ID: 1152399796

View in Genome Browser
Species Human (GRCh38)
Location 17:80059027-80059049
Sequence GTCCACGCACAGGGTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152399788_1152399796 11 Left 1152399788 17:80058993-80059015 CCCGCAGCTCTCAGTGTTCGACC 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1152399796 17:80059027-80059049 GTCCACGCACAGGGTGCTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 196
1152399790_1152399796 -10 Left 1152399790 17:80059014-80059036 CCCTCCAGTGAGTGTCCACGCAC 0: 1
1: 0
2: 0
3: 9
4: 76
Right 1152399796 17:80059027-80059049 GTCCACGCACAGGGTGCTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 196
1152399789_1152399796 10 Left 1152399789 17:80058994-80059016 CCGCAGCTCTCAGTGTTCGACCC 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1152399796 17:80059027-80059049 GTCCACGCACAGGGTGCTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 196
1152399787_1152399796 12 Left 1152399787 17:80058992-80059014 CCCCGCAGCTCTCAGTGTTCGAC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1152399796 17:80059027-80059049 GTCCACGCACAGGGTGCTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152399796 Original CRISPR GTCCACGCACAGGGTGCTGG TGG Intronic