ID: 1152399787

View in Genome Browser
Species Human (GRCh38)
Location 17:80058992-80059014
Sequence GTCGAACACTGAGAGCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152399787_1152399792 2 Left 1152399787 17:80058992-80059014 CCCCGCAGCTCTCAGTGTTCGAC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1152399792 17:80059017-80059039 TCCAGTGAGTGTCCACGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 95
1152399787_1152399796 12 Left 1152399787 17:80058992-80059014 CCCCGCAGCTCTCAGTGTTCGAC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1152399796 17:80059027-80059049 GTCCACGCACAGGGTGCTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 196
1152399787_1152399795 9 Left 1152399787 17:80058992-80059014 CCCCGCAGCTCTCAGTGTTCGAC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1152399795 17:80059024-80059046 AGTGTCCACGCACAGGGTGCTGG 0: 1
1: 0
2: 2
3: 11
4: 146
1152399787_1152399797 13 Left 1152399787 17:80058992-80059014 CCCCGCAGCTCTCAGTGTTCGAC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1152399797 17:80059028-80059050 TCCACGCACAGGGTGCTGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 256
1152399787_1152399794 3 Left 1152399787 17:80058992-80059014 CCCCGCAGCTCTCAGTGTTCGAC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1152399794 17:80059018-80059040 CCAGTGAGTGTCCACGCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152399787 Original CRISPR GTCGAACACTGAGAGCTGCG GGG (reversed) Intronic