ID: 1152398262

View in Genome Browser
Species Human (GRCh38)
Location 17:80048506-80048528
Sequence ATTCTATTCTGGGGCATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152398262_1152398267 10 Left 1152398262 17:80048506-80048528 CCATTGATGCCCCAGAATAGAAT 0: 1
1: 0
2: 2
3: 13
4: 121
Right 1152398267 17:80048539-80048561 TCTCTCCAGCAGCTCCTCAATGG 0: 1
1: 0
2: 4
3: 24
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152398262 Original CRISPR ATTCTATTCTGGGGCATCAA TGG (reversed) Intronic
901531072 1:9852847-9852869 ATTCCCTCCTGGGGCATCCAGGG - Intronic
902103225 1:14011147-14011169 ATTCCATCCTGGGACACCAAGGG - Intergenic
907763225 1:57382553-57382575 ATTCCTTTCTGGAGCTTCAAAGG + Intronic
909894529 1:81050706-81050728 ATTTTTTTCGGGGGCATCACAGG - Intergenic
910855231 1:91688277-91688299 ATCCTATTCAGGGGCCACAAAGG - Intronic
913072345 1:115311025-115311047 ATTCTATTTTGGGCAAACAAGGG + Intronic
913298004 1:117340532-117340554 ATTATTTTCTGAGGCATAAATGG - Intergenic
915946042 1:160152550-160152572 ATTATATTCTGTGGAAACAAGGG - Intronic
918580196 1:186117691-186117713 CTTTTATTCTGGTGCAACAAAGG - Intronic
921296539 1:213709368-213709390 TTTGTATTCTGTGGGATCAATGG + Intergenic
923415758 1:233758101-233758123 ATTTTGATCTGGGGCTTCAAAGG - Intergenic
924355803 1:243174204-243174226 AATCTATTCTGTGACATCCAGGG - Intronic
924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG + Intronic
1064308810 10:14193067-14193089 ATTCTACCCTGGGCCATCCATGG + Intronic
1070537592 10:77391260-77391282 ATCCTTCCCTGGGGCATCAAGGG - Intronic
1071949206 10:90683662-90683684 TTTCTTTTTTGGGTCATCAAGGG - Intergenic
1076089040 10:127663201-127663223 ATTCTATTCTGATAAATCAAGGG + Intergenic
1078020566 11:7653166-7653188 ATCCAGTTCAGGGGCATCAAGGG - Exonic
1080322202 11:31023404-31023426 ATTCCATCCTGGGCAATCAAAGG + Intronic
1091235122 11:134016752-134016774 ATTCTTTTTTGTGGCATCAGAGG - Intergenic
1093996118 12:25644704-25644726 CTTCTATTCTGCAGCATCTATGG - Intronic
1095404016 12:41847370-41847392 ATTCTCTTCTGTTCCATCAACGG - Intergenic
1097197597 12:57252119-57252141 GTTATATACTGAGGCATCAAAGG - Intronic
1099128346 12:78794765-78794787 ATTCTCTTCTGGGGAAGCAGGGG + Intergenic
1101293924 12:103401335-103401357 TTTCTATTCTTGGACATCAGTGG + Intronic
1102099969 12:110270595-110270617 TTTCTATTGTGGGACATCAAGGG + Intergenic
1102833796 12:116034104-116034126 AGTCTATTCTGGGGCTTTAAAGG - Intronic
1104544151 12:129696022-129696044 ATCCTATTCTGGGCCAACACAGG + Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107795251 13:44045289-44045311 ATTTTATTATGGGTCATTAAGGG - Intergenic
1117213818 14:53529060-53529082 ATTTTATAATGGGGCATTAAGGG - Intergenic
1120545779 14:85809458-85809480 CTTCTATTCAGGGACATCTATGG + Intergenic
1121128760 14:91426889-91426911 TTTCTTTTCTGTGGCATCATCGG - Intergenic
1122177904 14:99934691-99934713 ATTCTATTCTGGGCCCTGCATGG + Intronic
1124184074 15:27506564-27506586 ATTCTTTTCTGGGGGCTCTAGGG - Intronic
1125253670 15:37736895-37736917 ATTCTATTCTGTAACATCACAGG - Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1129494587 15:75966173-75966195 ATTCGATTCTGTGGCATTCAAGG + Intronic
1129771666 15:78206836-78206858 ATGCTTTTCTGGGGCTCCAAGGG + Intronic
1136912663 16:34157422-34157444 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1139775669 16:69315684-69315706 TTTCTATTCTGCTGCCTCAAGGG - Intronic
1147195598 17:38764558-38764580 ATTCTAAGCTCTGGCATCAATGG - Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153014188 18:568622-568644 TTTCTGTTCTGGGGCATCTCAGG - Intergenic
1153433720 18:5046750-5046772 TTTCTTTTCTGGGGCTTCAATGG - Intergenic
1156443053 18:37211213-37211235 ATTCTAGTCTGGGAAGTCAAGGG + Intronic
1157850423 18:51043708-51043730 ATGCTATGCTGGGGCCTTAACGG - Intronic
1158461902 18:57653848-57653870 ATTCTGTTGTCAGGCATCAAGGG - Intronic
1160892855 19:1388326-1388348 ATTCAAGTCTGGGCCATCATTGG + Intronic
1162399412 19:10435831-10435853 ATCTGATTCTGGGGCATCACTGG + Intronic
927295478 2:21448040-21448062 TTTATATTGTGGGGAATCAAAGG - Intergenic
927387075 2:22547223-22547245 TTTCTATTCTAGGGGCTCAAAGG + Intergenic
938993445 2:136653292-136653314 ATTCTATTCTGTGTGATGAAGGG + Intergenic
939142792 2:138376143-138376165 ATTCTATTTTGGGGAAACAATGG - Intergenic
939295000 2:140250637-140250659 ATTCTAGTCTGGAACATAAAGGG - Intronic
939488221 2:142843908-142843930 ATTCTATTCATAGTCATCAAAGG - Intergenic
945206687 2:207340440-207340462 ATTCTATTTTAGGGCCCCAAAGG - Intergenic
946523713 2:220495246-220495268 ATTGTATTCAGTGGCATCACTGG + Intergenic
947705659 2:232273541-232273563 ATTATTTGCTGGGGCATCCAGGG + Intronic
1171968519 20:31548881-31548903 ATACTAATCTGGGGCAGCCAAGG + Intronic
1173722780 20:45273942-45273964 ATTTTATTCTGGGAAATCATTGG - Intergenic
1174531237 20:51216018-51216040 CTTTTATTTTGGGGCCTCAAAGG + Intergenic
1175805581 20:61826736-61826758 ATGCTATCCTAGGCCATCAACGG - Intronic
1176553195 21:8238978-8239000 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1176572117 21:8422002-8422024 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1176580026 21:8466585-8466607 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1176589080 21:8623072-8623094 ATTTTATTCTGAGACATCAAGGG - Intergenic
1178484412 21:33008911-33008933 TTTCTATTCTGGGATGTCAAAGG - Intergenic
1180271906 22:10600069-10600091 ATTTTATTCTGAGACATCAAGGG - Intergenic
1181410768 22:22717170-22717192 ATTCTTTCCTGGGGCGTCATAGG + Intergenic
1182579026 22:31292717-31292739 ATTCTATCAAGGGGCATCATGGG + Intergenic
1182792511 22:32964797-32964819 GTTCTGTCATGGGGCATCAAGGG - Intronic
1203258193 22_KI270733v1_random:156020-156042 AATCTATTTTGTGGCCTCAAGGG - Intergenic
949138236 3:598697-598719 ATTTTATTCTGAGACATCAAGGG + Intergenic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
954768458 3:52943348-52943370 ATTACCTTCTGGGGCTTCAAGGG + Exonic
955031660 3:55227693-55227715 ATTTTATTCTAGGACATAAAAGG + Intergenic
955058535 3:55476645-55476667 TTTGTATTCTGCGGCATAAAAGG - Intronic
955354935 3:58223424-58223446 ATTCAACTCTGGGCCCTCAAGGG - Intergenic
958521455 3:95193238-95193260 ATTTTAATTTGGGGCACCAAAGG - Intergenic
961922539 3:130443145-130443167 ACTCTATTCTGATTCATCAAAGG - Intronic
962405217 3:135094523-135094545 ATTCTATTCTGAGGCAGGCAGGG + Intronic
963372783 3:144422817-144422839 AAGCTATTCTTGGGCATTAAAGG - Intergenic
965421426 3:168463820-168463842 ATTTTATTGTGGGGCATGAAGGG + Intergenic
969778754 4:9380185-9380207 AGTCTTTTCTGGGCCAACAAGGG - Intergenic
969836619 4:9847592-9847614 AACCCATGCTGGGGCATCAATGG + Intronic
972370783 4:38421246-38421268 CTTCTGTTCTTGGGCATCAGTGG - Intergenic
976005337 4:80423491-80423513 ATTGTTTTCTGGGGCAGCACTGG + Intronic
977509848 4:97949527-97949549 GTTCTATTCTGGTGCATAATGGG + Intronic
979246009 4:118505427-118505449 AATCTATTCTGTGACATCCAGGG + Intergenic
982038866 4:151375082-151375104 ATTCTAGTCTGGGGCAGGAAAGG - Intergenic
987933819 5:24436986-24437008 AATCTATTCTCGGGCACCATGGG - Intergenic
991470087 5:66958786-66958808 ATTCTATTCGAGAGCATCACAGG + Intronic
992892149 5:81213397-81213419 CTTCTATTCTCTGGCACCAATGG - Intronic
993361262 5:86979563-86979585 AAACTGTTTTGGGGCATCAATGG + Intergenic
996843793 5:127877632-127877654 ATATTATTCTGGGACAACAATGG - Intergenic
997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG + Intronic
999160589 5:149493390-149493412 ATTCTATTATGGTGCCACAAAGG - Intronic
1000534755 5:162466183-162466205 ATTCTGTTCTGCTCCATCAAGGG - Intergenic
1001442443 5:171754401-171754423 TTTTTATTCTGGGACATTAATGG + Intergenic
1003904688 6:10688611-10688633 ATTTTATACTTGGGCATCCAAGG - Intronic
1004755044 6:18601789-18601811 GTTCTTTGCTGGGGCTTCAAAGG + Intergenic
1005807812 6:29491325-29491347 ACTCCATAGTGGGGCATCAAGGG - Intergenic
1007225806 6:40313314-40313336 GTTCTATTTTGGGCCTTCAATGG - Intergenic
1013532892 6:111036243-111036265 ATTCTATTGTTGGGCATTAATGG + Intergenic
1023086665 7:36577093-36577115 ATTCTATTGTAGTGCATGAAGGG - Intronic
1029265083 7:99332516-99332538 ATTCTGTTCAGGGTCGTCAATGG - Intronic
1031130104 7:117823641-117823663 ATCCTTGGCTGGGGCATCAAAGG - Intronic
1034591534 7:152144141-152144163 ATTCCATTCTGAGACATCCAAGG + Intronic
1036276205 8:7354158-7354180 AGTCTTTTCTGGGCCAACAAGGG - Intergenic
1036345142 8:7956189-7956211 AGTCTTTTCTGGGCCAACAAGGG + Intergenic
1036840475 8:12116956-12116978 AGTCTTTTCTGGGCCAACAAGGG + Intergenic
1036862273 8:12363201-12363223 AGTCTTTTCTGGGCCAACAAGGG + Intergenic
1038884000 8:31642547-31642569 ATTCTATTCTTGTGCTTCTAAGG + Intronic
1041162602 8:55060530-55060552 ATTCTCTTCTAGGGCTACAAGGG - Intergenic
1045362131 8:101442547-101442569 ATTCTCTTCTGGGGCAGGACAGG - Intergenic
1045696771 8:104817876-104817898 ATTCTCCTTTGGGGAATCAAAGG + Intronic
1047575692 8:126152105-126152127 ACTATATTCTGAGGCATAAATGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1051617095 9:19016671-19016693 TTTCTAATCTGTGGCACCAATGG - Intronic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1053967289 9:43667909-43667931 ATTCTACTCTGTGACTTCAATGG - Intergenic
1054021973 9:44615714-44615736 ATTCTACTCTGTGACTTCAATGG - Intergenic
1056276844 9:85001927-85001949 ATCCTATTATGGAGCATCAGAGG + Intronic
1058033301 9:100223678-100223700 GTTCTATTTAGGGTCATCAAGGG + Intronic
1203474387 Un_GL000220v1:138043-138065 AATCTATTTTGTGGCCTCAAGGG - Intergenic
1203619085 Un_KI270749v1:101652-101674 ATTTTATTCTGAGACATCAAGGG - Intergenic
1186540164 X:10392329-10392351 ATTCTTTTATGGGTCATCAATGG - Intergenic
1186900148 X:14045788-14045810 TTTCTGTTCTGGGGCATTTATGG + Intergenic
1192047566 X:67692253-67692275 ATTCTAGTCTAGAGAATCAAAGG - Intronic
1194628332 X:96252083-96252105 ATTCTATTCAGGAGCAGAAAGGG - Intergenic
1196097083 X:111811869-111811891 TTGCTGTTCTGGGCCATCAAAGG - Intronic
1197345330 X:125321770-125321792 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197345342 X:125321833-125321855 ATCATGTTCTGGGGCATCACTGG - Intergenic
1197640794 X:128966177-128966199 TATGTATTATGGGGCATCAAAGG - Intergenic