ID: 1152397136

View in Genome Browser
Species Human (GRCh38)
Location 17:80040298-80040320
Sequence CCAGTGTCGCACGGCCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152397129_1152397136 22 Left 1152397129 17:80040253-80040275 CCAGCAGTGGGCAGATTGGTGAG 0: 1
1: 1
2: 1
3: 14
4: 132
Right 1152397136 17:80040298-80040320 CCAGTGTCGCACGGCCCACGGGG 0: 1
1: 0
2: 1
3: 0
4: 46
1152397130_1152397136 -4 Left 1152397130 17:80040279-80040301 CCCTGACTTCTGTTTTGTGCCAG 0: 1
1: 0
2: 2
3: 26
4: 392
Right 1152397136 17:80040298-80040320 CCAGTGTCGCACGGCCCACGGGG 0: 1
1: 0
2: 1
3: 0
4: 46
1152397131_1152397136 -5 Left 1152397131 17:80040280-80040302 CCTGACTTCTGTTTTGTGCCAGT 0: 1
1: 1
2: 3
3: 13
4: 223
Right 1152397136 17:80040298-80040320 CCAGTGTCGCACGGCCCACGGGG 0: 1
1: 0
2: 1
3: 0
4: 46
1152397127_1152397136 30 Left 1152397127 17:80040245-80040267 CCTCTGGGCCAGCAGTGGGCAGA 0: 1
1: 0
2: 1
3: 39
4: 336
Right 1152397136 17:80040298-80040320 CCAGTGTCGCACGGCCCACGGGG 0: 1
1: 0
2: 1
3: 0
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152397136 Original CRISPR CCAGTGTCGCACGGCCCACG GGG Intronic
900531653 1:3156772-3156794 CCAGAGTCCCAGGGCCCACATGG + Intronic
910542752 1:88379428-88379450 CCAGAGTGGCACGGGCCATGTGG - Intergenic
917764472 1:178201601-178201623 CCAGTGTGGCAGGGGCCAAGTGG + Intronic
922677440 1:227561416-227561438 GCAGTGGCGGACGCCCCACGAGG - Intergenic
1066196724 10:33107102-33107124 CCACTGTCGCAGGTCCCACAAGG + Intergenic
1076573456 10:131448465-131448487 CCAGTGTCGCTTTGCCCAAGAGG + Intergenic
1076594758 10:131618783-131618805 CCAGCGCCCCACGGCCCACCCGG + Intergenic
1076721848 10:132396547-132396569 CCAGTGTCCCGCCCCCCACGCGG + Intergenic
1078454491 11:11464533-11464555 TCAGTGTGCCAGGGCCCACGAGG - Intronic
1084312424 11:68324813-68324835 CCAGGGACCCACAGCCCACGGGG - Intronic
1091238795 11:134039039-134039061 CCAGTGTGGCAAGGACCAGGCGG + Intergenic
1100593527 12:96051944-96051966 TCAGTGTAGCACTGCCCACATGG - Intergenic
1113492805 13:110705851-110705873 CCAGTCCCGCGCGGCCCACCAGG + Exonic
1122370261 14:101225595-101225617 ACAGGGTCCCACGGCCCCCGGGG - Intergenic
1130511605 15:84594308-84594330 CCAGTTTGGCAGGGCCCACAGGG - Intergenic
1135630978 16:24035465-24035487 CCTGTGTGGCACGGACCACACGG + Exonic
1146653318 17:34620596-34620618 CCAGTGTCTCATGGCCCCAGGGG + Intronic
1152397136 17:80040298-80040320 CCAGTGTCGCACGGCCCACGGGG + Intronic
1154175300 18:12083735-12083757 CCAGGGCTGCACTGCCCACGGGG + Intergenic
1162442448 19:10701424-10701446 ACTGTGTGGTACGGCCCACGTGG + Intronic
1167162680 19:47778439-47778461 CCAGAATGGTACGGCCCACGGGG - Intergenic
935260953 2:101355680-101355702 CCACTGTCGCAAGTCCCTCGAGG - Intronic
937882497 2:126878776-126878798 CCAGTGGCTCACGGCCCCCATGG + Intergenic
938478333 2:131635849-131635871 CCAGGTTCCCACAGCCCACGTGG + Intergenic
945868541 2:215202874-215202896 CCCCTGTTGCAAGGCCCACGGGG - Intergenic
1170571129 20:17633364-17633386 CCAGTGTGGCACGGCCAGCCTGG + Intronic
1172602726 20:36195079-36195101 CCAGTGTGGCTCTGCCCACTTGG + Intronic
1176618406 21:9039997-9040019 CCAGGGTCGCAGTGTCCACGAGG + Intergenic
1183647084 22:39133139-39133161 CCAGGTTCGCAAGGCCCATGTGG + Exonic
955115267 3:55992139-55992161 CGAGTGTGGCAAGGCCCAAGCGG - Exonic
956769774 3:72515354-72515376 CCAGTGTCCCACGGGCTAAGGGG - Intergenic
960697039 3:120406445-120406467 CCAGTGCCACATGGCCCAAGTGG + Intronic
983076379 4:163331984-163332006 CCAGCGTCGCACGGGTCCCGCGG - Intronic
983250413 4:165339015-165339037 CCAGTGTAGCACTGTCCACAAGG - Intronic
997470659 5:134115209-134115231 CCAGTTGCGCGCGGCCCTCGGGG + Intronic
1002633732 5:180596912-180596934 CCAGTGCCCGAGGGCCCACGGGG - Intergenic
1013656651 6:112253890-112253912 CGAGTGTGGCACAGCCCGCGGGG + Intronic
1019999178 7:4745183-4745205 CCAGTGCCGCCCCGCCCCCGCGG + Intronic
1024006545 7:45228590-45228612 CCAGGGTCGAACAGCCCTCGTGG - Intergenic
1031918612 7:127585400-127585422 CCAGTGTCGCCCCGCCTCCGGGG - Exonic
1033670566 7:143488857-143488879 CCAGTGTCTCACAGGCCACATGG + Intergenic
1051174470 9:14348538-14348560 CCAGTTTAGCACGGCACAGGCGG + Intronic
1054350617 9:64015154-64015176 CCAGGGTCGCAGTGTCCACGAGG + Intergenic
1058153321 9:101486109-101486131 CTAGTGTCGCACTGCGCTCGCGG - Intronic
1061762667 9:132861169-132861191 GCAGTGTCACAAAGCCCACGGGG - Intronic
1062432610 9:136532768-136532790 CCGGGGTCGCACGGCCCACGTGG + Intronic
1062625941 9:137441562-137441584 CCAGGGTCGCCCCGCCCCCGGGG + Intronic
1203551275 Un_KI270743v1:166348-166370 CCAGGGTCGCCTGGTCCACGTGG + Intergenic