ID: 1152398267

View in Genome Browser
Species Human (GRCh38)
Location 17:80048539-80048561
Sequence TCTCTCCAGCAGCTCCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152398265_1152398267 0 Left 1152398265 17:80048516-80048538 CCCAGAATAGAATCACTGAGGCT 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1152398267 17:80048539-80048561 TCTCTCCAGCAGCTCCTCAATGG 0: 1
1: 0
2: 4
3: 24
4: 277
1152398264_1152398267 1 Left 1152398264 17:80048515-80048537 CCCCAGAATAGAATCACTGAGGC 0: 1
1: 0
2: 0
3: 15
4: 148
Right 1152398267 17:80048539-80048561 TCTCTCCAGCAGCTCCTCAATGG 0: 1
1: 0
2: 4
3: 24
4: 277
1152398266_1152398267 -1 Left 1152398266 17:80048517-80048539 CCAGAATAGAATCACTGAGGCTT 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1152398267 17:80048539-80048561 TCTCTCCAGCAGCTCCTCAATGG 0: 1
1: 0
2: 4
3: 24
4: 277
1152398262_1152398267 10 Left 1152398262 17:80048506-80048528 CCATTGATGCCCCAGAATAGAAT 0: 1
1: 0
2: 2
3: 13
4: 121
Right 1152398267 17:80048539-80048561 TCTCTCCAGCAGCTCCTCAATGG 0: 1
1: 0
2: 4
3: 24
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152398267 Original CRISPR TCTCTCCAGCAGCTCCTCAA TGG Intronic
900576864 1:3387311-3387333 TCTCTCCAACACCGCCTCAAGGG + Intronic
900754425 1:4423900-4423922 TCCATCCACCAGCTCCTCATGGG + Intergenic
900756498 1:4438952-4438974 TCTCTCGAGGAGCTTCTCTATGG - Intergenic
900951728 1:5861850-5861872 TGTCTCCAGCAGCCCCTAGAAGG + Intergenic
901241537 1:7696989-7697011 TCACTCCAGCTACTCCTGAATGG + Intronic
902236339 1:15059976-15059998 TCTTCCCAGCAGCTGCTCTATGG + Intronic
902602039 1:17546616-17546638 TCTCTCCCTCCCCTCCTCAAAGG - Intronic
903040602 1:20527015-20527037 TCTCACCCTCAGCTCCTCACTGG - Intergenic
905283251 1:36862645-36862667 TCCCTCCCTCAGCTCCTCCAGGG + Intronic
907265349 1:53256393-53256415 TCTCACCAGCTTCTCCTCACTGG - Intronic
908041324 1:60116732-60116754 TCTCTCCTGCTGCTGCACAATGG - Intergenic
909106354 1:71414333-71414355 TATCTCCTGCAGCTGCTCATGGG - Intronic
911264812 1:95730762-95730784 TCTGTCCACCTCCTCCTCAAAGG - Intergenic
913664831 1:121037656-121037678 GCTCTGGAGTAGCTCCTCAAAGG + Intergenic
914016224 1:143820931-143820953 GCTCTGGAGTAGCTCCTCAAAGG + Intergenic
914161558 1:145140077-145140099 GCTCTGGAGTAGCTCCTCAAAGG - Intergenic
914654841 1:149729472-149729494 GCTCTGGAGTAGCTCCTCAAAGG + Intergenic
915679098 1:157562830-157562852 TCCCTCCAGGAGCTCCTGAGAGG - Intergenic
919813549 1:201423912-201423934 TCTCTCCTGCAGTCTCTCAAAGG + Intronic
920049098 1:203152530-203152552 TCCCTGCAGCAGCTACTCACAGG + Intronic
920092333 1:203463662-203463684 TCACTCCAGCTTCTCCTCTAGGG - Intergenic
920295702 1:204954820-204954842 TCTCTCCAGAATCTCCTCTGTGG + Exonic
920633743 1:207678629-207678651 TCTCTCACACAGCTGCTCAATGG - Intronic
923670091 1:236032916-236032938 TAACTCCTGCAGTTCCTCAATGG - Intronic
924754968 1:246932183-246932205 TCTCCCCACCAGCTCCTCGGAGG - Intergenic
1062999583 10:1903161-1903183 TCTCTCCAGGCTCTGCTCAAAGG + Intergenic
1068153827 10:53169758-53169780 TTTTTCCAGCAGCAACTCAAAGG - Intergenic
1070289182 10:75103740-75103762 TGTCTCCAGCAGCTCCCCTCAGG - Intronic
1072818847 10:98536398-98536420 TCTTTCCAGCATCACCTCAATGG - Intronic
1074332319 10:112527230-112527252 GCTCTCAAGCTGCTCCTTAACGG + Intronic
1075144654 10:119872777-119872799 TGTCGCCAGCAGCTCCTCGGCGG - Intronic
1078968237 11:16372733-16372755 TCTCTCCATCAACATCTCAAGGG - Intronic
1080859668 11:36142392-36142414 TTTCACCAGCAGCTACTAAACGG - Intronic
1081840334 11:46196091-46196113 TCCCTCCAGCAGCACCTAAGAGG + Intergenic
1083620744 11:64048229-64048251 TCCCGCCGGCAGCTACTCAAAGG + Intronic
1083832872 11:65244085-65244107 TCTCTCCAGTGGCTCCTCAAAGG + Intergenic
1083934272 11:65862236-65862258 CCTCTGCAGCAGCTCCTCCTTGG - Exonic
1084036666 11:66515559-66515581 GCTCTCCAGCATCTCCTTCAGGG - Exonic
1084570655 11:69957718-69957740 TCTCCCCAGCAGCTCTGCAAGGG - Intergenic
1084653860 11:70503992-70504014 TCATCCCAGCAGCTCCTGAATGG + Intronic
1084731141 11:71074397-71074419 TCCCTCCCCCAGCTCCTCAAAGG + Intronic
1084791901 11:71480482-71480504 ACGCTCTGGCAGCTCCTCAAAGG - Intronic
1088422231 11:109660973-109660995 TCCCTACAGCAGTTCCTCATAGG - Intergenic
1088592345 11:111414609-111414631 TCTCTCCCACAGACCCTCAAAGG + Intronic
1090604430 11:128406737-128406759 TCTCCCCCTCAGCTCCTCCAGGG + Intergenic
1091237744 11:134033202-134033224 TCTCTCCAGCTGCTACCCACAGG + Intergenic
1091545582 12:1499505-1499527 TCTCTCCTCCAGGCCCTCAATGG + Intergenic
1094692700 12:32785565-32785587 ACAACCCAGCAGCTCCTCAAAGG - Intergenic
1096169870 12:49459223-49459245 TCCCTCCACCAGTTCCTCACTGG - Intronic
1098366213 12:69705951-69705973 TCACTCCAGCAGCTTCCCACAGG + Intergenic
1098967351 12:76804716-76804738 TCCCTCCCCCAGCTCCTCACTGG - Intronic
1100404612 12:94262660-94262682 TCCCTCCACCAGGTGCTCAAGGG + Intronic
1101224553 12:102675254-102675276 TCTCTTCAGCACTTCCTCATGGG - Intergenic
1102227888 12:111241720-111241742 TTGCTCCAGCTGCCCCTCAAGGG - Intronic
1102647733 12:114414625-114414647 CCCCTCGAGCAGCGCCTCAAAGG + Intergenic
1103010112 12:117451729-117451751 TCTCAGCAGCAGCTCCTCAAGGG + Intronic
1105603376 13:21907449-21907471 TCTTTTCAGCAGATACTCAAAGG - Intergenic
1108173203 13:47765468-47765490 TCTCTCCCCCAGGTCCTCATTGG + Intergenic
1108863798 13:54897122-54897144 TCTCTCCCCCAGGTCCTCATTGG + Intergenic
1112703111 13:102034810-102034832 TTACTCCAGCAGGTGCTCAAGGG - Intronic
1113711670 13:112469337-112469359 TCTCTCCAGCGCCTCCTGCAAGG + Intergenic
1113858110 13:113460530-113460552 TCTCTCCAGAGGGTCCACAAAGG + Intronic
1114169991 14:20262682-20262704 TCTCTGCAGCAGCTCTGCCATGG + Intronic
1114449400 14:22815072-22815094 TCTCTCCAGCAGCAACTCTGGGG - Intronic
1117258081 14:54000686-54000708 CCTCTGCAGCAGCTCCTGGAGGG - Intergenic
1117828339 14:59726635-59726657 TCACTCCAGGATCTCCTAAATGG - Intronic
1118742294 14:68748396-68748418 TATCTGCAGCACCTCCTCCATGG + Intergenic
1119148192 14:72334788-72334810 TCCCTCCAGCATCTCCCCACAGG + Intronic
1119714757 14:76851168-76851190 TCTCTCCAGCAGAGGCTCAGGGG - Intronic
1120071591 14:80109305-80109327 TCTCTGCATCAGATCCTCCATGG - Intergenic
1120834857 14:89030406-89030428 TCTCTGCAACAGCTCTTCACTGG + Intergenic
1121341503 14:93107818-93107840 TCTCCCCAGCAGAGCCTCATGGG - Intronic
1123682275 15:22771335-22771357 TTTCTCCTTCAGCTCCTCATTGG + Intergenic
1124141972 15:27085172-27085194 CCTCTCCAGCACTTCCTCCAGGG - Intronic
1124823101 15:33067261-33067283 TCTGTGCAGAAGATCCTCAAAGG - Intronic
1125193134 15:37016514-37016536 TCCCTCCAGCAGCTCGAAAAGGG + Intronic
1127371305 15:58344437-58344459 TCCCTCCCGCAGTTCCTCATAGG + Intronic
1128758634 15:70199777-70199799 TTTCCCCAGCAGCTCCCCGATGG + Intergenic
1129158538 15:73733760-73733782 TCTCTCCACCATCTCCTATATGG + Intergenic
1129433651 15:75520199-75520221 TTTCTCCATGAGCTCCTCAAGGG + Intronic
1131330917 15:91498591-91498613 GCTCTCCTGCAACTTCTCAAAGG - Intergenic
1131851909 15:96552695-96552717 TCTCTCCCTCAGTTCCTCATTGG - Intergenic
1132938841 16:2496990-2497012 TTTCTCCAGCAGCTTCTCAGGGG - Exonic
1132948705 16:2547908-2547930 TCTCTGAAGCAGCCCCACAAAGG - Intronic
1132965882 16:2654219-2654241 TCTCTGAAGCAGCCCCACAAAGG + Intergenic
1132998444 16:2836547-2836569 TTCCTCCAGCAGCTCCTCTTAGG - Intronic
1133731943 16:8585530-8585552 CCTCTGCAGCAGGTCCTTAAAGG + Intronic
1134630456 16:15752407-15752429 TCACTCCAGCAGCTCTTCACAGG + Intronic
1134692192 16:16198152-16198174 TCTGTCCAGCGGCTCCAGAAAGG - Exonic
1135168012 16:20157502-20157524 GGCCTCCAGTAGCTCCTCAAAGG + Intergenic
1135172055 16:20193507-20193529 GCTCTGCAGCAGCGCCTTAATGG - Intergenic
1137601670 16:49760406-49760428 CCTCTCCAGCATATCCTCTAGGG + Intronic
1137684290 16:50374986-50375008 ACTCTCCAGCATCACCTCAGTGG - Intergenic
1141854505 16:86671949-86671971 TCCCTCCAGCAGTTCCTCGGGGG + Intergenic
1142732827 17:1873296-1873318 TCTCTGCAGCAGGTCCTAAGAGG + Intronic
1144876811 17:18401337-18401359 TCACTCCTGCACCTCCTCCAAGG + Intergenic
1145155419 17:20543081-20543103 TCACTCCTGCACCTCCTCCAAGG - Intergenic
1147467795 17:40624721-40624743 TCTTTCAAGTGGCTCCTCAAAGG + Intergenic
1148620232 17:49029186-49029208 TCTCTCCATAAGCTCCACAAAGG + Intronic
1151307585 17:73273117-73273139 TCCCTCCAGCACCCCCTCCAGGG - Intergenic
1151578345 17:74963887-74963909 TCCCTGCACCAGCTTCTCAACGG + Exonic
1151808560 17:76422162-76422184 TCTCTCCGGCTTTTCCTCAATGG + Intronic
1151887797 17:76933346-76933368 CCTCTCCAGCAGCCACTCCAGGG + Intronic
1152398267 17:80048539-80048561 TCTCTCCAGCAGCTCCTCAATGG + Intronic
1157134741 18:45042771-45042793 TCTCTCCTGCATCTCCTCGATGG - Intronic
1157619995 18:49011434-49011456 TCTCTGCAGCACCGCCTCCAAGG + Intergenic
1157969170 18:52246517-52246539 TCTGTAAAGCAGCTCCTTAAGGG - Intergenic
1158397826 18:57093422-57093444 TCTCTTCAGGAGCTCGTTAAGGG + Intergenic
1158683266 18:59588812-59588834 CCTCTCAAGCAGCTGCTCAGTGG + Intronic
1159556337 18:69949270-69949292 TTTCTCCATCAGCTCCTCGGCGG - Intronic
1160034424 18:75287320-75287342 CTTCTCCACCAGCTCCTCCATGG - Exonic
1160369197 18:78357184-78357206 GCCCTCCTGCAGCTCCTCAGTGG - Intergenic
1161331376 19:3689332-3689354 TGTCTGCAGCAGCTTCACAAAGG + Intronic
1164888607 19:31804260-31804282 TCCCTCCCCCAGCTCCTCATAGG - Intergenic
1165454751 19:35903985-35904007 TTTCCCCAGCACCTCCTCCAGGG - Intronic
1165466474 19:35977814-35977836 TCTCTCCAGCACCACCTCGAAGG - Intergenic
1166257448 19:41616683-41616705 CCTCTCAAGCATCTCCTCAAGGG + Intronic
1166770304 19:45277915-45277937 TCGCTCCCGCAGCTCCTGCAGGG - Exonic
1166807821 19:45497369-45497391 TCTTTCCACCCCCTCCTCAATGG - Intronic
1167421640 19:49407392-49407414 TCTCTCCAGCTGCACATCCAAGG - Intronic
1167632277 19:50632516-50632538 TGGCTCCAGCAGCTCAGCAAAGG + Exonic
1167734216 19:51282016-51282038 CATCTCCAGCAGCTCCTCCTCGG + Intergenic
1202646334 1_KI270706v1_random:145343-145365 TCTCTCCAGAACCTCCAGAAGGG - Intergenic
926335657 2:11860756-11860778 ACTATTCAGCAGCTCCTCAAAGG + Intergenic
926701271 2:15805531-15805553 TCTCTCCAGCAGCTGATGATGGG + Intergenic
927151516 2:20198949-20198971 TCTTTCCTGCAGCCCCTCAGAGG + Intergenic
927486831 2:23494392-23494414 TTCCACCAGCAGCTCCTCCACGG + Intronic
928108279 2:28486990-28487012 TCTCTCCAGCAGTTCCTTCTTGG - Intronic
928601630 2:32909132-32909154 GTTCACCAGCATCTCCTCAAAGG - Intergenic
929532398 2:42761347-42761369 TCTACCCAGGAACTCCTCAAGGG + Intergenic
929561026 2:42956577-42956599 TCTCCCCATCAGCTCCTAGAGGG + Intergenic
931681280 2:64751442-64751464 CCTCTCCACCAGCTCCTCTCCGG + Intergenic
932042552 2:68317001-68317023 TCTCTCCAGCAGATGCTTGAAGG + Intronic
932105142 2:68935431-68935453 TCCCTGCTGCAGCTCCTCTAAGG + Intergenic
933239993 2:79909646-79909668 GCTCTCCAGCCTCTCCTCCAGGG - Exonic
933641257 2:84762670-84762692 TTTCTCCTTCAGCTCCTCAGAGG - Intronic
933844503 2:86314549-86314571 CCTCTCCAGCCACTCCTTAAAGG + Intronic
934513729 2:94970505-94970527 TCTCTGCACCTGCTCCTCACTGG + Intergenic
935068884 2:99676336-99676358 TCCCTGCAGCAACTCCTCCAAGG + Intronic
935514987 2:104024912-104024934 CCTCTCCAGCAGGTTATCAAGGG + Intergenic
935559971 2:104549608-104549630 TCTCTCCAGTATCAACTCAAAGG + Intergenic
937538172 2:122916578-122916600 TCTCTCCTGAAGTTCCACAAGGG + Intergenic
938079532 2:128362373-128362395 TCTTTCCAGCAGCTCCTGCCTGG - Intergenic
938101788 2:128502565-128502587 TCTCTCCGCCAGTTCCTCATAGG - Intergenic
938159571 2:128973291-128973313 CTTTTCCAGCACCTCCTCAAGGG + Intergenic
938474009 2:131590906-131590928 TTTCACCAGCGGCTTCTCAATGG + Intergenic
938932841 2:136101921-136101943 TCTGAGCAGCACCTCCTCAATGG - Intergenic
943006732 2:182394543-182394565 AGTGTCCAGCAGCCCCTCAAAGG - Intronic
943241435 2:185389595-185389617 TTTCTCCAGAAGGTCCTCAGTGG + Intergenic
947913118 2:233814607-233814629 GCTCTCCATCAGCTGCTCCAGGG - Exonic
948585083 2:239014500-239014522 TCCCTCCAGGAGCTCGTCCATGG - Intergenic
1172189593 20:33053941-33053963 TTGCTCCTGCAGCTCCACAAGGG - Intergenic
1173258252 20:41410527-41410549 TATCTCCTGCAGCTCCTCTTGGG - Intronic
1173499906 20:43545566-43545588 TCTCTCCAGCACCTCCTCGATGG - Intronic
1173574017 20:44098412-44098434 TCTCTCCACCGGTTCCTCAAAGG - Intergenic
1175336836 20:58201844-58201866 ACAGTCCAGCAGTTCCTCAAAGG + Intergenic
1175444359 20:59009880-59009902 TCTCTCCAGCCTCTTCTCATGGG + Intergenic
1175486267 20:59348824-59348846 CCTCTCCAGGAGCTGCCCAAGGG - Intergenic
1176605538 21:8827415-8827437 TCTCTCCAGAACCTCCAGAAGGG + Intergenic
1177718420 21:24871263-24871285 TCTCTGTTGCAGCTGCTCAACGG - Intergenic
1179609738 21:42542392-42542414 CCTCTCCTGCAGGTCATCAACGG + Exonic
1180347835 22:11719020-11719042 TCTCTCCAGAACCTCCAGAAGGG + Intergenic
1180355613 22:11837125-11837147 TCTCTCCAGAACCTCCAGAAGGG + Intergenic
1180382640 22:12155199-12155221 TCTCTCCAGAACCTCCAGAAGGG - Intergenic
1181075525 22:20373560-20373582 CGTCTCCAGCTGCACCTCAAGGG + Intronic
1181867219 22:25868321-25868343 GGTCTCCAGGAGCTCCTCCACGG - Exonic
1182624265 22:31634475-31634497 CCCCACCAGCAGCTCCCCAAGGG + Intronic
1184660933 22:45965204-45965226 TCCCTCCAGCAGGTCCTTCAGGG + Intronic
1184946710 22:47809009-47809031 TCTGTCCAGGAGCTGCTCAGAGG - Intergenic
1185325548 22:50224149-50224171 CCTCTCCAGCTCCTCCTCCAGGG + Exonic
949554436 3:5140986-5141008 TCCCTCCCCCAGCTCCTCATTGG + Intronic
950132326 3:10555688-10555710 TCTCCCCACCAGCCCCACAATGG - Intronic
951509039 3:23480568-23480590 TCTCTGCAGCAGCTGCTGTACGG - Intronic
953514450 3:43576421-43576443 TCTCACCATCACCTTCTCAAGGG - Intronic
954701271 3:52452128-52452150 CATCTCCTGCAGCTCCTCAGGGG + Exonic
954747861 3:52797182-52797204 CCTCTTCAGCAGCTCCTCGTAGG - Exonic
954748885 3:52802782-52802804 CTTCTCCAGCAGCTGCTCAATGG - Exonic
954861598 3:53695173-53695195 CCTCCCCAGCACCTCCTCCACGG - Intronic
954972794 3:54665091-54665113 TTTCTCCAGCAGTGCCCCAAGGG + Intronic
960908169 3:122622252-122622274 TCTCTCCAGGATCTCCTCTGGGG + Intronic
961403567 3:126663784-126663806 TCTTTCCAGCTGCTCCTTACGGG + Intergenic
961404841 3:126671584-126671606 TCTCTCCAGTCACTCATCAAGGG - Intergenic
964426067 3:156555086-156555108 TCTCGCCTGCAGCTCCGCCATGG - Exonic
969203324 4:5622857-5622879 ACGCTCCTGCAGCTCCTCCAGGG + Exonic
969299816 4:6291323-6291345 ATTCTCCAGCAGCTCCGCCACGG - Exonic
972407186 4:38757976-38757998 TCTCTCCTGCAGGCCCTCATGGG - Intergenic
973372561 4:49263487-49263509 TCTCTCCAGAACCTCCAGAAGGG - Intergenic
973388431 4:49531572-49531594 TCTCTCCAGAACCTCCAGAAGGG + Intergenic
974092259 4:57323322-57323344 CCTCTCCAACACCTCCACAATGG + Intergenic
974278449 4:59758963-59758985 CCTCTCCAGGACCTCCTCCAGGG - Intergenic
975465087 4:74699676-74699698 GCTCTGGAGCAGCTTCTCAATGG - Intergenic
975656384 4:76645290-76645312 TCTCTCCAGCCTCTCCCCACCGG + Intronic
976874640 4:89837595-89837617 CTCCTCCAGCAGCTCCCCAAGGG - Intronic
979221682 4:118233935-118233957 TCTCATAAGCAGCTCCTCAGGGG - Intronic
983511357 4:168612488-168612510 TCTGTCCAGCAGCTGAACAATGG + Intronic
983990254 4:174109596-174109618 TCTCTGCAACAGCTCTGCAAGGG + Intergenic
984397672 4:179222221-179222243 TCTCTCCATCCTCTCCACAATGG + Intergenic
985608976 5:876042-876064 TCCCGCCAGCAGCACCCCAAGGG + Intronic
985641235 5:1064381-1064403 TCACTCCGTCAGCTCCTCCAAGG + Intronic
985788750 5:1913934-1913956 TCTCTCCAGGCTCTACTCAATGG - Intergenic
985874906 5:2587115-2587137 TCCCTCCAGCAGCCCCTGAAAGG - Intergenic
985897420 5:2757025-2757047 TCCCTCCAGCAGCTCCTCCGTGG + Intergenic
986392894 5:7301867-7301889 TTTCTCCTTCAGCTCCTCATTGG + Intergenic
992067083 5:73119072-73119094 TCTCTCCAGCAGTTCAGAAAAGG - Intergenic
992279365 5:75158099-75158121 CTTCTCTAGCATCTCCTCAAAGG - Intronic
995784249 5:115811797-115811819 TCTCTCCCACAGCTCCCCAAAGG - Intronic
996730808 5:126715722-126715744 TCTTTCCTGCAGCTTCCCAATGG - Intergenic
997064002 5:130541845-130541867 TCTCTCCCCCAGTTCCTCATTGG + Intergenic
997423146 5:133785177-133785199 TCTCACCAGCATGTCCTCAGTGG - Intergenic
997829118 5:137133913-137133935 TCTGTACAGCAGCACCTCTAGGG + Intronic
998179396 5:139925894-139925916 TCTCCCAAGCAGCTCATCCATGG + Intronic
999026574 5:148239612-148239634 TTACTTCAGCAGCTCCTCAGTGG - Intergenic
999673368 5:153976355-153976377 TCTCTCCATCATCCCCTCCAGGG - Intergenic
1001695878 5:173669434-173669456 CCTCTCCAGGAGCTCCAAAAGGG + Intergenic
1001958701 5:175866616-175866638 TCTGCCCAGCAGCTCCTCAGAGG - Intronic
1001961589 5:175883200-175883222 TCTCTCTGGCAGCTCCTCCCAGG - Exonic
1002603375 5:180368061-180368083 TCCCACCAGCAGCTCCTCTCAGG + Intergenic
1002781436 6:369799-369821 TCTCTCCACCAGCCCCTCCGGGG - Intergenic
1003188824 6:3855232-3855254 TCTCTCCTCCAGTTCCCCAAAGG - Intergenic
1003977721 6:11359623-11359645 TCATGACAGCAGCTCCTCAAGGG + Intronic
1004090053 6:12491959-12491981 CCTCTTCAGCAGCTCCGAAAAGG + Intergenic
1004366134 6:15014208-15014230 CCTCTCCAACACTTCCTCAATGG + Intergenic
1004417055 6:15434393-15434415 TCTCCCCATCAGCTCCTCTAGGG - Intronic
1004763263 6:18694899-18694921 TCTCTCCTGCATATTCTCAATGG - Intergenic
1004892974 6:20119531-20119553 TCTTTAGAGCAGCTCTTCAAAGG - Intronic
1005071528 6:21866539-21866561 TCTCTCTACCAGTTCCTCATGGG + Intergenic
1006437444 6:34033312-34033334 CTTTTCCAACAGCTCCTCAAGGG - Intronic
1006914655 6:37586433-37586455 TCCGACCAGCAGCTCCTGAAGGG - Intergenic
1006980320 6:38142456-38142478 TGTCTTCAGCAGCTCCTGGATGG + Intronic
1007983037 6:46178823-46178845 ATTCTCCAGGAGGTCCTCAATGG + Intergenic
1008690279 6:53971264-53971286 CCTCTCAAGCAGATCCTAAATGG + Intronic
1015040449 6:128711263-128711285 ACTGTCCAGCAGTTCCTCAGAGG - Intergenic
1015234758 6:130958089-130958111 TCACTCCCTTAGCTCCTCAAAGG - Intronic
1020457211 7:8387590-8387612 TCTCTGCAGCAGCTCCTCAGGGG + Intergenic
1021348523 7:19558337-19558359 TCTTTCCAGCAGCTCCTTCAAGG + Intergenic
1022209068 7:28190794-28190816 TCTCTCCATCAGCTGATCATAGG - Intergenic
1023043303 7:36191333-36191355 TCTGTCCAGCTGCTCTGCAAAGG - Intronic
1023105549 7:36760019-36760041 TCTGGCCAGCAGCTGCTCAGGGG + Intergenic
1023920370 7:44624808-44624830 ACCCTCCAGCATCTCCGCAAGGG + Intronic
1023989709 7:45121417-45121439 TCCCTCCAGCAGATCATCATTGG + Intergenic
1024051869 7:45628845-45628867 TTTCTGCAGCAGCTCCTCATGGG + Intronic
1024533561 7:50411774-50411796 TTTCACCCGCAGCTCCTCCAGGG - Intergenic
1024589508 7:50868800-50868822 TGTCTCCATCAGCTTCTCTAGGG - Intergenic
1026796481 7:73369146-73369168 TCCTGGCAGCAGCTCCTCAAAGG + Intergenic
1026947986 7:74328295-74328317 TCTCTCCCGAAGGTGCTCAAAGG - Intronic
1027434693 7:78152333-78152355 TTTTGCCAGCAGCTCCTCACAGG - Intronic
1028222415 7:88213158-88213180 TGACTCCAGCAGCTCCCTAATGG + Intronic
1029055260 7:97733739-97733761 TCTCTGCAGAAGATGCTCAAAGG - Exonic
1029319167 7:99742106-99742128 TCTCTCCAGATGGCCCTCAATGG - Intergenic
1029324132 7:99791076-99791098 TCTCTCCAGATGGCCCTCAATGG - Intergenic
1033150123 7:138907072-138907094 TATCACCATCAGTTCCTCAAGGG - Exonic
1033758254 7:144414806-144414828 TCTCTCCTTCAGCTCCTCTCTGG + Intergenic
1034066839 7:148145142-148145164 TTTCTCCAGCAGAGCCTGAATGG + Intronic
1035049407 7:155990072-155990094 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049416 7:155990101-155990123 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049433 7:155990159-155990181 TCTCCCCAGTTGCTCCTCCAGGG - Intergenic
1035049441 7:155990189-155990211 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049449 7:155990218-155990240 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049457 7:155990246-155990268 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049465 7:155990275-155990297 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049473 7:155990304-155990326 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049481 7:155990333-155990355 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049489 7:155990362-155990384 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049497 7:155990391-155990413 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049505 7:155990419-155990441 TCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049513 7:155990449-155990471 TCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049520 7:155990478-155990500 TCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049798 7:155992215-155992237 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035049807 7:155992244-155992266 CCTCCCCAGCTGCTCCTCCAGGG - Intergenic
1035570359 8:668731-668753 GCGGTCCAGCAGCTCCTCAGCGG + Exonic
1035936116 8:3841838-3841860 TCAAGCTAGCAGCTCCTCAAGGG + Intronic
1036773147 8:11592575-11592597 TCTCTCCAATAGCTCCACGAGGG + Intergenic
1037482497 8:19317244-19317266 TGTTTCTAGCAGCTTCTCAAAGG - Intronic
1037703788 8:21298114-21298136 TCTCCTCTGCAGCTCCTCCAGGG - Intergenic
1041104227 8:54425711-54425733 TCACTCCAGCAGCTTCTCTGTGG - Intergenic
1041427442 8:57738647-57738669 TCTCTCCTGAAGCTCTCCAATGG + Intergenic
1042435012 8:68753935-68753957 CCTCTCCAGCAGCCACTGAAAGG - Intronic
1044031269 8:87240907-87240929 TCTCTCCAGGAGGTTCTCCAGGG + Intronic
1046905100 8:119564244-119564266 TTTCTTCAACAGCTCTTCAATGG - Intronic
1046909578 8:119611264-119611286 TCTTTCTAGCAGTTCCTCGAAGG + Intronic
1049230546 8:141479206-141479228 TCTCCCCAGCTCCTCCCCAAAGG - Intergenic
1049716747 8:144096507-144096529 TCTCTCCAGCACCACCCCATGGG - Intronic
1049741768 8:144244469-144244491 GCTCGTCAGCAGATCCTCAAGGG - Exonic
1053477155 9:38390829-38390851 TTCCTTCAGCTGCTCCTCAAGGG + Intergenic
1054804715 9:69386831-69386853 TCTCTACAGCAGCTTCTAAGTGG + Intronic
1056665273 9:88576693-88576715 CTTCTCCACCAGCCCCTCAAAGG + Intronic
1057576609 9:96247436-96247458 GCCCTGCAGCAGCTCCTCAGAGG + Intronic
1057873215 9:98733498-98733520 TCTCCCCAGCAGCTCTGCAGAGG - Exonic
1061130931 9:128707274-128707296 TTGCTCCAGCAGCTGCTCCAAGG - Exonic
1061638129 9:131928507-131928529 TTCCTCCAGCAGCTGCTAAATGG + Intronic
1061909208 9:133713936-133713958 TCCCTCCGTCAGCTCCTCGAGGG - Intronic
1061935756 9:133856707-133856729 TCTCCCCGGCACCTCCTGAAAGG - Intronic
1062195811 9:135273375-135273397 TCTCTGCAGCCACTCCTCCAGGG + Intergenic
1062316279 9:135968635-135968657 ACTCTCCAGCAGCCCCGGAAAGG + Intergenic
1062390161 9:136330653-136330675 TCTCTTCAGCATCTGCTCAGGGG + Intronic
1203786074 EBV:128302-128324 TTGCTCCACCAGCTTCTCAAAGG - Intergenic
1203552942 Un_KI270743v1:179510-179532 TCTCTCCAGAACCTCCAGAAGGG + Intergenic
1187190609 X:17031540-17031562 TCTCTCCAGTAGCTCCATGAGGG - Intronic
1187299362 X:18032819-18032841 TCTCACCAGCTGCTCCTCTGAGG + Intergenic
1188974291 X:36654730-36654752 TCTCTCCAGCAGTCTTTCAATGG + Intergenic
1191861046 X:65667152-65667174 TGTCCCTAACAGCTCCTCAAAGG - Intronic
1195649805 X:107272865-107272887 TCTCTCCAGCGGCTCCTGGGTGG - Intergenic
1198128275 X:133669028-133669050 TCTCTCCAGGGGCTCTTAAAGGG - Intronic
1199705547 X:150421907-150421929 TCTTTCCAGCAGCCACTGAAGGG + Intronic
1201154211 Y:11115084-11115106 TCTCTCCAGAACCTCCAGAAGGG + Intergenic
1201291998 Y:12429463-12429485 ACTCTTTAGCAGGTCCTCAAAGG + Intergenic