ID: 1152404795

View in Genome Browser
Species Human (GRCh38)
Location 17:80091040-80091062
Sequence CGACTGTGTCAGCCGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152404784_1152404795 2 Left 1152404784 17:80091015-80091037 CCCGGCTCCCCCTCCTCAGCCAG 0: 1
1: 1
2: 12
3: 88
4: 752
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404789_1152404795 -6 Left 1152404789 17:80091023-80091045 CCCCTCCTCAGCCAGGGCGACTG 0: 1
1: 0
2: 3
3: 29
4: 395
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404777_1152404795 20 Left 1152404777 17:80090997-80091019 CCTCCCTGTCCCTTCTTCCCCGG 0: 1
1: 0
2: 3
3: 59
4: 609
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404779_1152404795 17 Left 1152404779 17:80091000-80091022 CCCTGTCCCTTCTTCCCCGGCTC 0: 1
1: 0
2: 3
3: 38
4: 488
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404776_1152404795 30 Left 1152404776 17:80090987-80091009 CCGGGCTGCTCCTCCCTGTCCCT 0: 1
1: 1
2: 8
3: 123
4: 906
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404781_1152404795 11 Left 1152404781 17:80091006-80091028 CCCTTCTTCCCCGGCTCCCCCTC 0: 1
1: 0
2: 9
3: 84
4: 981
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404788_1152404795 -5 Left 1152404788 17:80091022-80091044 CCCCCTCCTCAGCCAGGGCGACT 0: 1
1: 0
2: 3
3: 51
4: 276
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404791_1152404795 -8 Left 1152404791 17:80091025-80091047 CCTCCTCAGCCAGGGCGACTGTG 0: 1
1: 0
2: 1
3: 28
4: 255
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404782_1152404795 10 Left 1152404782 17:80091007-80091029 CCTTCTTCCCCGGCTCCCCCTCC 0: 1
1: 0
2: 12
3: 199
4: 1699
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404790_1152404795 -7 Left 1152404790 17:80091024-80091046 CCCTCCTCAGCCAGGGCGACTGT 0: 1
1: 0
2: 1
3: 12
4: 197
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404785_1152404795 1 Left 1152404785 17:80091016-80091038 CCGGCTCCCCCTCCTCAGCCAGG 0: 1
1: 0
2: 6
3: 107
4: 912
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404783_1152404795 3 Left 1152404783 17:80091014-80091036 CCCCGGCTCCCCCTCCTCAGCCA 0: 1
1: 0
2: 1
3: 91
4: 642
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
1152404780_1152404795 16 Left 1152404780 17:80091001-80091023 CCTGTCCCTTCTTCCCCGGCTCC 0: 1
1: 0
2: 2
3: 64
4: 605
Right 1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152404795 Original CRISPR CGACTGTGTCAGCCGCTGCA GGG Intronic
908250338 1:62260715-62260737 CAACTGTGTCAGATTCTGCAGGG - Intronic
909729712 1:78876310-78876332 GGGCAGTGGCAGCCGCTGCATGG - Intergenic
921742688 1:218704555-218704577 ACACTGTGCCAGCTGCTGCAGGG + Intergenic
922581402 1:226701152-226701174 GGTCTGTGTGAGCCGCAGCAAGG + Intronic
923211797 1:231810245-231810267 CTCCTGTGTCTGCAGCTGCAGGG + Intronic
924560990 1:245156245-245156267 CGCCGGTGTCAGGGGCTGCAAGG - Intronic
1063301092 10:4849410-4849432 TGACTGTGTCACCTGCTGCATGG - Intergenic
1067030524 10:42876572-42876594 CCACCGTGCCAGGCGCTGCATGG - Intergenic
1069994237 10:72332749-72332771 GGACAGTGTCAGCAGCAGCAGGG + Intergenic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1078740283 11:14059739-14059761 TGACTGTGGCAGCGGCTGCTGGG - Intronic
1081757167 11:45552825-45552847 CGGCTGTGTGAGCAGGTGCAGGG + Intergenic
1084032215 11:66487666-66487688 CCACTGTGCCAGGCACTGCACGG - Intronic
1084706654 11:70819818-70819840 TGGCTGTCTCAGCAGCTGCAGGG - Intronic
1093075803 12:14757633-14757655 CGTCTGTGTCACCCTCTGCAAGG + Intergenic
1097592581 12:61590504-61590526 GGGCGGTGGCAGCCGCTGCACGG - Intergenic
1098058579 12:66535596-66535618 AGACTGTGTCAGCAGTTACATGG - Intronic
1104875582 12:132032033-132032055 CGACGGTGTCCGCCTCTACAAGG - Exonic
1112440398 13:99420847-99420869 CCTCTGTGTCAGCAGCTGGAGGG - Intergenic
1128334775 15:66778945-66778967 CGAGTGTGTCAGGCACAGCAAGG - Intronic
1132578538 16:674886-674908 TGACTATGGCAGCCCCTGCAAGG - Intronic
1133002679 16:2858925-2858947 CCACTGTGGCAGCCGCTGGGGGG - Intergenic
1140078543 16:71723648-71723670 CGACTGCCTCAGCCACTGCGCGG + Intronic
1141532635 16:84657448-84657470 CTGCTGCGTCAGCCACTGCAGGG - Exonic
1142122003 16:88391107-88391129 CCACTGTGCCAGCTGCTGCCCGG + Intergenic
1143322120 17:6075199-6075221 CTACTGTGGCAGCTGCAGCAAGG - Intronic
1147609512 17:41793353-41793375 CAGCTGTGTCAGCCTGTGCATGG - Intergenic
1148208390 17:45793660-45793682 TGACTGTGGAAGCTGCTGCAAGG + Intronic
1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG + Intronic
1156391631 18:36656036-36656058 TGCCTGTGTCAGCAGCTGCCTGG - Intronic
1159056511 18:63470990-63471012 CGAGAGTGTCAGCCCCCGCAGGG - Intergenic
1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG + Intronic
1161575171 19:5051027-5051049 CACCTGTGGCAGCCCCTGCAGGG + Intronic
1165720226 19:38073762-38073784 CCACTGTGCCTGCCCCTGCAAGG + Intronic
925159871 2:1676454-1676476 AACCTGTGTCAGCAGCTGCATGG + Intronic
925288322 2:2730217-2730239 CGAGTGTGCCAGCAGCTGGACGG - Intergenic
929004585 2:37382857-37382879 GGGCGGTGGCAGCCGCTGCACGG + Intergenic
929797760 2:45073039-45073061 GGACTGAGTCAGCCGCTGCAGGG + Intergenic
932773582 2:74514607-74514629 CGCCCGTGCCAGCCGCTGCCGGG - Exonic
946281908 2:218671941-218671963 CGTCTGCGTCTGCAGCTGCAGGG - Exonic
1175468711 20:59210469-59210491 AGGCTGTGTCAGCTGCAGCAGGG + Intronic
1176180432 20:63747172-63747194 CGACTGTGCTGGCCGCGGCATGG - Exonic
1184784368 22:46664618-46664640 CCGCTGGGGCAGCCGCTGCAGGG - Intronic
956892210 3:73624123-73624145 CGACTCGCTCAGCCGCTGCGTGG - Exonic
961548738 3:127654461-127654483 CGTCTGTGTGGGCAGCTGCAGGG - Intronic
961573315 3:127816049-127816071 CCACTCTGTCAGTCTCTGCAGGG - Intronic
963320014 3:143801306-143801328 GGGCAGTGGCAGCCGCTGCATGG - Intronic
968625118 4:1623508-1623530 CCACTTGGTCACCCGCTGCAGGG + Intronic
975831361 4:78372626-78372648 GGACTCTGTCTGCAGCTGCAAGG - Intronic
978933599 4:114348273-114348295 GGAATGTGTAAGCCTCTGCAGGG + Intergenic
980153659 4:129079594-129079616 AGACTGTGAAAGCAGCTGCAGGG - Intronic
982633522 4:157863737-157863759 CTAATCTGTGAGCCGCTGCATGG - Intergenic
985957410 5:3275923-3275945 CCGGTGTGTCAGCCCCTGCAGGG + Intergenic
993652066 5:90533999-90534021 GGACTCTGTCAGCCACTGCAAGG + Intronic
993652198 5:90535704-90535726 GGACTTTGTTAGCCACTGCAGGG + Intronic
995045588 5:107643136-107643158 GGACTAAGTCAGCCGGTGCAGGG - Intronic
997183125 5:131853355-131853377 CTGCTATGTAAGCCGCTGCATGG + Intronic
1002332688 5:178455378-178455400 CTGCTGTGTCAGCCGATGCCAGG - Intronic
1004507782 6:16261061-16261083 GGACGGCGGCAGCCGCTGCACGG + Intronic
1005051444 6:21687581-21687603 CGATTGTGTGAGCCTCTGAAGGG - Intergenic
1012323637 6:97885416-97885438 CCTCTGTGACAGCCGCTGGATGG - Intergenic
1024279304 7:47706271-47706293 TGACTGTGACAGCCACTGCAGGG + Intronic
1027269883 7:76513425-76513447 AGCCTGTGTCAGCCCCTGCTGGG + Intronic
1028505958 7:91570384-91570406 GGATTGTGGCAGCCTCTGCAAGG - Intergenic
1034211886 7:149371034-149371056 AGACTGTGTCATCTGGTGCAAGG + Intergenic
1034550067 7:151814840-151814862 CACCTGTGTCAGGCGCTGCTGGG + Intronic
1037652107 8:20848223-20848245 AGACTGTGTCAGACACTGCTGGG + Intergenic
1039704118 8:39989779-39989801 AGACAGTCTCAGTCGCTGCAGGG - Exonic
1042223323 8:66494566-66494588 CCCCTGTGTCAGCCGCTGACAGG + Intronic
1048527814 8:135219995-135220017 CTACTGTGTGAGCTGCTACAAGG - Intergenic
1057036438 9:91814942-91814964 CGACTGTGTCAGCCCTTGTGGGG - Intronic
1186473196 X:9837107-9837129 CCAGTGTGTCAGCTGATGCACGG + Intronic
1190778378 X:53573671-53573693 CGCCTGTGTCAGACACTGCTGGG - Intronic
1196992425 X:121344857-121344879 GGGCAGTGGCAGCCGCTGCATGG + Intergenic