ID: 1152401784

View in Genome Browser
Species Human (GRCh38)
Location 17:80070866-80070888
Sequence CAGGGAATGACCGTGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152401777_1152401784 -10 Left 1152401777 17:80070853-80070875 CCCTTCTTCCCACCAGGGAATGA 0: 1
1: 0
2: 2
3: 19
4: 231
Right 1152401784 17:80070866-80070888 CAGGGAATGACCGTGGCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 149
1152401772_1152401784 27 Left 1152401772 17:80070816-80070838 CCTGTCAGGACTGCTGTGGTAGC 0: 1
1: 0
2: 0
3: 11
4: 212
Right 1152401784 17:80070866-80070888 CAGGGAATGACCGTGGCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 149
1152401775_1152401784 -5 Left 1152401775 17:80070848-80070870 CCTGTCCCTTCTTCCCACCAGGG 0: 1
1: 0
2: 2
3: 49
4: 382
Right 1152401784 17:80070866-80070888 CAGGGAATGACCGTGGCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152401784 Original CRISPR CAGGGAATGACCGTGGCTGT GGG Intronic
901303875 1:8218329-8218351 CTGGGGAGGACCGTGGCTGGTGG + Intergenic
901872289 1:12145163-12145185 CAGGGTCTGTCTGTGGCTGTGGG - Intergenic
904266910 1:29323517-29323539 CAGGGAAGGACCCTGGGTGGTGG + Intronic
904299765 1:29546708-29546730 GAGGGAACCACCTTGGCTGTGGG + Intergenic
907565426 1:55429580-55429602 CAGGAATTGACCTTGGCTTTTGG - Intergenic
907817994 1:57938785-57938807 GAGGGAAGGACAGTGGCTGCAGG - Intronic
912627842 1:111220945-111220967 CAGGGAATGGCCGTGACCATGGG + Intronic
915304942 1:154971675-154971697 CAGGGAAGGAGCCTGGCTGGAGG + Intronic
917261192 1:173172077-173172099 CATGGAAGGACCATGGCTTTGGG + Intergenic
921690839 1:218147845-218147867 AAGGGCATGACCCTGGCTTTTGG + Intergenic
922244495 1:223782375-223782397 CAGAGAAGGAAAGTGGCTGTAGG + Intronic
1063055499 10:2500079-2500101 AAGGGAAAGACCGCGGGTGTTGG - Intergenic
1067563258 10:47318883-47318905 CAGCCAATCACCGTGGCTGGGGG - Intergenic
1067732371 10:48821252-48821274 CAGGAACTGACCCTAGCTGTGGG + Intronic
1070346053 10:75543085-75543107 CAGGGAAGGACCTTGGCTCTAGG - Intronic
1070356164 10:75642472-75642494 CAGTGAATGTCAGTGACTGTTGG + Intronic
1070357752 10:75657282-75657304 CAGGAAATGACAGTGGCATTTGG + Intronic
1072461766 10:95625557-95625579 CTGGTGATGACCGTGGATGTGGG - Intronic
1072760341 10:98051408-98051430 CAGGGAATGCCCGTGAAAGTGGG - Intergenic
1075880311 10:125845559-125845581 GAGGGAATGGCCCTGGCTTTGGG - Intronic
1076163503 10:128263941-128263963 CAGAGAATGATCCCGGCTGTGGG + Intergenic
1081653275 11:44839795-44839817 CAGAGAAGGCCAGTGGCTGTAGG + Intronic
1082030735 11:47601612-47601634 CAGGGAATGAGCCTGGGTATGGG - Intergenic
1084422575 11:69067619-69067641 CAGGGAGGGACCGTGGGGGTCGG + Intronic
1084938173 11:72598369-72598391 CAGGGTATGACAGTGGCAGAGGG + Intronic
1091329291 11:134718142-134718164 CTGGGAATGAGCGTGGCTCCTGG + Intergenic
1091756652 12:3056765-3056787 CATGGATTGACCATGGCTTTGGG - Intergenic
1094736877 12:33244796-33244818 AAGGGAATGATATTGGCTGTGGG - Intergenic
1104219457 12:126767630-126767652 CAGGGGCTGAGCGTGGCTGGCGG + Intergenic
1104412029 12:128566523-128566545 GAGGGAAAGATCCTGGCTGTTGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1107549540 13:41462084-41462106 CAGGGAATGGCTGGGGGTGTGGG - Intronic
1113245072 13:108386302-108386324 CTGGGAATGACCGTGTCTCCTGG - Intergenic
1113380861 13:109804685-109804707 CAGGGAGTGAAGGTGTCTGTGGG - Intergenic
1113615888 13:111680545-111680567 CAGGGCATGAGCCTGTCTGTTGG + Intergenic
1113621356 13:111765438-111765460 CAGGGCATGAGCCTGTCTGTTGG + Intergenic
1119591484 14:75892441-75892463 CAAGTAATGAGCGTGGCTTTAGG - Intronic
1119715379 14:76855275-76855297 CAGAGACTGACCCAGGCTGTGGG + Intronic
1122971072 14:105152459-105152481 CCGGGAATGCCCGTGACAGTGGG - Intronic
1124183137 15:27497071-27497093 CTGAGAGTGACCGTGTCTGTGGG - Intronic
1127774700 15:62255648-62255670 CAGGGGATGAGGGAGGCTGTAGG + Intergenic
1129741304 15:77990950-77990972 TTGGGGATGACAGTGGCTGTGGG - Intronic
1129844360 15:78761449-78761471 TTGGGGATGACAGTGGCTGTGGG + Intronic
1130075892 15:80689859-80689881 CATGGAATGACCGTGGTTATAGG + Intronic
1130910089 15:88264888-88264910 AAGGGAATGAAGGTGGCAGTGGG + Intergenic
1131576978 15:93602090-93602112 CAGGGAATGACTGAGGCTTTTGG - Intergenic
1132631373 16:919282-919304 CAGGGAAGGAACGTGGGGGTTGG + Intronic
1135223769 16:20637726-20637748 CAGGGTATTCCCCTGGCTGTGGG + Intronic
1137389120 16:48066951-48066973 CAGGTGATGACAGTGGCAGTGGG - Intergenic
1137580199 16:49628908-49628930 GAGGGAAGGACTGTGGCTGTGGG + Intronic
1138855719 16:60689091-60689113 CATGGAGTGACAGTGGCTCTGGG + Intergenic
1141140514 16:81494123-81494145 CAGGCAAGGACCGTGCCTGGAGG - Intronic
1141851936 16:86652229-86652251 CAGGGATGGACCCTTGCTGTGGG + Intergenic
1142557533 17:789992-790014 GAGGGAAAGCCCGTGGCTGGGGG + Intronic
1147239382 17:39080552-39080574 CAGGGACTGACTGCAGCTGTTGG + Intronic
1147891930 17:43723364-43723386 CAGGGAATGAGGGTGGGGGTGGG + Intergenic
1148082032 17:44972161-44972183 CCTGGAATGACTGGGGCTGTCGG - Intergenic
1149566536 17:57644409-57644431 CAGAGAAAGACAGTGGCTGGAGG - Intronic
1149684060 17:58525380-58525402 CAGGAAATGCCGGTGGCTGTTGG + Intronic
1152401784 17:80070866-80070888 CAGGGAATGACCGTGGCTGTGGG + Intronic
1152508643 17:80770521-80770543 CTGGGCATGGCGGTGGCTGTCGG + Intronic
1154322573 18:13367144-13367166 CAGGGAAGTCCTGTGGCTGTGGG + Intronic
1155762366 18:29584072-29584094 CAGGGAATGACTATGACTCTGGG - Intergenic
1156719167 18:40049083-40049105 AAGGGAATGGCCCTGGCTGATGG - Intergenic
1157117628 18:44876775-44876797 CAGGGAATGACCACAGGTGTGGG - Intronic
1158580209 18:58674165-58674187 CAGGGAAGAAGCGTGGCTGCTGG + Intronic
1160511578 18:79456175-79456197 CACGGAACCACCGTGGCTTTGGG + Intronic
1161730775 19:5959271-5959293 AAGGGAGTGAGAGTGGCTGTGGG + Intronic
1161771853 19:6235257-6235279 CAGAGGATGAACGTGGCTGGGGG + Intronic
1162839735 19:13347540-13347562 AAGTGAATGAGCATGGCTGTGGG - Intronic
1164986314 19:32651324-32651346 CAAGGAAGGGCCGTGGCTGGAGG + Intronic
1165929514 19:39347479-39347501 CAGAGAATGACTGCGGCTGGGGG - Intronic
1168243682 19:55099354-55099376 CAGGGGGTCACCCTGGCTGTGGG + Intronic
925015893 2:523858-523880 CAGGGAATGACAGTGGTTGTTGG + Intergenic
932132074 2:69196983-69197005 CAGGGAAGGGCGGTGGCTCTAGG - Intronic
933851747 2:86372924-86372946 CTGGGAATTGCCCTGGCTGTGGG + Intergenic
934526685 2:95056422-95056444 CAGGGCCTGGCCGTGGCCGTGGG - Intergenic
934583494 2:95467032-95467054 CGGGGAATGAGTGTTGCTGTGGG - Intergenic
934595958 2:95609682-95609704 CGGGGAATGAGTGTTGCTGTGGG + Intergenic
934786821 2:97015797-97015819 CGGGGAATGAGTGTTGCTGTGGG - Intronic
937856022 2:126672511-126672533 CAGGGAATGAGTGTGAGTGTGGG + Intronic
944120187 2:196232083-196232105 CAGAGAATGACCATGGCTGACGG - Intronic
944672469 2:202006535-202006557 CAGGGCATACCCATGGCTGTGGG - Intergenic
946237872 2:218335897-218335919 CAAGGATTGACCGTGTATGTGGG - Intronic
947014471 2:225602726-225602748 CAGTGAATGATCTTGGCAGTTGG + Intronic
948122678 2:235543036-235543058 GAGGGAATGACTGTGGCTCCCGG - Intronic
948386831 2:237585789-237585811 CAGGAAATGCCCTTGGCTCTGGG - Intronic
1169199567 20:3701671-3701693 CAGGGAATGCCCTTGTCTGAGGG - Intronic
1170942539 20:20860460-20860482 AAGGGAATGACTGTGGCGTTAGG + Intergenic
1173966046 20:47113671-47113693 CTGGGAATGACCTTTGCAGTGGG - Intronic
1175845258 20:62054879-62054901 GAGGGAATGTCGGTGGCTGGTGG - Intronic
1180945678 22:19691809-19691831 CTGGGTGTGAGCGTGGCTGTTGG + Intergenic
1181035946 22:20169788-20169810 AAGGGAAAGACCCTGGCTGGTGG - Intergenic
1181609616 22:24003858-24003880 CAGGGAAGGTCTGAGGCTGTGGG + Intergenic
1182271846 22:29158713-29158735 CAGGGCATGGCTGTGGCTGATGG + Intronic
1185316515 22:50181532-50181554 CAGGGGCTGTCCCTGGCTGTCGG + Intergenic
950866728 3:16195791-16195813 CAGAGGATGACGCTGGCTGTGGG - Exonic
951641443 3:24840441-24840463 CAAGGAATGATGGTTGCTGTGGG + Intergenic
953743763 3:45557644-45557666 CAGGGAATGGCTGGGGCTCTGGG + Intronic
955166773 3:56522482-56522504 CCGGCAATGACCGTGGCAGAGGG + Intergenic
958728796 3:97937958-97937980 CAGGGACTGCCTGTGGCTTTTGG - Intronic
959278166 3:104304313-104304335 CAGGGAATCTCCTTGTCTGTGGG - Intergenic
962810411 3:138954889-138954911 CAGTGAGTGTGCGTGGCTGTGGG - Intergenic
967637187 3:191816556-191816578 CAAGGAATGCCCATGACTGTGGG + Intergenic
968185148 3:196627961-196627983 CCTGGCATGACCATGGCTGTGGG - Intergenic
968657988 4:1786869-1786891 CAGGGAAGGGGCGTGGCTCTGGG - Intergenic
969932472 4:10644135-10644157 CAAGGAATGAATGTGTCTGTTGG + Intronic
972642238 4:40935566-40935588 TAGGGAATGCCCATGGCTGAGGG + Intronic
976604047 4:86965988-86966010 CAGGGAATGAATGTGGTTTTTGG + Intronic
982211011 4:153036386-153036408 CTGGGAGTGACCGTGGCAATGGG + Intergenic
983458602 4:167997616-167997638 CAGGGTGTGAGGGTGGCTGTTGG - Intergenic
988215634 5:28268554-28268576 CAGGGAATGAACTTGACTATGGG - Intergenic
990809295 5:59704283-59704305 CAGGGAATGGCCTGGGCTTTGGG - Intronic
993430513 5:87827033-87827055 CAGAGAATGACACTGGCTGTTGG + Intergenic
994232532 5:97324488-97324510 CAGGAAATGACATTGGCTGGAGG - Intergenic
997352868 5:133243603-133243625 CAGGGCATGTAGGTGGCTGTAGG + Intronic
997386952 5:133481036-133481058 CTGGAAGGGACCGTGGCTGTTGG + Intronic
999150677 5:149424134-149424156 CAGGAAATGTCTCTGGCTGTGGG - Intergenic
1000679926 5:164170928-164170950 CAGTGAATGAAGGTGGATGTGGG + Intergenic
1001798904 5:174526475-174526497 CTGGGAATGGCCATGGCAGTTGG + Intergenic
1002439752 5:179258178-179258200 CTGGGACTGCCCATGGCTGTGGG + Intronic
1006387412 6:33739043-33739065 CTGGGAATGACAGTGCCTCTCGG - Intronic
1006647909 6:35527791-35527813 CAGGGCATGGCCATGGCAGTGGG - Intergenic
1011310392 6:85974295-85974317 CAGGGAATGACTAGGGGTGTGGG - Intergenic
1014402967 6:121013894-121013916 CAGGGAAAGACCGTGTCTCTGGG + Intergenic
1015753960 6:136589395-136589417 CAGGGACTGAGTGTGTCTGTGGG + Intronic
1017511919 6:155122133-155122155 CAGTAGATGACAGTGGCTGTTGG + Intronic
1019295335 7:270822-270844 CTGGGAATGACGGTGGCAGCTGG - Intergenic
1019488925 7:1302052-1302074 CAGGGAATGCCGGTGGCCCTAGG + Intergenic
1020361383 7:7330192-7330214 GTGGGAATGAGCCTGGCTGTTGG + Intergenic
1024668191 7:51566308-51566330 CAAGGAACGAGAGTGGCTGTGGG - Intergenic
1025072307 7:55910862-55910884 GTGAGAATGACCGTGGCTGGAGG - Intronic
1029490678 7:100868413-100868435 GTGGAAATGACCCTGGCTGTGGG - Intronic
1034430817 7:151040416-151040438 CAGGGAGTGGCCATGGCTCTGGG - Intronic
1034800810 7:154054254-154054276 CAGGGAACCAGCGTGGCTGGAGG - Intronic
1035473696 7:159128047-159128069 CAGGGCCTGACCGTGGGTCTCGG + Intronic
1037319082 8:17627133-17627155 CAGTTACTGACTGTGGCTGTGGG + Intronic
1038670727 8:29580935-29580957 CAGGGAAGGAAGCTGGCTGTGGG - Intergenic
1039980967 8:42409780-42409802 CATGGGCTGACCGTGGCTGCAGG + Intergenic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1045108890 8:98920703-98920725 CAGGCAGTGAGCATGGCTGTAGG - Intronic
1045708261 8:104953210-104953232 CAGAAAATGACTGTGTCTGTGGG - Intronic
1046190876 8:110792436-110792458 GAGAGACTGACCATGGCTGTGGG + Intergenic
1046768198 8:118092775-118092797 CAGGGAATGCCCTAGGCTGAAGG + Intronic
1048105337 8:131402548-131402570 TAGGGAAGGACAGTGGCTGAGGG - Intergenic
1048981880 8:139706746-139706768 CAGCCAATCACCGTGGCTCTGGG - Intergenic
1049583644 8:143423389-143423411 CAGGGAGAGCCCGAGGCTGTGGG - Intronic
1049865652 8:144933894-144933916 CAGGGAGTGATCCAGGCTGTGGG - Intronic
1050713650 9:8494796-8494818 AAGGATATGACCGTGGCAGTTGG - Intronic
1053036165 9:34828130-34828152 CTGGGAGGGGCCGTGGCTGTGGG - Intergenic
1053541026 9:38973988-38974010 GAGGTAATGGCCGTGGCTGAGGG - Intergenic
1054625114 9:67389919-67389941 GAGGTAATGGCCGTGGCTGAGGG + Intergenic
1056497503 9:87173712-87173734 CAGGGAATGACCCTGGCTTCTGG + Intergenic
1057310880 9:93942552-93942574 CAGGGAGTGAGTGGGGCTGTGGG - Intergenic
1059268266 9:113056243-113056265 TAGGGAAGGACCGTGGGGGTTGG - Intronic
1059902059 9:118939057-118939079 CAGGGAAAGTCAGTGGCTCTGGG - Intergenic
1060884558 9:127141199-127141221 CAGGGAATGCCAGGGGTTGTGGG + Intronic
1191152082 X:57229961-57229983 CATGGTATGACTATGGCTGTGGG - Intergenic
1198779319 X:140217095-140217117 CACTGAATGGCGGTGGCTGTAGG - Intergenic
1201692767 Y:16787679-16787701 AAGGAAATGACCTTGGATGTGGG - Intergenic