGAGGG - Intronic
1142690309 17:1602123-1602145 AAGGGTGCACAAGCGGCAGGGGG + Intronic
1143099309 17:4496761-4496783 AAGGGGCCACCAAGGGCAGAGGG - Intergenic
1143301314 17:5912585-5912607 AAGGGTGCACAAGGCACAGAAGG + Intronic
1143326051 17:6099087-6099109 CAGGGGGTACAAATTGCAGAGGG + Intronic
1143413384 17:6726490-6726512 AAAGGTGCGCCAATGGAAGAAGG + Intergenic
1145212381 17:21023773-21023795 AAAGGTGCACAGCTGGCAGGTGG - Intronic
1146554862 17:33814593-33814615 TTGGGTGTACAAGTGGCAGAGGG + Intronic
1148015280 17:44517451-44517473 AAGGGTGCAAGAATGGAAGTGGG + Intergenic
1149128275 17:53262367-53262389 ACAGGTGCAAAAATGGCAAAGGG + Intergenic
1150865908 17:68849758-68849780 AGGGGTCTACACATGGCAGAGGG + Intergenic
1152395723 17:80031633-80031655 AAGGGTGCACAAATGGCAGATGG - Intronic
1153992243 18:10410864-10410886 AAGTGTGAACAAGTGGGAGAAGG - Intergenic
1154316099 18:13304381-13304403 AAGAGTGCAGAGATGGGAGATGG + Intronic
1154344542 18:13531155-13531177 AAGGGTCCACAAAGGTCACATGG + Intronic
1155705990 18:28813440-28813462 GAGGGTGATCCAATGGCAGAAGG + Intergenic
1156828736 18:41465437-41465459 AAGGCTGCATAAATTTCAGAAGG - Intergenic
1157161225 18:45316086-45316108 AGGGAGGCACAAATGGCATAGGG - Intronic
1158348850 18:56543721-56543743 AAAGGTGCACAAATTGCTGGGGG + Intergenic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1160393791 18:78557643-78557665 TGGGGTCCACAAATAGCAGAGGG - Intergenic
1163116230 19:15190379-15190401 AAGAGGGCATACATGGCAGAGGG - Intronic
1163383591 19:16985475-16985497 AAGGGTGGATGAAGGGCAGACGG + Intronic
1165121912 19:33565352-33565374 AAGGGGGCCCCAAGGGCAGATGG - Intergenic
1166790292 19:45395378-45395400 AAGGGAGGACAAATGGCAGGGGG - Intronic
1167146648 19:47684723-47684745 AAGGTTGCACAGCTGGCAAATGG + Intronic
925358539 2:3261180-3261202 AAGGAAGCTCAACTGGCAGAGGG + Intronic
927653740 2:24928445-24928467 AAGGTTCCACAACTGGCAAAGGG + Intergenic
929983556 2:46702926-46702948 AAAGGACCACAAATGGAAGAAGG - Intronic
930278425 2:49340830-49340852 AGGGGTGCACAAATGGCAAAGGG - Intergenic
933857228 2:86427702-86427724 ATGTGTGCACAAATGTCAGCAGG - Intergenic
935139407 2:100339472-100339494 AAGCCTGCACACGTGGCAGATGG - Intergenic
935483574 2:103623951-103623973 ACAGGTTCAGAAATGGCAGAGGG - Intergenic
936543126 2:113368274-113368296 CAGGGTCCTCACATGGCAGAAGG + Intergenic
937318539 2:120947268-120947290 AAGGGTGCCCAGATAGCAGGTGG - Intronic
938862181 2:135381108-135381130 AAGGGGGTACAAATGGCACCTGG + Intronic
939655166 2:144815760-144815782 AAAGGTGGACAAATGTGAGAAGG + Intergenic
939956536 2:148532051-148532073 AGGGGTGCACAAACGCCTGAGGG + Intergenic
940438359 2:153682486-153682508 AAGTGTGCACAGTTTGCAGAGGG - Intergenic
942189233 2:173454648-173454670 AGGGGTGTAGAAATGGCGGAGGG - Intergenic
942647878 2:178134216-178134238 AATGCTGCAGAAGTGGCAGAAGG + Intronic
944122980 2:196261124-196261146 AAGTGTGCGTAAGTGGCAGATGG - Intronic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
944595387 2:201256514-201256536 ACTGGTGCATAAAGGGCAGAAGG - Intronic
944692447 2:202170151-202170173 CAGGGCTCACAAATGGCACAGGG - Intronic
946312344 2:218889747-218889769 AAGGGCGTACAAAAAGCAGAGGG + Intronic
946588636 2:221218879-221218901 AAGTGGGCACATATGGCAGTGGG - Intergenic
1169062730 20:2673331-2673353 ATGGGTGCAGAGATGGCTGAAGG + Intergenic
1170139102 20:13107405-13107427 AATGGTGTCCAGATGGCAGAGGG + Intronic
1170523185 20:17209797-17209819 AAGGGTCCAAAAATGGGAGTTGG + Intergenic
1171187344 20:23132319-23132341 CAGGGAGCTCATATGGCAGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175894024 20:62328135-62328157 CAGGGAGCACAAATGGGAGCAGG + Intronic
1177321690 21:19530027-19530049 AATGATGCTCACATGGCAGACGG + Intergenic
1178272701 21:31207294-31207316 ACTGGTGCTCAGATGGCAGATGG + Intronic
1178903537 21:36616778-36616800 AAGGGGGAACAAATGGCACCTGG + Intergenic
1179139713 21:38714010-38714032 AGGGGAGCACAATTGGCAAAGGG - Intergenic
1180103352 21:45600403-45600425 AAGTGTCCACTCATGGCAGAAGG - Intergenic
1182271703 22:29157883-29157905 AGGGGAGCAAACATGGCAGAGGG + Intronic
1182432349 22:30307227-30307249 AAGGGACCACAAATGGCCCATGG + Intronic
1182541420 22:31044744-31044766 AAGTGTGTGAAAATGGCAGATGG + Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
949699777 3:6743172-6743194 AAGGATGCAAAAAGGGGAGAAGG - Intergenic
950565386 3:13766900-13766922 AAGGAAGCACAAATGAGAGATGG - Intergenic
954422849 3:50427666-50427688 AAAGGTGCAGTAATGGTAGATGG - Intronic
955123750 3:56088465-56088487 AAGGGGGAAAAAATGACAGAGGG + Intronic
955173677 3:56590323-56590345 AATGCTGTACAAATGGCAGCTGG - Intronic
956013100 3:64852566-64852588 CCGGGTGCAGAAATGGGAGATGG + Intergenic
956235695 3:67068747-67068769 AAGCTTTCAAAAATGGCAGAAGG + Intergenic
957382889 3:79456910-79456932 AAAGATGCACAAATAGCAAAAGG - Intronic
959366843 3:105471397-105471419 AAAAGTGCACAAATGGAAAATGG + Intronic
960100134 3:113733394-113733416 AAAGGTTCACAAATTGCAGTTGG - Intronic
960336996 3:116429711-116429733 GAGGGAGCAAAAATTGCAGAGGG + Intronic
960808174 3:121604078-121604100 AAGGGTCCACTCATGACAGAAGG - Intronic
960998385 3:123354303-123354325 AAGAGTGCAGGAATGGGAGACGG + Intronic
961144121 3:124580019-124580041 AAGAGGGCACAAATGCCAAATGG + Intronic
961882036 3:130068521-130068543 AAGGGTGCTTAAAAGGAAGAAGG + Intergenic
962332845 3:134494919-134494941 ATGGGTTCACACATGTCAGAGGG - Intronic
962407672 3:135113831-135113853 GAGCCTGGACAAATGGCAGAGGG - Intronic
962846933 3:139281408-139281430 AAGTCTGCACCAAAGGCAGAGGG - Intronic
963156919 3:142109121-142109143 AAGGGTGAACAAAATGCACAGGG - Intronic
963226862 3:142871305-142871327 TAGGGTGCAAGAATGGAAGAAGG - Intronic
965083299 3:164063778-164063800 AAGGTTACACTCATGGCAGAAGG - Intergenic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
971324569 4:25633556-25633578 AAGGGGGCACACAAGGCTGAAGG + Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
976119421 4:81763113-81763135 AAGGGTGGACAGATGGCTTATGG + Intronic
978546263 4:109875428-109875450 AAGAGTGGACAAGTGGCTGAAGG - Intergenic
979562766 4:122119082-122119104 AAGACTGCAGAAATGGCAAATGG - Intergenic
979599804 4:122575064-122575086 AAGGGGGGACAAATGGCACCTGG - Intergenic
981212333 4:142122512-142122534 AAAGGTGCACAAATCACAAAGGG - Intronic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
984058769 4:174965208-174965230 AAGGGTGCAAAAAGATCAGAGGG + Intronic
984573247 4:181418659-181418681 GAGGGTGAAAAAATAGCAGAGGG - Intergenic
985028822 4:185767970-185767992 GAGGGTATTCAAATGGCAGAAGG - Intronic
985966017 5:3339217-3339239 CACGGTGCACAAAGAGCAGAGGG + Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987340798 5:16936924-16936946 AAGGAAGCAGAGATGGCAGATGG + Intergenic
988143877 5:27278530-27278552 AATGGTGCACATATGGCATTAGG + Intergenic
988707407 5:33739809-33739831 AAGGGTGTAAAGAAGGCAGAAGG + Intronic
990886486 5:60600238-60600260 AAAGGTGCAGACATTGCAGAAGG + Intronic
995467574 5:112466617-112466639 AAGGGGGGACAAATGGCACCTGG - Intergenic
995976036 5:118035532-118035554 AACAATGCACAAATGACAGAAGG - Intergenic
997538847 5:134644409-134644431 AAGGTTGTATATATGGCAGAAGG + Intronic
998854168 5:146378591-146378613 AAGAGCACACAAATGACAGAGGG - Intergenic
999383040 5:151135063-151135085 GAGGATGCACAAAGGGAAGAGGG + Intronic
999500153 5:152138881-152138903 AAGGCTGCACGAAGGGGAGATGG + Intergenic
1000023292 5:157337526-157337548 AAGTGTGCAGAAATGGTTGAAGG - Intronic
1001355773 5:171021789-171021811 AAGGGTGCAGAACTGGATGAAGG - Intronic
1002971442 6:2026132-2026154 AACGGTGCTCAAAAGGCAAAGGG + Intronic
1004873706 6:19934329-19934351 CAGGTTTCACAAATGGCATAAGG - Intergenic
1005992195 6:30910264-30910286 AAGGGTGGAAAGATGGCAGAGGG + Intronic
1006385536 6:33728765-33728787 AAGGGTGCTCAGGAGGCAGAGGG - Intronic
1007702810 6:43774347-43774369 CAGGCTGCACCCATGGCAGAAGG + Exonic
1009925002 6:70109951-70109973 AAGGGGGCACAAGTGCCGGAAGG - Intronic
1010892723 6:81334239-81334261 AAGGGAGCACATATGGAAGGAGG + Intergenic
1011231787 6:85169983-85170005 AAGGGTGCACAAAAGGTGGTAGG + Intergenic
1011674345 6:89717073-89717095 ACGGTTTCTCAAATGGCAGAAGG + Intronic
1013978794 6:116105526-116105548 AAAAGTGCACAAAAGGTAGATGG - Intronic
1014358436 6:120442878-120442900 AAGGCTGTGTAAATGGCAGAGGG + Intergenic
1016862601 6:148735902-148735924 AAGGGAGTCCAAATGGCAGTAGG + Intergenic
1017126022 6:151065529-151065551 AACGGAGCACAAATGCCAGAAGG - Intronic
1017273119 6:152532670-152532692 AAGGGTGCACAGAATGCACATGG - Intronic
1018341852 6:162859180-162859202 AAAGGTACAAAAATGGCAAACGG - Intronic
1018512277 6:164537917-164537939 AAGGAAGGTCAAATGGCAGATGG - Intergenic
1020736589 7:11957167-11957189 AAGCTTCCAAAAATGGCAGAAGG + Intergenic
1022212352 7:28224102-28224124 AAGGGTGCAGGAAAGGTAGAAGG - Intergenic
1026399733 7:69997596-69997618 AAGTGTTTACTAATGGCAGAAGG + Intronic
1028639893 7:93030062-93030084 AAGTGTGCACAGTTGCCAGAAGG + Intergenic
1031840148 7:126728157-126728179 AAGAGAGCACTAATGGCAGTGGG - Intronic
1033708861 7:143917255-143917277 AAGGGTCCACAAATTTCATAAGG - Intergenic
1035344084 7:158186716-158186738 AAAGGTGCACTCATGCCAGAGGG - Intronic
1036053734 8:5227929-5227951 AAAGGTGCACAACTGTCAAATGG - Intergenic
1039376360 8:37038260-37038282 AAGAGTCCCCAGATGGCAGATGG + Intergenic
1041381097 8:57255022-57255044 AAGGGTGCAGCAATGGAAGCAGG - Intergenic
1041386266 8:57307320-57307342 AAGATTGCACATTTGGCAGAGGG + Intergenic
1041508835 8:58632267-58632289 AAGGGAACAGAAATGGCAAAAGG - Intronic
1042859921 8:73302082-73302104 AAGGGTACAGAAATGGTACATGG - Intronic
1043408292 8:79962728-79962750 TAGGGTGCTCAAATGGTAAAGGG + Intronic
1045536737 8:103036202-103036224 AAGGCTGCACGACTGGCAGATGG - Intronic
1046798878 8:118402696-118402718 AAGGGAGGAGATATGGCAGAAGG + Intronic
1050947337 9:11542424-11542446 AAGTGTCCTCACATGGCAGAAGG - Intergenic
1051987216 9:23105342-23105364 AAGGGGGGACAGATGGCACATGG + Intergenic
1053046060 9:34918198-34918220 AAGGGGTCACAGTTGGCAGAGGG - Intergenic
1053534682 9:38913783-38913805 AGGTGTCCACACATGGCAGAAGG - Intergenic
1054206901 9:62138203-62138225 AGGTGTCCACACATGGCAGAAGG - Intergenic
1054631449 9:67450144-67450166 AGGTGTCCACACATGGCAGAAGG + Intergenic
1055286563 9:74734880-74734902 TGGGGCACACAAATGGCAGAAGG + Intronic
1057572580 9:96215879-96215901 AGAGGTGCAGAAATGGCCGAGGG - Intergenic
1058496404 9:105563409-105563431 AAGGGGGGACAAATGGCACCTGG + Intronic
1058910412 9:109515673-109515695 AAGGCTTCACTTATGGCAGAAGG + Intergenic
1059091146 9:111359757-111359779 GCTGGTGAACAAATGGCAGAAGG - Intergenic
1060485990 9:124046286-124046308 AAGCGTGCAAAAGTGTCAGAAGG - Intergenic
1061642627 9:131971262-131971284 AAGAGAGCACAGCTGGCAGAAGG + Intronic
1185913981 X:4014380-4014402 AAGTGTCCACACATGGCAGAAGG - Intergenic
1187448968 X:19380474-19380496 ATGGCTTCACAAATGGCAGATGG + Intronic
1189216819 X:39332390-39332412 AAGCTTCCACTAATGGCAGAAGG + Intergenic
1190801616 X:53794658-53794680 TAGGCTGCACATAAGGCAGAGGG + Intergenic
1193750461 X:85336585-85336607 GAAGGTGTACAAATGGCAAACGG - Intronic
1194195225 X:90883715-90883737 AAGGCAGCAAAAATGGCAGCTGG + Intergenic
1195218165 X:102721116-102721138 AAGGGTGTTCAAAAGGCAGGAGG - Intronic
1195534049 X:105990629-105990651 AAGGGTGGATAAATGGAAGTGGG - Intergenic
1198046349 X:132907047-132907069 AAGCTTCCACTAATGGCAGAAGG - Intronic
1199017909 X:142840836-142840858 AAGGACGTACAAATGGCAAACGG - Intergenic
1199429404 X:147741944-147741966 ATGGTTGCACAACTGACAGATGG + Intergenic
1199490861 X:148399070-148399092 AAGGGTTCTCAAGTGGAAGAAGG - Intergenic
1199952643 X:152717618-152717640 AAGGATGTACAAGTGGCTGATGG - Exonic
1199957040 X:152750830-152750852 AAGGATGTACAAGTGGCTGATGG + Intronic