ID: 1152397101

View in Genome Browser
Species Human (GRCh38)
Location 17:80040158-80040180
Sequence GTCCACCAGAATCCAGAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152397096_1152397101 3 Left 1152397096 17:80040132-80040154 CCAAGGCTTCCAGCAAGAGGCCA 0: 1
1: 0
2: 2
3: 25
4: 231
Right 1152397101 17:80040158-80040180 GTCCACCAGAATCCAGAGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 353
1152397098_1152397101 -6 Left 1152397098 17:80040141-80040163 CCAGCAAGAGGCCACCGGTCCAC 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1152397101 17:80040158-80040180 GTCCACCAGAATCCAGAGAAAGG 0: 1
1: 0
2: 0
3: 25
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152397101 Original CRISPR GTCCACCAGAATCCAGAGAA AGG Exonic
900548645 1:3242472-3242494 GTCCTCCAGCATCCAGAGTGAGG + Intronic
901179350 1:7330463-7330485 GTCCAGAAGAATCCTCAGAAGGG - Intronic
902837174 1:19054616-19054638 GCCCCCCAGATTCCACAGAAGGG + Intergenic
903891911 1:26575407-26575429 GTTCACCAGCATCCAGAACAGGG - Intergenic
906507327 1:46389861-46389883 GTCCACTATAATACAGGGAAAGG - Intergenic
906766708 1:48440639-48440661 GTCCACCATAACTCAGGGAAAGG + Intronic
906933163 1:50189185-50189207 GTCCTCCATAATACAGAAAAGGG - Intronic
907842372 1:58170289-58170311 GTCCACCATAACTCAGGGAAAGG + Intronic
908034644 1:60038843-60038865 GTCCACCAGAGTCCCTAGGATGG - Intronic
908300440 1:62756913-62756935 GTCCACCATAACTCAGGGAAAGG + Intergenic
909359392 1:74743557-74743579 GTCCACCATAACTCAGGGAAAGG - Intronic
909481710 1:76133548-76133570 GTCCACCTATATCCAGAGAGTGG + Intronic
911026430 1:93440343-93440365 GGCCACCAGATTACACAGAAGGG - Intergenic
911129745 1:94376168-94376190 GTCCACCATAACCCAGGGAAAGG - Intergenic
911298993 1:96150561-96150583 GTCCACCATAACTCAGGGAAAGG + Intergenic
911751439 1:101501520-101501542 GTCCACCATAACTCAGGGAAAGG + Intergenic
911845593 1:102747451-102747473 GTCCACCATAACCCAGGGAAAGG - Intergenic
915401557 1:155625665-155625687 GTCCACCATAACACAGGGAAAGG - Intergenic
915912025 1:159921440-159921462 GGCCTCCAGAAGCCAGAAAAGGG + Intronic
916104481 1:161421070-161421092 GTACATCAGTATCCAGGGAATGG + Intergenic
916114460 1:161475217-161475239 GTCCACCATAACTCAGGGAAAGG + Intergenic
917086156 1:171307502-171307524 GTCCACCATAACTCAGGGAAAGG + Intergenic
917281189 1:173379413-173379435 GTCCACCATAACTCAGGGAAAGG + Intergenic
917445768 1:175104865-175104887 ATCCACCATAACCCAGGGAAAGG - Intronic
917676304 1:177322263-177322285 GTCCACCAAAACTCAGGGAAAGG + Intergenic
918250377 1:182698149-182698171 GGCCACTAGAATGGAGAGAAAGG + Intergenic
919256941 1:195138360-195138382 GTCCACCATAACTCAGGGAAAGG + Intergenic
921154143 1:212425536-212425558 GTGCACCAAAATACAGAAAAAGG - Intergenic
921470545 1:215543167-215543189 TTCCCCCATAACCCAGAGAAAGG + Intergenic
922789917 1:228305862-228305884 GTCCCCCAGACTCCAGGGCAGGG - Intronic
923276749 1:232403307-232403329 GTCCTGAAGAATCCAGAGAAGGG - Intronic
1063414831 10:5864821-5864843 GTCCACCATAACTCAGGGAAAGG + Intronic
1063859055 10:10289040-10289062 TTCCACCATAACTCAGAGAAAGG - Intergenic
1063859058 10:10289076-10289098 TTCCACCATAACTCAGAGAAAGG - Intergenic
1064242957 10:13647210-13647232 GGCCCCCAGAATCCACACAAAGG + Intronic
1064603537 10:17016194-17016216 GTCCACCATAACTCAGGGAAAGG - Intronic
1064976631 10:21123689-21123711 GATCATCAGAATTCAGAGAAGGG - Intronic
1065174671 10:23064857-23064879 TTCCACCCAATTCCAGAGAATGG - Intergenic
1066463440 10:35632898-35632920 GTCAGCCAGTAGCCAGAGAAAGG - Intergenic
1066614545 10:37281980-37282002 GTCCACCATAACTCAGGGAAAGG - Intronic
1068934458 10:62622362-62622384 GGCTTCCAGAATCCAGAGAGCGG + Intronic
1071189447 10:83082536-83082558 GCCCACCAGAAACCAGGGAAAGG - Intergenic
1072371626 10:94770726-94770748 GTCCACCATAACTCAGGGAAAGG - Intronic
1073813276 10:107175290-107175312 CTCCCCCAGAATATAGAGAAAGG - Intergenic
1073970786 10:109043920-109043942 GTCCACCATAACTCAGGGAAAGG + Intergenic
1074207693 10:111298283-111298305 GTCCACCCAGATTCAGAGAAAGG - Intergenic
1075146358 10:119886128-119886150 GTCCACCATAACTCAGCGAAAGG + Intronic
1076736405 10:132461108-132461130 CTCCCCCAGACTCCAGAGGAAGG + Intergenic
1078077620 11:8175925-8175947 GTCCACAGGAATCTAGTGAAAGG - Intergenic
1078524970 11:12093491-12093513 GAACACCAAATTCCAGAGAAAGG + Intergenic
1079731183 11:23938939-23938961 GTCCACCATAACTCAGGGAAAGG - Intergenic
1079811624 11:25004663-25004685 GTCCACCATAATTCAGGGAAAGG - Intronic
1080251292 11:30236713-30236735 GTCCACCATAGTGCTGAGAAGGG - Intergenic
1081146035 11:39563319-39563341 GTCCACCATAACTCAGGGAAAGG + Intergenic
1081421461 11:42877613-42877635 GTCCACCATAACTCAGGGAAAGG + Intergenic
1081727141 11:45338310-45338332 GTCCACAGCCATCCAGAGAATGG + Intergenic
1081961338 11:47139834-47139856 GTCAGCCTGAATCCAGAGATGGG + Intronic
1082979887 11:59110166-59110188 GTCCATCAGACTGCAGAGACTGG + Intronic
1083097438 11:60266193-60266215 GTTCACCAGAGTGCAGAGAATGG - Intergenic
1083785846 11:64946418-64946440 GTGCATCAAAACCCAGAGAAAGG + Intronic
1083832515 11:65241835-65241857 GCCCAAGAGAATCCAGAGGAGGG + Intergenic
1084211046 11:67622672-67622694 GTCCACCATAACTCAGGGAAAGG + Intergenic
1084935655 11:72585265-72585287 GTCCCGCAGAAGGCAGAGAAAGG + Intronic
1086206921 11:84269476-84269498 TACCACAAGAATTCAGAGAAGGG - Intronic
1086317428 11:85609135-85609157 GTCCACCATAACTCAGGGAAAGG + Intronic
1087319304 11:96639038-96639060 GTCCACCATAACTCAGGGAAAGG + Intergenic
1091903538 12:4164776-4164798 GTCCCCCAGGCTCCAGGGAAGGG - Intergenic
1094111341 12:26866032-26866054 GGGCCCCAGATTCCAGAGAAGGG + Intergenic
1095801217 12:46271211-46271233 GTCAACTAAAATCCAGAGAAGGG - Intergenic
1096683239 12:53270727-53270749 GGCCTCCAGCATCCAGACAACGG - Exonic
1097428338 12:59473504-59473526 GTCCACCATAACTCAGGGAAAGG + Intergenic
1097586256 12:61519776-61519798 GGCCACCAGAAACCAGGGGAAGG + Intergenic
1099019179 12:77381881-77381903 GTCCAAGTGAATCCTGAGAATGG - Intergenic
1099520919 12:83661126-83661148 GTGCACCACAATCCTGATAATGG + Intergenic
1099939385 12:89167118-89167140 TTACACCAGAGTCCATAGAATGG + Intergenic
1100092187 12:90985248-90985270 GTCCACCATAACTCAGGGAAAGG + Intronic
1100361630 12:93884877-93884899 GTCCACCCGAATGCATAGAGTGG + Intronic
1100515522 12:95323646-95323668 GTCCTCCAAAAACCAGAAAAAGG - Intergenic
1100548395 12:95624363-95624385 GACCACTAGACTCCTGAGAATGG - Intergenic
1101779704 12:107824357-107824379 GTCCACCATAACTCAGGGAAAGG + Intergenic
1103049114 12:117763895-117763917 ACCCACCAGAACCCAGAGGAAGG + Intronic
1104306221 12:127612896-127612918 GTCTACCATAACTCAGAGAAAGG + Intergenic
1104466059 12:128991897-128991919 GTTTACAAGAATCCAGAGATCGG + Intergenic
1105762526 13:23527473-23527495 GTCCACCATAACTCAGGGAAAGG + Intergenic
1106162739 13:27215357-27215379 GTCCACCATAACTCAGGGAAAGG + Intergenic
1109221436 13:59644773-59644795 CCCAACAAGAATCCAGAGAACGG - Intergenic
1109501068 13:63236518-63236540 GTCCACCATAACTCAGGGAAAGG + Intergenic
1111372570 13:87336156-87336178 GTCCACCATAACTCAGGGAAAGG + Intergenic
1111964239 13:94845229-94845251 GGCCACCATATTCCACAGAAGGG + Intergenic
1112519163 13:100080915-100080937 GTCCACCATAACTCAGGGAAAGG + Intergenic
1113203885 13:107894675-107894697 GTCCACCATAACTCAGGGAAAGG - Intergenic
1113431476 13:110255275-110255297 TGCCACCAAAATCCAGCGAATGG - Intronic
1113965360 13:114150112-114150134 GTCCACCAGACTCGAGAGTGGGG - Intergenic
1114715342 14:24818415-24818437 CTGCCCCTGAATCCAGAGAAGGG - Intronic
1115285421 14:31709299-31709321 GTCCACCATAACTCAGGGAAAGG - Intronic
1115486632 14:33916800-33916822 GTCCACCCAAATGAAGAGAAAGG - Intergenic
1116059954 14:39910361-39910383 GTGCACCAGAGTTCAGAGAAGGG - Intergenic
1117194569 14:53326930-53326952 GTCCACCAGATTTGAGAGAGTGG - Intergenic
1117904076 14:60566266-60566288 GTCCATGAGAACCCAAAGAAGGG + Intergenic
1120198833 14:81515633-81515655 GTCCACCATAACTCAGGGAAAGG + Intronic
1120444686 14:84579369-84579391 GGGCACCAGCATCCAGACAAGGG - Intergenic
1121017387 14:90556895-90556917 CTCCCCCAGAAGCCAGGGAACGG + Intronic
1121092001 14:91189387-91189409 GTCCACCAGGCTCCAAAGCATGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122725093 14:103745320-103745342 ATCCACCACAATCCCGAAAAAGG + Intronic
1123138854 14:106055709-106055731 GTCCCCCAGGCTCCAGGGAAGGG - Intergenic
1123139610 14:106062314-106062336 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123141453 14:106083049-106083071 GTCAACAAGACTCCAGGGAAGGG - Intergenic
1123141923 14:106088287-106088309 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123148097 14:106153793-106153815 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123156846 14:106235227-106235249 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123159975 14:106268771-106268793 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123162189 14:106289191-106289213 GTCCGCCAGGCTCCAGGGAATGG - Intergenic
1123178352 14:106443294-106443316 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123187931 14:106537975-106537997 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123189688 14:106557107-106557129 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123193401 14:106592838-106592860 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123197604 14:106631362-106631384 GTCCACCAGGCTCCAGGAAAGGG - Intergenic
1123200390 14:106657888-106657910 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123202033 14:106675177-106675199 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123207618 14:106728325-106728347 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1123214122 14:106790863-106790885 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1202943432 14_KI270726v1_random:5126-5148 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1124013936 15:25861046-25861068 GTTCACCAGAAGCCTGAGCAGGG - Intronic
1125578625 15:40770853-40770875 CTCCACCAGCACTCAGAGAAGGG + Exonic
1126072037 15:44873779-44873801 GTCCACCATAACTCAGGGAAAGG - Intergenic
1126086210 15:45013210-45013232 GTCCACCATAACTCAGGGAAAGG + Intergenic
1126333546 15:47560875-47560897 GTCTAACAGAAGCCAGGGAAGGG + Intronic
1127623999 15:60762464-60762486 GGTCACCAGAATTCAGAGAAAGG + Intronic
1130936906 15:88478505-88478527 ATCCATCAGAATCCAGAGGTAGG - Exonic
1131411246 15:92209936-92209958 GTCCACCATAACTCAGGGAAAGG + Intergenic
1133840341 16:9402371-9402393 GTCCTCCACCACCCAGAGAAGGG - Intergenic
1135231239 16:20710199-20710221 GACCACTAGAATCCATAGAGTGG + Intronic
1136404776 16:30038152-30038174 GCCCACCATCATTCAGAGAAAGG - Intronic
1136682105 16:31973842-31973864 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136694560 16:32066173-32066195 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136782417 16:32915343-32915365 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136795061 16:33009437-33009459 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1136870483 16:33803030-33803052 ATCCACCAGGCTCCAGGGAAGGG + Intergenic
1136874852 16:33844945-33844967 GTCCGCCAGGCTCCAGGGAAGGG - Exonic
1136887376 16:33938508-33938530 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
1137582030 16:49639403-49639425 GTCCACCCATACCCAGAGAATGG - Intronic
1138240012 16:55419789-55419811 GTCGATCAGACGCCAGAGAAAGG - Intronic
1139163943 16:64543861-64543883 GTCCATCAGAATCCCTAGAAGGG - Intergenic
1140722003 16:77780502-77780524 GTCCAACAGAAACCAGAAAGGGG - Intergenic
1142182703 16:88678959-88678981 CTCCAGCAGAATCCAGGGCAGGG + Intronic
1203085077 16_KI270728v1_random:1179330-1179352 GTCCGCCAGGCTCCAGGGAAGGG + Intergenic
1203101689 16_KI270728v1_random:1313020-1313042 ATCCACCAGGCTCCAGGGAAGGG - Intergenic
1142522986 17:518195-518217 GTCATCCTGCATCCAGAGAATGG - Exonic
1144082693 17:11779053-11779075 GTGCAATAGTATCCAGAGAATGG + Intronic
1144340154 17:14303510-14303532 ATCCACCAGTGTCCCGAGAATGG - Intronic
1146805814 17:35864361-35864383 CTCCAGCTGTATCCAGAGAATGG - Intronic
1147933272 17:43996045-43996067 GCCCACCAGACTCAAGGGAAGGG - Intronic
1148512354 17:48182422-48182444 GTCCAGCAGAAGCCAGAGACTGG - Exonic
1148827103 17:50401813-50401835 GTCCACCATAACACAGGGAAAGG - Intergenic
1149209702 17:54288864-54288886 GTCCACCATAACTCAGGGAAAGG + Intergenic
1150223064 17:63508033-63508055 GTTCACCAGACTCCAGGGACAGG - Intronic
1150384218 17:64745029-64745051 GTCCAATAGAATTAAGAGAAAGG + Intergenic
1150771874 17:68049210-68049232 GTCCAATAGAATTAAGAGAAAGG - Intergenic
1151653676 17:75485608-75485630 GTACATCAGAGTCCTGAGAAGGG - Intronic
1152163197 17:78682554-78682576 CTCCACCAGCATCCTGAGAAAGG + Intronic
1152397101 17:80040158-80040180 GTCCACCAGAATCCAGAGAAAGG + Exonic
1152496944 17:80679973-80679995 CTCCCCCAGAGTCCAGAGAGAGG + Intronic
1153191558 18:2546238-2546260 GTCAACCACAGTCCAGAGATAGG + Intronic
1153438088 18:5088085-5088107 GTCCACCATAACTCAGGGAAAGG + Intergenic
1155476084 18:26236992-26237014 GTCCACCATAACTCAGGGAAAGG - Intronic
1155986788 18:32238601-32238623 TCCCAACGGAATCCAGAGAAGGG + Intronic
1157857526 18:51116211-51116233 GTCCACCATAACTCAGGGAAAGG - Intergenic
1161598198 19:5163296-5163318 GTCCACCACAACTCAGGGAAAGG - Intronic
1162107949 19:8382099-8382121 GTCCACCATAACTCAGGGAAAGG + Intronic
1162237438 19:9320343-9320365 GTCCACCATAACTCAGGGAAAGG - Intergenic
1164992919 19:32697452-32697474 GTCCACCATAACTCAGGGAAAGG - Intronic
1165592218 19:36978856-36978878 GTTCAGTAGAACCCAGAGAAAGG - Intronic
1165847117 19:38825351-38825373 GTCCACCATAACTCAGGGAAAGG + Intronic
1167579201 19:50332086-50332108 GTGCACCAGAATTCGGGGAAGGG - Intronic
928617593 2:33055351-33055373 GTCCACCATAACTCAGGGAAAGG - Intronic
928682291 2:33714865-33714887 TTCCAGCAGAATATAGAGAATGG - Intergenic
929455203 2:42060364-42060386 GTCCTGCAGAGTCAAGAGAAGGG + Intergenic
930152770 2:48075461-48075483 GTCCACTAGAATACAGTGGAAGG - Intergenic
930215322 2:48690279-48690301 GTGCTGCAGAATTCAGAGAATGG + Intronic
930339453 2:50094312-50094334 GTCCATCAAAATGCAGAAAAAGG + Intronic
931540518 2:63324872-63324894 GTCCACCATAACTCAGGGAAAGG + Intronic
931973908 2:67621865-67621887 TACCACCAGAAGCCAGAGGAAGG - Intergenic
934511532 2:94948024-94948046 GTCCGCCAGGCTCCAGGGAAGGG - Intergenic
934576510 2:95405123-95405145 TTCCTCCAGAAACTAGAGAAGGG + Intronic
934672094 2:96220716-96220738 GTCCACCATAACACAGGGAAAGG - Intergenic
934713660 2:96531044-96531066 GTCCACCTGACTCCAGAGCCGGG + Intergenic
934867152 2:97823729-97823751 GTCCACCATAACTCAGGGAAAGG + Intronic
935347484 2:102121974-102121996 GGCAACCAGAATCAAGAAAAGGG + Intronic
938800783 2:134761499-134761521 AGCCTCCAGAATCCACAGAAAGG + Intergenic
938806161 2:134808775-134808797 GTCCACCATAACTCAGGGAAAGG - Intergenic
939851884 2:147314013-147314035 GTCCACCATAACTCAGGGAAAGG + Intergenic
940179345 2:150914552-150914574 AACCACCAGAAGCCAGAGAGAGG - Intergenic
941243442 2:163069386-163069408 GTCCACCATAACTCAGGGAAAGG + Intergenic
941537529 2:166741531-166741553 GTCCACCATAACTCAGGGAAAGG - Intergenic
941914972 2:170805800-170805822 GTCCACCAGGATCAAGCTAAAGG - Intergenic
943133775 2:183888068-183888090 GTCCACCATAACTCAGGGAAAGG + Intergenic
943748226 2:191484501-191484523 AGTCACCACAATCCAGAGAAAGG - Intergenic
944729030 2:202499543-202499565 GTCCACCATAAATCAGGGAAAGG + Intronic
947579762 2:231307721-231307743 GTCAACCAGGTTCCAGAGCAGGG + Intronic
947803250 2:232945586-232945608 CACCACCAGAAGCCAGAGAGAGG + Intronic
948569694 2:238909938-238909960 CTCCACCAGCGTCGAGAGAAGGG + Exonic
948714681 2:239853335-239853357 GTCCACCAGCACACAGGGAAGGG + Intergenic
1169456912 20:5760160-5760182 GTCGAACAGAAAACAGAGAAGGG + Intronic
1171015093 20:21533443-21533465 GTTTTCCAGAATCCAAAGAAGGG + Intergenic
1172857307 20:38015328-38015350 GGCCCCAAGAAGCCAGAGAAGGG + Intronic
1174666758 20:52265283-52265305 GACTCCCAGAAACCAGAGAAAGG + Intergenic
1177135092 21:17299410-17299432 GTCCACCATAACTCAGGGAAAGG + Intergenic
1179087940 21:38237059-38237081 GTCCACCAGCAGCAAGAGGAAGG + Intronic
1180037936 21:45259559-45259581 CTCCTCCAGAAGCGAGAGAACGG + Intergenic
1185035058 22:48470418-48470440 GACCTCAAAAATCCAGAGAAGGG - Intergenic
949535430 3:4992089-4992111 GTCCACGTGAATACATAGAAAGG + Intergenic
951020511 3:17777098-17777120 GTCCACCATAACTCAGGGAAAGG + Intronic
951569171 3:24044242-24044264 GTCCTCCAGGACCCAGAGACAGG + Intergenic
952453053 3:33449274-33449296 GTCCACCATAACTCAGGGAAAGG + Intergenic
952555026 3:34521674-34521696 GTCCACCATAACTCAGGGAAAGG - Intergenic
953581178 3:44158012-44158034 CTCCACTAGAATCTTGAGAAAGG + Intergenic
953622917 3:44548291-44548313 GTCCACCATAACTCAGGGAAAGG - Intergenic
954036072 3:47851925-47851947 GACCACCAGATCCCAGGGAATGG + Exonic
954232244 3:49226444-49226466 GTCCACCATAACTCAGGGAAAGG - Intronic
954755202 3:52835442-52835464 GTCCACTGGAATCCAGGGGAAGG - Exonic
954977260 3:54707977-54707999 GTCCACCTGTATCCACAGAGAGG + Intronic
955926773 3:64014436-64014458 GTCCACCCCAATCCAGTGGAGGG - Intronic
958043752 3:88257785-88257807 GGCCACCAGAAGCCAGAAAGGGG - Intergenic
958549195 3:95592850-95592872 GTCCACCATAACTCAGGGAAAGG - Intergenic
960063709 3:113349156-113349178 GTCCACCATAACTCAGGGAAAGG + Intronic
960418114 3:117410126-117410148 CTCCACCATAACCCAGAGGAGGG - Intergenic
963409197 3:144907231-144907253 GTCCACCATAACTCAGGGAAAGG - Intergenic
963696773 3:148573468-148573490 GTCCACCATAACTCAGGGAAAGG + Intergenic
963992270 3:151668306-151668328 GTCCACCATAACTCAGAGAAAGG - Intergenic
964064521 3:152562452-152562474 GTCCACCATAATTCAGGGAAAGG + Intergenic
964972254 3:162577155-162577177 GTCCACCATAACTCAGGGAAAGG + Intergenic
966666121 3:182472847-182472869 GTCCCCCAGAGTCTACAGAAGGG - Intergenic
967583636 3:191188072-191188094 GTCCGCCATAACTCAGAGAAAGG + Intergenic
968153459 3:196358162-196358184 AGCCACCAGTATGCAGAGAATGG + Intronic
969060240 4:4428245-4428267 GCCCACCAGAAGCCAGTGACTGG - Intronic
971281186 4:25243744-25243766 GTCCACCATAACTCAGGGAAAGG - Intronic
972027289 4:34398853-34398875 GACCCTCAGAAGCCAGAGAATGG + Intergenic
972133279 4:35862514-35862536 GTCCACCATAATTCAGGGAAAGG - Intergenic
972391003 4:38613387-38613409 GTGCACCAGACTCCAGGGCAGGG - Intergenic
973045877 4:45534088-45534110 GTCCACCATAACTCAGGGAAAGG + Intergenic
974187333 4:58460732-58460754 GTCCACCATAACTCAGGGAAAGG + Intergenic
974207839 4:58729725-58729747 GACCACCTGAAACCAGTGAAAGG + Intergenic
974537155 4:63187271-63187293 GTCCACCATAACTCAGGGAAAGG + Intergenic
974838841 4:67279665-67279687 GTCCACCATAACTCAGGGAAAGG - Intergenic
976174302 4:82336403-82336425 GTCCACCATAACTCAGGGAAAGG - Intergenic
978625755 4:110683632-110683654 ATACACCAGAACTCAGAGAAGGG - Intergenic
978714762 4:111828109-111828131 GTTCACCAGAATACAAAGGAAGG - Intergenic
978747189 4:112208089-112208111 GTCCACCATAAGTCAGGGAAAGG + Intergenic
981466672 4:145080275-145080297 GTACACCAAAACCCAGCGAAAGG + Intronic
982126552 4:152188819-152188841 GTTCACCAGAGTCTTGAGAAGGG + Intergenic
984917465 4:184737075-184737097 GTCCACCATAACTCAGGGAAAGG + Intergenic
986600664 5:9469407-9469429 GGCTACCAGAAAACAGAGAAAGG + Intronic
986933322 5:12854105-12854127 GTCCACCATAACTCAGGGAAAGG + Intergenic
987360689 5:17103875-17103897 CTGCAGCAGAATCCAAAGAAGGG + Intronic
987545225 5:19304681-19304703 GTCCACCATAACTCAGGGAAAGG - Intergenic
988592002 5:32557222-32557244 GTCCACCACAACTCAGGGAAAGG - Intronic
989183650 5:38602420-38602442 ATCCACCAGAATAAAGGGAAGGG - Intronic
989964354 5:50450946-50450968 GTCCACCATAACTCAGGGAAAGG - Intergenic
990116746 5:52399937-52399959 GTCCACCATAACTCAGGGAAAGG + Intergenic
990367857 5:55088535-55088557 GTCCACCATAACTCAGGGAAAGG - Intergenic
990770655 5:59240621-59240643 GTTCTCCAGAGTCCAGAGCAGGG - Intronic
991438488 5:66620931-66620953 GTCCCCCCTAATTCAGAGAAAGG + Intronic
992455212 5:76910138-76910160 GTCCACCATAACTCAGGGAAAGG + Intronic
994231719 5:97315625-97315647 GTCCACCATAACTCAGGGAAAGG - Intergenic
995159116 5:108954878-108954900 GTCCATCAGAATATACAGAAAGG - Exonic
995223737 5:109680474-109680496 GTCAAAGAGAATCCATAGAAAGG + Intergenic
995706447 5:114993026-114993048 GTCCACCATAACTCAGGGAAAGG + Intergenic
996099219 5:119430204-119430226 GTCCACCATAACTCAGAGAAAGG - Intergenic
997740235 5:136246532-136246554 GCCCACCAGAATACACAGCATGG - Intronic
1000085240 5:157882662-157882684 GTCCACCATAACTCAGGGAAAGG + Intergenic
1002212221 5:177605788-177605810 GTCTGCCAGAAAGCAGAGAAGGG - Intronic
1003805798 6:9724940-9724962 GTCCACCATAACTCAGGGAAAGG + Intronic
1004531371 6:16458326-16458348 GTCCACCATAACTCAGGGAAAGG + Intronic
1004812245 6:19273859-19273881 GTCCACCATAACTCAGGGAAAGG + Intergenic
1006221789 6:32497668-32497690 GTCCACCATAACTCAGGGAAGGG + Intergenic
1006555180 6:34859681-34859703 GTCCAGGAGAATGCATAGAATGG + Intronic
1006586751 6:35120055-35120077 GTCTACCACAAACCACAGAAAGG - Intronic
1007030042 6:38619056-38619078 GTCCACCATAACTCAGGGAAAGG + Intronic
1008586984 6:52959403-52959425 GTCCACCATAACTCAGGGAAAGG - Intergenic
1009242006 6:61195451-61195473 CCCCACCAGAACCCAAAGAATGG - Intergenic
1009385936 6:63084154-63084176 GTCCACCATAACTCAGGGAAAGG - Intergenic
1009407698 6:63330590-63330612 GTCCACCATAACTCAGGGAAAGG - Intergenic
1009470810 6:64027267-64027289 GTCCACCATAACTCAGGGAAAGG + Intronic
1009735171 6:67667303-67667325 TTGCAACAGAATCCAAAGAAGGG + Intergenic
1010074950 6:71788201-71788223 GTCCACCATGACTCAGAGAAAGG + Intergenic
1010166400 6:72919931-72919953 GTCCACTACAATCCAGAGCTGGG + Intronic
1010269825 6:73906436-73906458 GTCCACCATAACTCAGGGAAAGG + Intergenic
1011375039 6:86678744-86678766 GTCCACCATAACTCAGGGAAAGG - Intergenic
1012163892 6:95924067-95924089 GTCCCCCACAACCCTGAGAAAGG - Intergenic
1013907839 6:115238504-115238526 GTCCACCATAAATCAGGGAAAGG - Intergenic
1013977427 6:116093729-116093751 GTCCACCATAACTCAGGGAAAGG + Intergenic
1014916542 6:127156722-127156744 GTACACCAGAGTCCAGTGAAAGG + Intronic
1016184037 6:141178806-141178828 GTCCACCATAATTCAGGGAAAGG + Intergenic
1016571553 6:145519248-145519270 GTCTTCCAGATTTCAGAGAAGGG + Intronic
1018560979 6:165100698-165100720 GCCCACCAGAACCCAAAGAATGG + Intergenic
1020210145 7:6152882-6152904 GTCCAAGAGAAATCAGAGAAAGG + Intronic
1020474153 7:8575821-8575843 ATCCACCAGTATCCATAAAATGG - Intronic
1021356579 7:19658399-19658421 GTCCACCATAACTCAGGGAAAGG - Intergenic
1022865297 7:34411939-34411961 CTCTCCCAGAATTCAGAGAAAGG - Intergenic
1024521511 7:50308700-50308722 CTCCACCAGGGTGCAGAGAAAGG - Exonic
1024787285 7:52922721-52922743 GTACACCTGAATCCTGAGATTGG - Intergenic
1026554753 7:71397684-71397706 GTCCACAAGAAGACAGTGAAGGG - Intronic
1027714511 7:81653201-81653223 GTCCACCAGCTTCCACAGGAAGG + Intergenic
1027791121 7:82639723-82639745 GTCCACCATAACTCAGGGAAAGG + Intergenic
1028588609 7:92474410-92474432 GTCCACCATAACACAGGGAAGGG - Intronic
1030715285 7:112801595-112801617 GTCCACCTGGATCCTGAGAGTGG + Intergenic
1031105648 7:117539091-117539113 GTCAACCAGGATACAGAGAGAGG - Intronic
1032708232 7:134440660-134440682 GTCCACCAGAGTCCTGAGGCTGG + Intergenic
1033759247 7:144422279-144422301 GTCCACCATAACTCAGGGAAAGG - Intergenic
1036224798 8:6948914-6948936 GTGAACCAGAAACCAAAGAAGGG + Intergenic
1036286809 8:7449943-7449965 TTCAAGCAGGATCCAGAGAAAGG + Intronic
1036334669 8:7861580-7861602 TTCAAGCAGGATCCAGAGAAAGG - Intronic
1038127268 8:24688665-24688687 GTCCAAGAGAAGACAGAGAATGG + Intergenic
1038638791 8:29307623-29307645 GTCCACCAAAACTCAGGGAAAGG + Intergenic
1039276005 8:35934651-35934673 GTCTACCATAATTCAGGGAAAGG + Intergenic
1039360444 8:36871011-36871033 GACCACCAGAATCCCTAGCAGGG + Intronic
1039391261 8:37182566-37182588 GTCCACCAAGATCCAGAGGGTGG + Intergenic
1039834227 8:41243703-41243725 GACCACCAGAAGGCAGAGAGAGG + Intergenic
1039999680 8:42565510-42565532 GTCCACCATAACTCAGGGAAAGG - Intergenic
1040527213 8:48235686-48235708 GTCCACCATAACTCAGGGAAAGG + Intergenic
1040648953 8:49428970-49428992 GTCCACCATAACTCAGGGAAAGG + Intergenic
1040667873 8:49654360-49654382 GTCCACCATAACTCAGGGAAAGG - Intergenic
1040953391 8:52957288-52957310 GTCCACCATAACTCAGGGAAAGG + Intergenic
1040971460 8:53140935-53140957 GTCCACCATAACTCAGGGAAAGG - Intergenic
1041222535 8:55665791-55665813 CTCCTCCAGAAGCCAGGGAAAGG + Intergenic
1042771909 8:72390596-72390618 GTCCACCATAACTCAGGGAAAGG + Intergenic
1042919608 8:73908658-73908680 GTCCGCCATAACTCAGAGAAAGG + Intergenic
1043257053 8:78150220-78150242 GTCCACCATAACTCAGGGAAAGG + Intergenic
1044005439 8:86931874-86931896 GTCCACCATAACTCAGGGAAAGG - Intronic
1044456632 8:92398247-92398269 GTCCACCATAACTCAGGGAAAGG - Intergenic
1046758243 8:117993480-117993502 TTCCACCAAAGTCCAGAAAAGGG + Intronic
1047187030 8:122642907-122642929 CTCAAACAGAATCCAGGGAAGGG + Intergenic
1051563427 9:18469213-18469235 GGCCATGAGAATTCAGAGAAGGG - Intergenic
1051935272 9:22437185-22437207 GTCCACCATAACTCAGGGAAAGG + Intergenic
1052057774 9:23923228-23923250 GTCCACCATAACTCAGGGAAAGG - Intergenic
1058669721 9:107350609-107350631 GTCCAGCAGAAGCTAGAGCAAGG - Intergenic
1060459952 9:123842167-123842189 GTACACCAGAATTCAAAGGAAGG + Intronic
1060833827 9:126739807-126739829 GTTGACTGGAATCCAGAGAATGG + Intergenic
1203654553 Un_KI270752v1:10288-10310 GAACACCAGAATCCAGTGACAGG - Intergenic
1186101489 X:6162240-6162262 CTCCATCAGCAACCAGAGAAGGG + Intronic
1187704772 X:21998949-21998971 GGCCTCCAATATCCAGAGAAGGG + Intergenic
1188097513 X:26042757-26042779 GTCCACCATAACTCAGGGAAAGG + Intergenic
1188136509 X:26500114-26500136 GTCCACCATAACTCAGGGAAAGG + Intergenic
1188634974 X:32418325-32418347 GTCCAGCAGAAGACAGAAAATGG + Intronic
1190002443 X:46701966-46701988 GTCTAGCAGTGTCCAGAGAATGG - Intronic
1190541458 X:51482263-51482285 GTCCACCATAACTCAGGGAAAGG + Intergenic
1191254596 X:58274267-58274289 GTCCCCCAGAAGACAGAGACAGG - Intergenic
1191693767 X:63967043-63967065 GTCCACCTGGAGCAAGAGAAGGG + Intergenic
1192870018 X:75176109-75176131 ATCCACCATAACCCAGGGAAAGG - Intergenic
1195439564 X:104885395-104885417 GTCCACCATAACTCAGGGAAAGG + Intronic
1195552394 X:106184372-106184394 GTCCACCATAACTCAGGGAAAGG - Intronic
1196127355 X:112114153-112114175 GTCCACCATAACTCAGGGAAAGG - Intergenic
1196412154 X:115431647-115431669 TTCCCACAGAATCCAGAGATGGG - Intergenic
1196488977 X:116246144-116246166 GTCCACCATAACTCAGAGAAAGG + Intergenic
1196623375 X:117849873-117849895 GTTCTACAGAATCCAGAGACTGG - Intergenic
1196751910 X:119125930-119125952 GAGCACCACAACCCAGAGAAAGG + Intronic
1199832412 X:151559575-151559597 GTCCACCATAACTCAGGGAAAGG - Intergenic
1200305475 X:155022137-155022159 CTCCTCCAGAATCTAGAGACTGG - Intronic
1200618445 Y:5410723-5410745 GTACACAAGAATACAAAGAAGGG - Intronic
1200776211 Y:7172431-7172453 GTCCACCATAACTCAGTGAAAGG + Intergenic
1200959304 Y:8982510-8982532 GTCCACCATAACTCAGAGAAAGG + Intergenic
1201312058 Y:12606077-12606099 GTACACCATAACTCAGAGAAAGG - Intergenic
1201407515 Y:13663709-13663731 GTCCACCATAACTCAGGGAAAGG - Intergenic
1201429690 Y:13891592-13891614 GTCCATCATAACCCAGGGAAAGG + Intergenic
1201471888 Y:14343333-14343355 GTCCACCATAATGCAGGGAAAGG - Intergenic
1201515981 Y:14819069-14819091 GTCCACCATAACTCAGGGAAAGG - Intronic
1201555730 Y:15263365-15263387 GTCCACCATAACTCAGGGAAAGG + Intergenic
1201568588 Y:15391183-15391205 GTCCACCATAACTCAGAGAAAGG - Intergenic
1201911089 Y:19134183-19134205 GTCCACCATAATTCAGGGAAAGG + Intergenic
1202074712 Y:21026467-21026489 GTCTACCATAACTCAGAGAAAGG - Intergenic
1202089881 Y:21178377-21178399 GTCCACCATAATTCAGGGAAAGG - Intergenic
1202242876 Y:22788793-22788815 GTCCACCATAACTCAGGGAAAGG + Intergenic
1202272061 Y:23082285-23082307 GTCCACCATAACACAGGGAAAGG - Intergenic
1202293965 Y:23338397-23338419 GTCCACCATAACACAGGGAAAGG + Intergenic
1202395863 Y:24422543-24422565 GTCCACCATAACTCAGGGAAAGG + Intergenic
1202425058 Y:24716029-24716051 GTCCACCATAACACAGGGAAAGG - Intergenic
1202445731 Y:24954056-24954078 GTCCACCATAACACAGGGAAAGG + Intergenic
1202474922 Y:25247549-25247571 GTCCACCATAACTCAGGGAAAGG - Intergenic