ID: 1152405177

View in Genome Browser
Species Human (GRCh38)
Location 17:80094054-80094076
Sequence GTTGATTTAAAAGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1123
Summary {0: 1, 1: 0, 2: 8, 3: 138, 4: 976}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152405177 Original CRISPR GTTGATTTAAAAGAAAAAAC AGG (reversed) Intronic
900199192 1:1395719-1395741 GTTGATCTATAAGGAAAAGCAGG - Intronic
900546773 1:3233884-3233906 GTTTTTTTAAAAAAAAAAAAAGG + Intronic
900815873 1:4845372-4845394 GCTTTTTTAAAAGAAAAAAATGG - Intergenic
901400711 1:9013630-9013652 GTTGATCTAAACAAAAACACAGG + Exonic
901819354 1:11816843-11816865 ATTCATTTAAAAAAAAAAAAGGG - Intronic
901884318 1:12212090-12212112 TTTTATTTAAAAGATAAAATAGG - Intergenic
902336314 1:15756922-15756944 GTTTATTTAAGAGATAAAAGTGG - Intronic
902427006 1:16331452-16331474 TTTAATTAAAAAGTAAAAACCGG + Intronic
903404334 1:23083818-23083840 GTTCATATAAAAGAGAAAAATGG + Intergenic
904136967 1:28320409-28320431 TTTCATTTAAAAGGAAAAAAAGG + Intergenic
904153536 1:28463192-28463214 CTTTTTTTAAAAAAAAAAACAGG - Intronic
904358567 1:29957615-29957637 GTAGTTTTACGAGAAAAAACAGG - Intergenic
904589006 1:31597946-31597968 GCTGATTAAAAAGAAAAATAAGG + Intergenic
904794511 1:33049205-33049227 TTTGCTTTAGAAGAAACAACTGG - Intronic
905065839 1:35181698-35181720 GTTTCTTTAAATGAAAAAAATGG + Intronic
906453534 1:45973516-45973538 CTTGATTTCAAGGAAAAAATAGG + Intronic
906555479 1:46708944-46708966 GTGGCTTTAAAAAAAAAAAAAGG - Intronic
906637985 1:47422641-47422663 GTTCATTCAAAAGGAAAAAATGG - Intergenic
907234192 1:53029892-53029914 TTTGTTTCAAAAAAAAAAACAGG - Intronic
907531484 1:55102682-55102704 ATAGATTTAAAAAAAAAAACTGG + Intronic
907546109 1:55261248-55261270 GTTTATTTAAGATAAAAATCTGG - Intergenic
907627237 1:56042127-56042149 TTTGTTTTATAAGAAAATACTGG + Intergenic
908232270 1:62117499-62117521 GTTTATTTAAAAAAAAAAAAAGG + Intronic
908857551 1:68447309-68447331 GACTATTTAAATGAAAAAACAGG + Intronic
908869806 1:68596395-68596417 TCTCATTTAAAATAAAAAACTGG + Intergenic
909116476 1:71543654-71543676 TTTGATTTTAGAGAACAAACTGG + Intronic
909188320 1:72518523-72518545 AGTGATTTAAAAGAGAAAAAAGG - Intergenic
909297761 1:73972570-73972592 GTTGCTATAAAGGAAAAAAAAGG + Intergenic
909314587 1:74199438-74199460 AGTGATCTAAAAGAAAAAAAAGG + Intronic
909540608 1:76787543-76787565 GTAAATTTAAAATAAAAACCTGG - Intergenic
909572500 1:77132312-77132334 GCTGATTCAAAAGAAGAAAAAGG - Intronic
909674186 1:78220800-78220822 GAAGATTTAAAAAAAAAATCAGG - Intergenic
909891821 1:81016765-81016787 GTTCATTGAAAAGAAAGAAAAGG - Intergenic
910044424 1:82894415-82894437 TTTGATTAAAAAGAAAAAAATGG + Intergenic
910345015 1:86226732-86226754 GTAGATTTAAAAAAGAAAAAAGG + Intergenic
910540453 1:88350070-88350092 GTTGATTTGAAAGTATAAACAGG + Intergenic
910704619 1:90115082-90115104 GTTTTTTTAAAAAAAAAAAAGGG - Intergenic
910960561 1:92757938-92757960 AATTATTTATAAGAAAAAACTGG + Intronic
911583978 1:99668772-99668794 GGTGATGGACAAGAAAAAACTGG + Intronic
912424814 1:109578052-109578074 GTTGGTTTAAAATTAAACACAGG - Intronic
912767881 1:112432684-112432706 GTAGTATTAAAAGAAGAAACTGG - Intronic
912995424 1:114528305-114528327 TTTGAATTAAAAAAAAAAAAAGG + Intergenic
913041660 1:115032291-115032313 GTTGATTGAAAAAAAAATCCTGG + Intronic
913310595 1:117487547-117487569 GTTGATGTCTAAGAAAAGACTGG + Intronic
913435791 1:118846075-118846097 ATCGATTTAAAAGACAAACCAGG + Intergenic
915422860 1:155799037-155799059 GTTGAGTTAAAAGACAATACAGG - Intronic
915620533 1:157080462-157080484 TTTGTCTTAAAAGAAAAAAGTGG - Intergenic
916272486 1:162958155-162958177 AGTGTTTTAAAAGAAAATACAGG + Intergenic
916945905 1:169727298-169727320 GGTGATTAAAAAGAAAAAGGGGG - Intronic
917042956 1:170826589-170826611 CTTTTTTTAAAAAAAAAAACAGG - Intergenic
917234542 1:172876752-172876774 GTTGATTTTAAAAAAAAAAGTGG - Intergenic
917323801 1:173811428-173811450 CTTGGTTTAAAAGTCAAAACTGG - Intronic
917785772 1:178456082-178456104 GTTAATTTAACAGCAAAATCAGG - Intronic
917834278 1:178928624-178928646 ATTGAGTTAGAAGAAAAACCTGG + Intergenic
918108903 1:181438512-181438534 GATGATTTAAAAAAATAAAAAGG - Intronic
918834200 1:189439157-189439179 CTTGATTAAAAATACAAAACTGG - Intergenic
918857905 1:189782157-189782179 TTTTATTTGAAAGAAAAAAAGGG - Intergenic
919716631 1:200785059-200785081 GTTGATTTCAAATATTAAACTGG + Intronic
919966256 1:202528826-202528848 ATACATTTGAAAGAAAAAACAGG - Intronic
920072124 1:203309729-203309751 GGTGGTATAAAAGAAAAATCTGG + Intergenic
921534496 1:216329541-216329563 GTTGAAGGTAAAGAAAAAACGGG - Intronic
921565239 1:216709687-216709709 GCTGATTTAAAAAAAAAAATTGG + Intronic
921576558 1:216841891-216841913 GATGATTTACAAAAAAAAAGAGG + Intronic
922602269 1:226865575-226865597 GCTGATTGAAAGAAAAAAACTGG - Intergenic
923098802 1:230796023-230796045 CTTGATTAAAAAAAAAAAAAAGG + Intronic
923758048 1:236811816-236811838 GTTGATTAGAAAGAAAATACTGG + Intronic
924069098 1:240257070-240257092 GCAGATTTAAAACAAAACACTGG + Intronic
924118208 1:240768630-240768652 CTTGATTTATAAGAAAAACCCGG - Intergenic
924168160 1:241306916-241306938 TGTGATTTGAAAGAAAATACTGG - Intronic
924286487 1:242493273-242493295 GACTATTAAAAAGAAAAAACTGG + Intronic
924403084 1:243710473-243710495 TTTGGTTTAAAAGAATAAATTGG - Intronic
924716996 1:246584856-246584878 CTTGATTTAAAAAAGAAAACTGG - Intronic
924872403 1:248063037-248063059 GTAGAATAAAAAGAAAAAACTGG - Intronic
924927117 1:248693773-248693795 GCTCATTTAAAAAAAAAAAAAGG + Intergenic
1063327486 10:5118932-5118954 ATTTCTTTAAAAAAAAAAACAGG + Intronic
1063640314 10:7823328-7823350 GATGATTAAAAAAAAAAAAAAGG + Intronic
1063815151 10:9762959-9762981 GTGGATTAAAAATAAAGAACAGG - Intergenic
1063904985 10:10772096-10772118 TTTGATTTAGAGGAAAAAAAAGG + Intergenic
1064234504 10:13561694-13561716 GATTAAATAAAAGAAAAAACAGG + Intergenic
1064393377 10:14960056-14960078 GTTCATTTGAAAGACAAAAGCGG - Intronic
1064534080 10:16341005-16341027 GTTAACTTCAAAGTAAAAACAGG + Intergenic
1064581838 10:16801090-16801112 TTTTTTTTAAAAAAAAAAACAGG + Intronic
1064611927 10:17112963-17112985 TTTGATTAAAAATAAAAACCAGG + Intronic
1064897829 10:20259203-20259225 TTTCATTAAAAAGAAAAAAAAGG - Intronic
1065093224 10:22254441-22254463 ATTAAATTAAAAGAAAAACCTGG - Intergenic
1065111430 10:22444128-22444150 GTTGACTGAAAAACAAAAACTGG - Intronic
1065292010 10:24240038-24240060 CATGGTTTAAAAGAAAATACTGG + Intronic
1065410257 10:25418506-25418528 GTTGTTTTAGAAGAACACACTGG - Intronic
1065454213 10:25890415-25890437 GCTGATTAAAAAAAAAAAAAGGG + Intergenic
1065648872 10:27866408-27866430 GTAAATTCAAAAGCAAAAACAGG + Intronic
1065671352 10:28121805-28121827 ATTTATTTAAAAAAAAAAAAAGG + Intronic
1065982342 10:30912353-30912375 GTTGATATAAAAGAAGAGAAAGG - Intronic
1066021283 10:31305671-31305693 GATAATTTCAAAGACAAAACTGG + Intergenic
1066348916 10:34618555-34618577 ATTCATTTTAAAAAAAAAACTGG + Intronic
1066432147 10:35362575-35362597 GGAGAATTAAAAAAAAAAACTGG - Intronic
1066586384 10:36941523-36941545 ATTTATTTAAAAAAAAAAAAAGG + Intergenic
1067373870 10:45709644-45709666 ATTTATTTAAAAGAAATAAGTGG - Intergenic
1067818653 10:49506081-49506103 GATAATGTACAAGAAAAAACAGG + Intronic
1067881701 10:50051397-50051419 ATTTATTTAAAAGAAATAAGTGG - Intergenic
1068054237 10:51991378-51991400 GTATATTTAAAAAAAAAATCTGG - Intronic
1068110195 10:52671311-52671333 ATTGTTTTAAAAGAGAAAACTGG - Intergenic
1068127646 10:52861286-52861308 GTTCTCTGAAAAGAAAAAACTGG + Intergenic
1068436726 10:57002129-57002151 TTTGATTTAAAACAATAAAAAGG - Intergenic
1068537787 10:58259313-58259335 AATGCTTTGAAAGAAAAAACAGG + Intronic
1068605222 10:58997902-58997924 GTTTATTTAAAAAATAAAACAGG + Intergenic
1068823515 10:61406982-61407004 CTTGAATTACAAGAAAAAAAGGG - Exonic
1069100072 10:64309241-64309263 GGTGGTTTAAAAAATAAAACAGG - Intergenic
1069278590 10:66625009-66625031 ATTTATTGAAAAGAAAAACCTGG + Intronic
1069297843 10:66869288-66869310 GTTAATTTAAAAGAACAATCAGG + Intronic
1069313401 10:67067679-67067701 GGTGATTCAAAATAAGAAACTGG + Intronic
1069448074 10:68492462-68492484 GTTTAGTTTAAAAAAAAAACAGG + Intronic
1069655223 10:70082982-70083004 CTTGATTAAAAAAAAAAAAAAGG - Intronic
1069998705 10:72359965-72359987 TTTGATCTAAGGGAAAAAACTGG + Intergenic
1070209609 10:74302420-74302442 GTCCATTTGAAAGCAAAAACAGG - Intronic
1071021346 10:81060808-81060830 CTAGACTTAAAAGAAAAAAATGG - Intergenic
1071215978 10:83401790-83401812 GTTGTTTAAAAAGAAAAATAAGG + Intergenic
1071309607 10:84329641-84329663 GATGCTTTAAAAAAAACAACTGG - Intronic
1071840172 10:89462316-89462338 GCAGATTTAAAAGAAAAGACAGG + Intronic
1073710748 10:106036775-106036797 GTTGATTAAAGAGAAAAACAAGG - Intergenic
1073748640 10:106498852-106498874 TTTGATTTAAAAAAAAAAAATGG + Intergenic
1073981306 10:109156844-109156866 ATTCAGTTAAAAGAAAAAGCTGG - Intergenic
1074556108 10:114491948-114491970 GATGATTTAGAAGAAAAGAGAGG + Intronic
1075051896 10:119188531-119188553 GATAAGATAAAAGAAAAAACTGG - Intergenic
1075051944 10:119188849-119188871 TTAGCTTTAAAAGAAAAAACTGG - Intergenic
1075452555 10:122562201-122562223 GATGACATAAAAGAAAAAAAAGG - Intronic
1076165944 10:128282924-128282946 GTTAACTTAAAAAAAAAAAAAGG + Intergenic
1076901784 10:133342820-133342842 GTTAATTTAAAATATACAACAGG + Intronic
1077277695 11:1722931-1722953 GTTTTTTTAAAAGAAAAAAATGG + Intergenic
1077483505 11:2827616-2827638 GTTGATTAAAAAAAAAAAGTGGG + Intronic
1077657173 11:4030471-4030493 GTTTATGTAAAAGCAAAAATGGG - Intronic
1077717433 11:4595770-4595792 GTTGCTTAAAAACAAAAAGCTGG - Intergenic
1077777538 11:5288132-5288154 TTTATTTTAAAAGAAATAACAGG - Intronic
1078313885 11:10275009-10275031 TATGAATTAAAAGTAAAAACTGG + Intronic
1078393872 11:10961312-10961334 GTTTTTTTAAAAGATAAAATTGG + Intergenic
1078782780 11:14455112-14455134 GTTGTTTTATAAGAAGAAAAAGG - Intronic
1078810877 11:14761684-14761706 CTTGATTTAAAAATGAAAACTGG - Intronic
1078992253 11:16661494-16661516 TTTTTTTTAAAAGAAAAAACAGG - Intronic
1079022253 11:16918765-16918787 GTCTATTTAAAGGAAAAAAGTGG - Intronic
1079226234 11:18607707-18607729 GCTCATTTAAAAGAAAAAAAAGG - Exonic
1079548733 11:21668430-21668452 TTTTAATTAAAAGAAAGAACTGG - Intergenic
1079745060 11:24116180-24116202 TTTTATTTAAAAAAAAAAATCGG + Intergenic
1079779157 11:24576776-24576798 GTTGATATCAAAGGAAAAAGTGG + Intronic
1079944255 11:26721903-26721925 GTTGACTTCAAAGAAGAATCTGG + Exonic
1080064400 11:27993534-27993556 GTTGCTTTATAAGAAAAAAATGG + Intergenic
1080071301 11:28091540-28091562 ATTGATGTAAAAAAAAAAAATGG + Intronic
1080576869 11:33607872-33607894 ATTGATTTAAAAAAAATAACTGG + Intronic
1080841316 11:35985842-35985864 ATTTATTTAAAAAAAAAAAAAGG - Intronic
1081080509 11:38733912-38733934 GGAGATCTAAAAGAAAAAACTGG - Intergenic
1081234825 11:40634989-40635011 GGAAATTTAAAAAAAAAAACAGG + Intronic
1082052870 11:47787086-47787108 CTTAATTTAAAAAAAAAAAGAGG - Intronic
1082618335 11:55390111-55390133 GTTGCTTTCAAACATAAAACTGG - Intergenic
1082621857 11:55432818-55432840 CCTGGTTTCAAAGAAAAAACTGG - Intergenic
1082624650 11:55468349-55468371 GCTGATTTCAAAGATAAAAATGG - Intergenic
1082830456 11:57613164-57613186 GTTGAATGAAAATAAAAAAGAGG - Intronic
1083116702 11:60467163-60467185 CTTGATTTAAAAAAAAAAATTGG + Intronic
1083529397 11:63405227-63405249 GTTCATTTAAAGGAAGCAACAGG + Intronic
1083714198 11:64566473-64566495 TTTTTTTTAAAAAAAAAAACTGG - Intronic
1084379890 11:68805142-68805164 ATTGATTTGAGAGAAAAAATTGG + Intronic
1084781285 11:71411084-71411106 GTTGATTTAAAACAAAACAAAGG - Intergenic
1085150547 11:74249543-74249565 GCTGATCTAACAGAAAGAACAGG + Intronic
1085216061 11:74833437-74833459 GTTCATTTCAAAGGATAAACAGG - Intronic
1085420106 11:76350083-76350105 CTTGATTTATAAGCAAAACCTGG - Exonic
1085617389 11:78011447-78011469 AATGATTTAAAAAAAAAAAAAGG + Intergenic
1085694296 11:78690765-78690787 GTTGATTTAAAAGATGACTCAGG - Intronic
1086279927 11:85173184-85173206 GTTGAAATGAAAGAAAAAAATGG + Intronic
1086760716 11:90626916-90626938 GTTTATTAAAAAGAAGAAAAAGG - Intergenic
1087152193 11:94869137-94869159 CTAGATTTAAAAAAAAAAAAAGG + Intronic
1087758127 11:102075935-102075957 GATGTTTGAAAAGACAAAACAGG - Exonic
1087880780 11:103413774-103413796 ATTGATTTAAGGGAAAAAAGGGG + Intronic
1087948927 11:104196048-104196070 GTTCATTAAAAATAATAAACTGG - Intergenic
1088458256 11:110055348-110055370 ATTAATTTAAAAGACAATACTGG + Intergenic
1089044796 11:115491263-115491285 GATGAATTAAAAGAAAAAAAAGG + Intronic
1089307137 11:117533774-117533796 GCTGATTTAAAGGAGAAAACTGG + Intronic
1089543015 11:119201993-119202015 GTTAACATAAAGGAAAAAACTGG + Intergenic
1089928355 11:122282705-122282727 GTTGAATTAAAGCAATAAACTGG + Intergenic
1090053016 11:123397101-123397123 GTTCAATTAAAAAACAAAACAGG + Intergenic
1090904007 11:131057937-131057959 GTTAATTTATAAGGAAAAAGAGG + Intergenic
1092076986 12:5682020-5682042 CTTGATTAAAGAGAAGAAACTGG - Intronic
1092653465 12:10659952-10659974 GTTGATTTACAGGAATAAGCAGG - Intronic
1092807003 12:12233531-12233553 GTTGACTTAATTGAAAAGACTGG - Intronic
1093206801 12:16260755-16260777 AGTGATCTAAAAAAAAAAACGGG - Intronic
1093515013 12:19975210-19975232 ATTAATTTAAAAGAAACAATGGG - Intergenic
1093516764 12:19996703-19996725 GTTGAAATAAAAGAGAAAAAAGG - Intergenic
1093596738 12:20971619-20971641 ATTTATTTAAAAAAAAAAAAAGG - Intergenic
1093791825 12:23260456-23260478 GTTATTTAAAAAGGAAAAACAGG + Intergenic
1093809069 12:23470847-23470869 ATTTGTTTAAAAGAAAAAAAGGG - Intergenic
1093863157 12:24192728-24192750 GTTCATTTAGAATGAAAAACTGG - Intergenic
1093917512 12:24822162-24822184 GTTGCTTTAAAAGAAGAAAAAGG + Intronic
1094059103 12:26294496-26294518 GTTGATTTAAAAAAAAATTGTGG + Intronic
1094073995 12:26452242-26452264 TTTGGTTTAAAAAAAAAAACTGG - Intronic
1094126621 12:27030604-27030626 GCTGATTTAAATCTAAAAACTGG + Intronic
1094231911 12:28115312-28115334 GGTTATTTAAAAGACAAATCAGG - Intergenic
1094351082 12:29525583-29525605 CTAGATTTAAAAAAAAAAAAAGG - Intronic
1094574522 12:31672589-31672611 CTTGTTTAAAAAAAAAAAACAGG + Exonic
1095556043 12:43506229-43506251 CAGGATTTAAAAAAAAAAACTGG - Intronic
1095561247 12:43568674-43568696 GTTGATTTATAAGAAAAACCTGG - Intergenic
1096278455 12:50230875-50230897 GGTGCATTATAAGAAAAAACTGG - Intronic
1096328144 12:50684489-50684511 GTGGATTTATAAGAAGAAATTGG + Intronic
1096934155 12:55252622-55252644 GTTGAATTAAAAGAGAAATTTGG - Intergenic
1097381483 12:58900284-58900306 GTTGATCAAAAAAAAAAAAAAGG - Intronic
1097755757 12:63405190-63405212 CTTGATTTAAAAGTTATAACTGG + Intergenic
1098424801 12:70350000-70350022 GTTAAATTAAAAAAAAAAATAGG - Intronic
1098861626 12:75717252-75717274 CTGGAATTAAAAGAATAAACTGG + Intergenic
1099035100 12:77577445-77577467 CTTGGTATAACAGAAAAAACTGG + Intergenic
1099080062 12:78166855-78166877 GTGGCTTTAAATGAAAAAATTGG - Intronic
1099182796 12:79486867-79486889 GTTGAATTAGAAGGAAAAGCAGG - Intergenic
1099286388 12:80717672-80717694 GTTGCTTTAAAAGAAGAGAGGGG + Intronic
1099440599 12:82694778-82694800 TTTAAGTTAAAAAAAAAAACTGG + Intronic
1099454421 12:82846755-82846777 GTTGAATGAAAAGAGAATACAGG - Intronic
1099563615 12:84211479-84211501 GTTCAGTTAAAAGGAAAAAAAGG - Intergenic
1099709518 12:86204243-86204265 GTTGAGATATAAGAAAAAAATGG + Intronic
1099778748 12:87166941-87166963 GTTTATTTAAAAAAAAAAGTGGG + Intergenic
1099902963 12:88735268-88735290 GCTTAATTTAAAGAAAAAACAGG - Intergenic
1100021188 12:90071238-90071260 GGTAATTTATAAGAAAAAAGAGG - Intergenic
1100222755 12:92523814-92523836 GATGATTGAAAGGAAAAAAGGGG + Intergenic
1100262579 12:92947007-92947029 GTTATTTTAAAAGGAAAAATGGG + Intergenic
1100689268 12:97022305-97022327 TTTAATTTGAAAGAACAAACAGG + Intergenic
1100860138 12:98796292-98796314 TTTCAATTAAAAGAATAAACAGG + Intronic
1100953633 12:99881248-99881270 GATGATATAAGAGAAAAACCTGG - Intronic
1101626746 12:106451325-106451347 GTTGATTTAAAAGAAAATTGAGG + Intronic
1102325405 12:111978095-111978117 GTAGATTAAAAAAAAAAAAAAGG + Intronic
1102571383 12:113829002-113829024 GTCTATTTAAAAAAAAAAAAAGG - Intronic
1102734283 12:115144332-115144354 TTTCTTCTAAAAGAAAAAACTGG - Intergenic
1102740613 12:115204300-115204322 GTTAAGTTAAAACAAAAAGCAGG + Intergenic
1102819180 12:115893554-115893576 CTTCCTTTAAAAAAAAAAACTGG - Intergenic
1102993685 12:117332562-117332584 ATTTATTTAAAAAAAAAATCAGG + Intronic
1103026372 12:117577551-117577573 GGTGATTTATAAAGAAAAACAGG + Intronic
1103260338 12:119582719-119582741 GCTGATTTATAAAGAAAAACAGG - Intergenic
1103309435 12:119992683-119992705 TTTGATTTAATTGAAAATACAGG - Intronic
1103389172 12:120558280-120558302 TTTTATTTAAAAGAAAATATAGG + Intronic
1103420560 12:120778535-120778557 GGTGACTATAAAGAAAAAACAGG - Intronic
1103743387 12:123106403-123106425 ATTCCTTTAAAAAAAAAAACAGG + Intronic
1104431570 12:128720667-128720689 AATGACTTAAAAGAAAAAACTGG + Intergenic
1105054711 12:133087734-133087756 GTTGCTTAAGAAGAAATAACAGG - Intronic
1105374847 13:19834276-19834298 TTTTTTTTAAAAGAAAAAATAGG - Intronic
1105510476 13:21047697-21047719 GTGGATTAAAAAAAAAAAAAAGG + Intronic
1106011787 13:25831133-25831155 GTACATTTAGAAGAAAAAGCAGG - Intronic
1106107365 13:26744634-26744656 ATGGACTTAAAAAAAAAAACAGG - Intergenic
1106173257 13:27307445-27307467 ATTGATTAAAAAAAAAAATCCGG + Intergenic
1106205582 13:27590528-27590550 CTTGCCTTAAAAAAAAAAACCGG - Intronic
1106318395 13:28615615-28615637 TCTGATTTAAAAAAGAAAACAGG + Intergenic
1106451825 13:29889076-29889098 CTTGATTTAAAAGAAAATGCTGG + Intergenic
1106491492 13:30227890-30227912 TATGATTTAAAAGAAATAAGAGG - Intronic
1106750413 13:32759212-32759234 TTTGCTTTAAAAGCAAAAAGAGG - Intronic
1107022929 13:35770104-35770126 GATGATTAAAAATAAAAGACTGG + Intronic
1107223212 13:38012096-38012118 GCTGATTTGAAAGAGAAAAGGGG + Intergenic
1107468546 13:40669753-40669775 TTTGAATTAAAAGAACAAATAGG + Intergenic
1107515062 13:41121043-41121065 GCTTATTTAAAAGAATAAAAAGG + Intergenic
1107839605 13:44442614-44442636 GTTGAATAAAAAGAACAAATCGG + Intronic
1108393172 13:49968047-49968069 TTTTATTTAAAAAAAAAAATTGG - Intergenic
1108451013 13:50562817-50562839 GTGGATTAAAAAAAAAAATCTGG + Intronic
1108707210 13:53000430-53000452 ATTTATTTAAAAAAAAAAAAAGG - Intergenic
1109116331 13:58391190-58391212 CTTGATTAAAAACAAAAATCAGG - Intergenic
1109231912 13:59767484-59767506 TTGGACTTAAAAAAAAAAACTGG - Intronic
1109489550 13:63077997-63078019 GTTGATTTAAAAAAATATACTGG + Intergenic
1109686394 13:65826187-65826209 TTTGCTTTAAAAGAAATATCTGG + Intergenic
1109786578 13:67183397-67183419 ATAGATTCAAAAGAAAAGACAGG - Intronic
1109961240 13:69634884-69634906 GTTTTTTTAAAAGATAAAATTGG - Intergenic
1109966604 13:69707086-69707108 GTTCAATTAAAAGAATAAACAGG - Intronic
1110051659 13:70909632-70909654 GTTCATTTAAAGAAAAAAATGGG - Intergenic
1110201335 13:72853052-72853074 GGAGATTTAAAAAAAAAAATAGG + Intronic
1110316370 13:74112788-74112810 GTTGATTTAAAGTAAGAGACAGG - Intronic
1110365026 13:74673280-74673302 GGTGACTTAAAACAATAAACAGG + Intergenic
1110703176 13:78573363-78573385 TTTGATTAAAAAGATATAACTGG + Intergenic
1110995620 13:82104403-82104425 GTATATTTATGAGAAAAAACTGG - Intergenic
1111062907 13:83046529-83046551 GTTTATTAAAAAAAAAATACAGG + Intergenic
1111079144 13:83279323-83279345 GTTGGTTTACAGGAATAAACAGG - Intergenic
1111252026 13:85613788-85613810 ATTGATTTAAAAAAAAAACCAGG + Intergenic
1111534350 13:89582706-89582728 ATAGATTTAAAATAAAAAAATGG - Intergenic
1111618443 13:90692406-90692428 TTTGTTTTAAAAGAACATACAGG + Intergenic
1111738088 13:92167568-92167590 ATGGTTTTAAAAGAAACAACAGG + Intronic
1112381566 13:98895804-98895826 TATGATTTAAAAGTAAAAATAGG + Intronic
1112443525 13:99443403-99443425 TTTGTTTTAAAAGAAAAAAAGGG - Intergenic
1112688776 13:101864625-101864647 GTTGATTTTAAAAATAAACCAGG - Intronic
1113003669 13:105674447-105674469 GCTTATTTCATAGAAAAAACTGG - Intergenic
1113092101 13:106627084-106627106 GTGGATTTGGAAGAACAAACGGG + Intergenic
1113152805 13:107283443-107283465 GCTGAGTTAAAAAAAAAAATTGG + Intronic
1113173028 13:107527864-107527886 GGTAATTTAAAAGGAAAAAGAGG - Intronic
1114570679 14:23665362-23665384 GTTTTTTTAAAAAAAAAAACTGG - Intergenic
1114729815 14:24980449-24980471 GTTGAATTACATGGAAAAACTGG - Intronic
1114995099 14:28339527-28339549 ATTGATATTAAAGAAAAAAAGGG - Intergenic
1115209846 14:30955830-30955852 ATTGCTGTAAAAGAAAAAAAAGG + Intronic
1115286402 14:31717772-31717794 GTTTGTTTAAAAAAAAAAAATGG + Intronic
1115454346 14:33584394-33584416 GTTTATTTAAAAAAAAAAAGGGG + Intronic
1115544519 14:34453877-34453899 GTTCTTTTAAAAAAAAAAAGAGG + Intronic
1115619166 14:35123630-35123652 GAAGATTTAAAAGAAAACACCGG + Exonic
1115767341 14:36636942-36636964 TTTTATATAAAAGAAATAACTGG - Intergenic
1116031812 14:39582765-39582787 ATAGATTTAAAAAAAAAAACAGG - Intergenic
1116193512 14:41690202-41690224 GTATAATTAAAAGAAAAAAAAGG + Intronic
1116484016 14:45425010-45425032 TTTGTTTTAAAAAAAAAATCTGG - Intergenic
1116607359 14:47018158-47018180 GTTTCTTTAAAAAAAAGAACGGG - Intronic
1116977806 14:51134984-51135006 GTTAATTTAAAAAAAAAGGCCGG - Intergenic
1117012058 14:51481244-51481266 ATTTATTTAAAAGAAAAAAGAGG + Intergenic
1117094808 14:52286032-52286054 AATGATTTTAAAGAAAAAATGGG + Intergenic
1117105540 14:52394257-52394279 CTTGATTTAAAAAATAAATCTGG + Intergenic
1117299502 14:54410451-54410473 TTTGGTTTAAAATAAATAACTGG - Intronic
1117686108 14:58255184-58255206 GTGTATTTAAAAAAAAAAAACGG - Intronic
1117872494 14:60215931-60215953 GTTGATTGAAAAAACAAAACTGG - Intergenic
1117929916 14:60830797-60830819 TGTGATTTAAAAAAAAAAAAAGG - Intronic
1118111495 14:62725855-62725877 ATTCATTAAGAAGAAAAAACTGG + Intronic
1118382818 14:65231391-65231413 TTTGATTTAAAAGAATACAATGG + Intergenic
1118392784 14:65309616-65309638 ATTAATTTAAAAAAAAAAAAAGG - Intergenic
1118559144 14:67059284-67059306 GTTAATTAAAAACAAAATACTGG - Intronic
1118763484 14:68894824-68894846 GTTGATGAACAAGACAAAACAGG + Intronic
1118773548 14:68958513-68958535 TTTCAATTAAAAAAAAAAACAGG + Intronic
1118999258 14:70866343-70866365 GTTGATTCACAGGAATAAACAGG + Intergenic
1119112591 14:71988964-71988986 GTTTTTTTAAAATAAAAAACAGG + Intronic
1119469123 14:74882519-74882541 GTGTACTTAAAAGAAAAAGCTGG + Intronic
1119471136 14:74900121-74900143 CATGGTTTAAAAGAAAAAAAAGG - Intronic
1119768238 14:77204243-77204265 TTTGATTTAAAAAAAAAATGTGG - Intronic
1119807548 14:77491999-77492021 CTTTATTTAAAAAAAAAAAAAGG - Intronic
1120424838 14:84334126-84334148 GTTGATTTAAAAAAAATAAAAGG + Intergenic
1120572155 14:86133260-86133282 GTTGAATTAAAAGAGAAAAGAGG - Intergenic
1120711181 14:87794690-87794712 GTTTACTTAAAATAAAAAAGTGG - Intergenic
1120855051 14:89205144-89205166 TTTGATTTAAAAAAAAAAAAAGG + Intronic
1120999454 14:90440977-90440999 GATGATGAAAAAGAAAAAAATGG - Intergenic
1121118891 14:91363678-91363700 GTTCATTTAAATTTAAAAACTGG - Intronic
1121186962 14:91981692-91981714 ATTGAGTTAAAAGACAAAGCAGG - Intronic
1121805333 14:96815362-96815384 GTTATTTAAAAAGAGAAAACAGG + Intronic
1121807742 14:96846206-96846228 CTTGGCTTAAAACAAAAAACTGG - Intronic
1121926966 14:97936096-97936118 GTAGTTTTAAAGGTAAAAACTGG - Intronic
1122456923 14:101861025-101861047 GATAATTTAATTGAAAAAACAGG - Intronic
1122515549 14:102305718-102305740 GTTGAATTAAAAAGAAAAACTGG - Intergenic
1122526398 14:102388391-102388413 GTTAATTTAAAAAAACAAGCTGG + Intronic
1124636661 15:31369537-31369559 CTTTGTTTAAAAGAAAAAAGAGG - Intronic
1124640669 15:31394112-31394134 GTTAAGTTAAAGGAAAAAAAAGG + Intronic
1124906526 15:33873615-33873637 GTTGATGTAAGAGAAAAAACTGG - Intronic
1125056980 15:35371879-35371901 GATGAAATAAAAGAAAAAAAAGG + Exonic
1126614294 15:50561028-50561050 TTCTATTTAAAAAAAAAAACTGG + Exonic
1126898754 15:53288920-53288942 TTTGATTAAAAATAAAAAACAGG - Intergenic
1127457467 15:59168092-59168114 TTTCATTTACAAGAAAAAATAGG - Intronic
1127511727 15:59648632-59648654 AAGGATTTAAAACAAAAAACAGG + Intronic
1127862853 15:63008873-63008895 ACTGAGTTAAAAGAAGAAACAGG + Intergenic
1127923890 15:63519063-63519085 GCTGATTGAAAAGAAAGACCCGG - Intronic
1128134184 15:65250501-65250523 GTTTATTTTACAGAAGAAACAGG - Intronic
1128602166 15:69005189-69005211 GTTGATTTAACATGAAAATCTGG + Intronic
1129973480 15:79801325-79801347 CTTCTTTTAAAAGAAAAAATTGG + Intergenic
1130119070 15:81031252-81031274 ATTGATATGAAAGAAGAAACAGG + Intronic
1131173038 15:90191877-90191899 GCTGATTTGAAAGAATACACAGG + Intronic
1131731926 15:95290970-95290992 CTTGCTTTAAAAGAAAGCACAGG + Intergenic
1131784641 15:95898869-95898891 GTTGATTTGTAAGGAAAACCCGG - Intergenic
1132068486 15:98753229-98753251 CTTTATTTAAAAAAAAAAAAAGG - Intronic
1132130104 15:99268984-99269006 GATTTTTCAAAAGAAAAAACAGG - Intronic
1132524906 16:409468-409490 TGTGATTTAAAAAAAAAAATCGG - Intronic
1133294462 16:4744525-4744547 GTTGACTTAAAAAAAAAATAGGG - Intronic
1133490055 16:6259450-6259472 GTTTATTTAAAAGAAGAAAGTGG - Intronic
1133571345 16:7043260-7043282 TGTGATAGAAAAGAAAAAACAGG - Intronic
1133721996 16:8503270-8503292 GTGGAATTAAAAGATAAAAATGG + Intergenic
1134478117 16:14593693-14593715 GTTTTTTTAAAAGTAAAATCTGG + Intronic
1134540535 16:15061015-15061037 ATGGATTTAAAAGACAAAAATGG - Exonic
1135064009 16:19294147-19294169 GTTTATTTAAAAAAAAAAAGAGG + Intronic
1135362768 16:21829313-21829335 GTAGATATTAAATAAAAAACAGG + Intergenic
1135487712 16:22880432-22880454 GTTAAATTAAAATTAAAAACTGG + Intronic
1136066692 16:27763817-27763839 GGTAATTTACAAGAAAAAAATGG - Intronic
1136156444 16:28385919-28385941 ATTACTATAAAAGAAAAAACTGG + Intronic
1136206642 16:28729365-28729387 ATTACTATAAAAGAAAAAACTGG - Intronic
1136286324 16:29245391-29245413 ATTGATTTAAAAAAAAAGGCTGG - Intergenic
1136306619 16:29376336-29376358 GTAGATATTAAATAAAAAACAGG + Intergenic
1136352150 16:29717745-29717767 CTTGATTTACAGGAATAAACAGG - Intergenic
1136427733 16:30180455-30180477 TTTCAATTAAAAGAAAAAAAAGG - Intergenic
1136685441 16:31991559-31991581 GCTGATTTAAAAGAAGAATGAGG - Intergenic
1136786053 16:32935089-32935111 GCTGATTTAAAAGAAGAATGAGG - Intergenic
1136883722 16:33918714-33918736 GTTGATTTAAAAGAAGAATGAGG + Intergenic
1137260933 16:46829921-46829943 CTTGATTTAAAAAAAAAAAAAGG + Intronic
1137310010 16:47245830-47245852 CTTCATTTAAAAAAAAAAAAAGG - Intronic
1137979479 16:53057343-53057365 GCTCATTTAAAAAAAAAAAGAGG + Intronic
1138395187 16:56698574-56698596 ATTCATTTAAAAAACAAAACAGG + Intronic
1138484790 16:57332303-57332325 TTTTTTTTTAAAGAAAAAACAGG + Intergenic
1138751014 16:59420973-59420995 GTAGATTTAAAAAAAAAATGTGG - Intergenic
1138972012 16:62156385-62156407 GTTAATTTACAAGAAATATCTGG + Intergenic
1139302029 16:65953648-65953670 TTTGCTTTAAAAAAAAAAAATGG - Intergenic
1139903307 16:70345022-70345044 GTTGATTAAAAATCAAAAAAAGG - Intronic
1139929120 16:70511063-70511085 GTTAATTAAAAACAAAATACAGG - Intronic
1140028002 16:71309093-71309115 GTTAATTAAAAAAAAAAAAAAGG - Intergenic
1140088103 16:71814215-71814237 GTTGTTTTAAAAACAAAAATTGG - Intergenic
1140091570 16:71843420-71843442 GTCCATTAAAAAGTAAAAACAGG - Intergenic
1140205580 16:72929915-72929937 GTTCACTTAAAAAAGAAAACAGG + Intronic
1140568717 16:76076180-76076202 GTTTATTTAAAAGGAAACAAAGG - Intergenic
1141276289 16:82591256-82591278 ATTGATTTATAAGAAAAAAAGGG - Intergenic
1141493667 16:84391912-84391934 TTTGTTTTAAAAAAAAAAAGAGG - Intronic
1142091675 16:88215688-88215710 ATTGATTTAAAAAAAAAGGCTGG - Intergenic
1203088286 16_KI270728v1_random:1196747-1196769 GTTGATTTAAAAGAAGAATGAGG - Intergenic
1142584531 17:963175-963197 CTTGATTTAAAAAAAAAAAAAGG + Intronic
1143612445 17:8026785-8026807 TTTAATTTAAAAAAAAAAAAAGG - Intergenic
1144285228 17:13767799-13767821 TTTTAATTAAAAGAAAAAATTGG + Intergenic
1144363112 17:14515556-14515578 GTTGATTGAAAAGAATATATTGG + Intergenic
1144394698 17:14832849-14832871 GTTGCTTTAAAAGAAAAAGCAGG - Intergenic
1144505341 17:15824914-15824936 AATGTTTTAAAAGAAAACACAGG - Intergenic
1144542878 17:16161595-16161617 GTTAATGTAAAAGAACAAACAGG - Intronic
1144753429 17:17665742-17665764 GATGATTTAAAGAAAAAAAGGGG + Intergenic
1145192382 17:20854741-20854763 TTTTAATTAAAAGAAATAACAGG + Intronic
1145301589 17:21644675-21644697 TTTAATGTAAAAGAACAAACAGG + Intergenic
1145327904 17:21847257-21847279 TTTAATGTAAAAGAACAAACAGG + Intergenic
1145348716 17:22058640-22058662 GTTAAAGTAAAAGAACAAACAGG - Intergenic
1145927101 17:28656268-28656290 TTTTATTTAAAAGAAGAAAAAGG - Intronic
1146140182 17:30360568-30360590 TTTTTTTTTAAAGAAAAAACTGG + Intergenic
1146767366 17:35535487-35535509 GTTGCTTTAAAAAAAAAAAAAGG - Intronic
1146784831 17:35710665-35710687 ATTGATATAAAAGAAGAAAATGG - Intronic
1147146387 17:38487234-38487256 GCTGATTTAAAAGAAGAATGAGG - Intronic
1147289325 17:39429017-39429039 ATTGATTTAAAAAAAAAAAAAGG + Intronic
1147532702 17:41294730-41294752 GCTGATTAAAAAAAAAAAAAAGG + Intergenic
1148573520 17:48690347-48690369 GTTTAATTAAAAGACAAACCAGG - Intergenic
1149136616 17:53373740-53373762 ATTAATTGAAAAGAAAAAAATGG + Intergenic
1149432645 17:56606596-56606618 TTAATTTTAAAAGAAAAAACTGG - Intergenic
1149590313 17:57824366-57824388 CTTCATTCAAAAGAAAAAAGGGG + Intergenic
1149908333 17:60547212-60547234 TTTGATTAAAAAAAAAATACTGG - Intergenic
1150604417 17:66678658-66678680 GTTGACTGAAAAAAAAAAAAAGG + Intronic
1150705340 17:67481770-67481792 GAAGATTTAAAAAAAAAAAAAGG + Intronic
1151045383 17:70914275-70914297 GGTGATTTATAAAGAAAAACAGG + Intergenic
1151511832 17:74565542-74565564 TGTGAATTAAAAGAAAAATCTGG + Intergenic
1151722930 17:75868437-75868459 ATTGCTTTAATATAAAAAACAGG - Intergenic
1152174511 17:78778800-78778822 GTTTGTTTAAAAGAAAACAATGG + Intronic
1152182301 17:78830924-78830946 TGTCATTTAAAAGAAAATACAGG + Intronic
1152405177 17:80094054-80094076 GTTGATTTAAAAGAAAAAACAGG - Intronic
1152514130 17:80812337-80812359 ATTCAATTAAAAAAAAAAACAGG - Intronic
1203192535 17_KI270729v1_random:203485-203507 TTTTATGTAAAAGAACAAACAGG + Intergenic
1203201900 17_KI270730v1_random:2920-2942 TTTTATGTAAAAGAACAAACAGG + Intergenic
1153166762 18:2270298-2270320 GAAGAGTGAAAAGAAAAAACCGG + Intergenic
1154953800 18:21235398-21235420 GATGATTTAAAAGAAAGCATGGG - Intergenic
1155051630 18:22152986-22153008 TCTGATTTAAAAGTGAAAACAGG - Intergenic
1155412756 18:25564345-25564367 ATTGAGTTAAAAGAAAATGCTGG + Intergenic
1155453994 18:25991533-25991555 GTGGATTCAAAAGAAAAAGATGG + Intergenic
1155469710 18:26178307-26178329 GTATATTTAAAAGAAAAAGTTGG + Intronic
1155907059 18:31464487-31464509 ATTGATTAAAAACAAGAAACTGG + Intronic
1156082770 18:33358524-33358546 GCTGATTTATAAGAAATGACTGG + Intronic
1156704950 18:39869368-39869390 TTTTATTTAAAATAAAAAAATGG + Intergenic
1156901606 18:42307113-42307135 GTTCATTTAAATGAAATAATTGG + Intergenic
1156974705 18:43206436-43206458 TATGATTTAAATGAGAAAACAGG - Intergenic
1157029420 18:43887366-43887388 TTCCATTTAAAAGAAAATACTGG - Intergenic
1157037634 18:43994924-43994946 GATGATTAAAAAAAAAAAACTGG + Intergenic
1157160530 18:45309978-45310000 GTTGAGTGAAAAAAAAAATCAGG - Intronic
1157322858 18:46647455-46647477 TTTGTTTTAAAAGGAAAAGCTGG + Intronic
1157342925 18:46795365-46795387 GTTATTTTTAAAGTAAAAACTGG + Intergenic
1157347527 18:46853274-46853296 TTTTATTTAAAAAAAAAAAAAGG - Intronic
1157407484 18:47434704-47434726 GTTGAATTATATGAAAATACAGG + Intergenic
1157637768 18:49177859-49177881 GTTTATTTAAAAGGAAAATGAGG - Intronic
1158106738 18:53893987-53894009 GTTGCTTTGAAAGAACAATCAGG + Intergenic
1158149544 18:54352367-54352389 GTTCTTTGAAAAGAAAAAAATGG - Intronic
1158280146 18:55815922-55815944 GTTGCTTTAAAATAAGAAAGAGG + Intergenic
1158534859 18:58298606-58298628 GTTTATTTTAAAGGAAAAAAGGG - Intronic
1158655904 18:59333344-59333366 CATCATTTAAAAAAAAAAACAGG + Intronic
1159347897 18:67230982-67231004 ATTTATTTAAAACAAAAAACTGG + Intergenic
1159406705 18:68012343-68012365 GTTGATTTATAAGATAGAAAAGG - Intergenic
1159511067 18:69399573-69399595 TTTTATTTAAAAAAAAAAAAAGG + Intergenic
1159571762 18:70122250-70122272 ATTTCTTTAAAAAAAAAAACTGG + Intronic
1159643463 18:70889706-70889728 CTTTATTTAAAAAAAAAAATGGG - Intergenic
1159820796 18:73140476-73140498 TTTAAATTTAAAGAAAAAACTGG + Intergenic
1160002910 18:75044334-75044356 TTTTTTTTAAAAAAAAAAACAGG + Intronic
1160523726 18:79523431-79523453 GATGATCAAAAAGAAGAAACTGG + Intronic
1161818134 19:6512798-6512820 TTTTATTTAAAAAAAAAAAAAGG - Intergenic
1162298750 19:9831559-9831581 TTTAATTTAAAAAATAAAACAGG - Intergenic
1162477733 19:10911189-10911211 TTTGATTCAAAAGAGAAAACAGG - Intronic
1162865245 19:13540999-13541021 GTTAATTTAATAGACAAAAATGG - Intronic
1163023985 19:14498944-14498966 GTTCCTTTAAAAGAAAAAAGAGG + Intergenic
1163805300 19:19392993-19393015 GCCAATTTAAAAGAATAAACTGG - Intronic
1164498078 19:28787505-28787527 GTTGAATTAAAAAAAAAAACTGG + Intergenic
1164666938 19:30046064-30046086 TTTGATTTAAAAGACATAGCAGG - Intergenic
1164967820 19:32500883-32500905 TTTTATTAAAAAGAAAAAATGGG - Intergenic
1165046727 19:33110645-33110667 TTTGCTTTAAAAAAAAAAAACGG + Intronic
1165351718 19:35279370-35279392 GTAGATTTTTAACAAAAAACGGG + Exonic
1165619231 19:37230629-37230651 GTTGATTTATAAAAATAAAAGGG - Intronic
1166389956 19:42403328-42403350 CTTGATCTAGAAGAAAAAATAGG - Intronic
1167115841 19:47488610-47488632 GTAGCTTTAAAAAAAAAAAAAGG + Intronic
1167457767 19:49606619-49606641 GATGGTATAAAAGAAAAAAATGG - Intronic
1167913567 19:52722734-52722756 CCTGTTTTAAAAGAAAAAAAGGG - Intronic
1168392052 19:56017224-56017246 GTTCTTTTCAAAGAACAAACTGG + Intronic
1168626684 19:57923977-57923999 ATTGATTCAAAAGAAAAATGTGG + Intronic
925004659 2:432222-432244 GTTTAGTGAAAAGATAAAACTGG + Intergenic
925220279 2:2133877-2133899 GATGCTTTAAGAGAAAAAAAAGG + Intronic
925471750 2:4169771-4169793 TTTGATTTAAAGGAATAAGCAGG + Intergenic
926063440 2:9819444-9819466 GTCTCTTTAAAAAAAAAAACTGG - Intergenic
926169452 2:10542906-10542928 GTGGATTTAAAAGAGAAACCTGG + Intergenic
926327613 2:11798769-11798791 GTTGACTAAAAAAAAAAAAAAGG + Intronic
926635783 2:15177686-15177708 TTGGATTTATAAGAAAAAACTGG + Intronic
926677211 2:15635925-15635947 GATACTTTAAAAGAAAATACCGG + Intergenic
927083326 2:19651509-19651531 GTTCAGTTTAAAAAAAAAACTGG - Intergenic
927761905 2:25764617-25764639 GTTTATATTAAACAAAAAACTGG - Intronic
927950157 2:27162309-27162331 GTTGATCCAAAGGAAAAAAATGG - Intergenic
928303179 2:30145218-30145240 GTTGAGTGAAAAAAAAAAGCAGG + Intergenic
928978746 2:37116909-37116931 GTTCATTCAAAAGAAAAAGTGGG + Intronic
929036376 2:37696138-37696160 CTTGATTTATAAGCAAAACCTGG - Intronic
929130540 2:38565387-38565409 TTTTAGTTAAAAGAAAAAAAAGG - Intronic
929138127 2:38643891-38643913 GTTGAGATAAAAGAGAAAACAGG - Intergenic
929180110 2:39029323-39029345 GTTTATTTAAAATTAAAAATTGG + Intronic
929485864 2:42353644-42353666 GCTCATTTAGAAGAAAAAAATGG - Intronic
929706580 2:44219197-44219219 TTGGATTTAAAAAAAAAAAAAGG - Intronic
929925792 2:46207183-46207205 GTTTATTAAAAAGAGAAAAATGG - Intergenic
930015693 2:46969200-46969222 TTTGTTTTAAAAAAAAAATCTGG + Intronic
930300846 2:49613629-49613651 ATTGATTAAAAAAAAAAAAAAGG - Intergenic
930455093 2:51598101-51598123 GTTTATTTTAAAAAAAAATCAGG - Intergenic
930794341 2:55372039-55372061 ATTTATTTAAAAGAAAAAAAAGG - Intronic
931017995 2:58008323-58008345 GTTCATATTATAGAAAAAACAGG + Intronic
931076410 2:58718415-58718437 GTTGTTTCAAAAGAAAAAAAAGG - Intergenic
931109500 2:59095445-59095467 ATGGATTTAAAAGCAAAAATAGG + Intergenic
931330446 2:61275615-61275637 GTTCATTTAAAAAAAAAAAAGGG - Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932061029 2:68497580-68497602 ATTTATTTAAAAAAAAAAAAAGG - Intronic
932077193 2:68675989-68676011 TTTTTTTTAAAAAAAAAAACAGG + Intergenic
932121797 2:69107581-69107603 CTTGGTTTAAAAAAAAAAACTGG + Intronic
932207492 2:69895858-69895880 GTTAATAAAAAAGAAACAACAGG - Intronic
932793774 2:74677881-74677903 CTAGATATGAAAGAAAAAACTGG + Intronic
932873478 2:75426866-75426888 GTTGAATTAAAAAAAAAAAAAGG + Intergenic
933143438 2:78822020-78822042 ATTGACTTAAAAGAAAACATTGG + Intergenic
933450091 2:82438098-82438120 TTTGATTAAAAAAGAAAAACCGG + Intergenic
933512277 2:83255957-83255979 GATGCTTTAAAAAAAAAATCAGG - Intergenic
934525465 2:95049116-95049138 GTATATTTAAAAGCAAAAAAGGG - Intronic
934901680 2:98164838-98164860 TTTGGTTTATAAGAAAAAAAGGG - Intronic
934934673 2:98456219-98456241 AATGATTAAAAAGAAAAAAAGGG + Intronic
935072443 2:99706729-99706751 GCTGCTTTAAAACAAAAAATCGG - Intronic
935282317 2:101528802-101528824 GCTGATTGAAAGGAAAAATCTGG - Intergenic
935497209 2:103795448-103795470 GTTAATTTATAAGGAAAAAGAGG + Intergenic
935528908 2:104208341-104208363 GTTGAATTCAAAGAAACAAATGG + Intergenic
935977113 2:108589177-108589199 GCTGTTTAAAAAAAAAAAACTGG + Intronic
936048637 2:109205871-109205893 GTTGGTTTCTATGAAAAAACAGG - Intronic
936411684 2:112264048-112264070 TTTGAGTTATAAGAAAAAAATGG + Intergenic
937051041 2:118890014-118890036 TTAGAAGTAAAAGAAAAAACAGG + Intergenic
937250519 2:120520932-120520954 GTTTCTTTAAAAAAAAAAAAAGG + Intergenic
937535176 2:122877514-122877536 AATGATTTGAAAGAAAAAATTGG - Intergenic
937782150 2:125850815-125850837 AATGATTTAAATGTAAAAACAGG - Intergenic
938163002 2:129003545-129003567 GTTGATTAAAAAAAGAAAACAGG - Intergenic
938278786 2:130050509-130050531 GGTGACCTAAATGAAAAAACAGG - Intergenic
938329760 2:130441368-130441390 GGTGACCTAAATGAAAAAACAGG - Intergenic
938360186 2:130680135-130680157 GGTGACCTAAATGAAAAAACAGG + Intergenic
938436589 2:131286843-131286865 GGTGACCTAAATGAAAAAACAGG + Intronic
938818466 2:134929171-134929193 GTTAATTTAAAAGTAGAATCAGG - Intronic
939034475 2:137114138-137114160 GATTGTTTAAAAGAAAAAAGAGG - Intronic
939053969 2:137339875-137339897 TCTGATTTAAAAAAAAAAAAAGG - Intronic
939290348 2:140186282-140186304 TTTAATTTAAAAAAAAAATCTGG + Intergenic
939732550 2:145802728-145802750 ATTACTTTAAAAGAAAATACTGG + Intergenic
939788263 2:146542474-146542496 GTTTATTAAAAATAAAAAGCAGG + Intergenic
939838909 2:147163690-147163712 GTTCATTTAAAAAAAAATTCTGG + Intergenic
940028473 2:149234774-149234796 GACTATTTAAAAGCAAAAACAGG + Intergenic
940256467 2:151735927-151735949 GTTGAATTAAAAAATAATACAGG + Intergenic
940432149 2:153605098-153605120 GTTGTTTTAAAGGAAAGCACAGG + Intergenic
940481600 2:154240270-154240292 ATTGCTTGAAAAGAAAAATCTGG + Intronic
940578116 2:155540840-155540862 ATTGAGTTAAAAGAACAAAAGGG - Intergenic
940613881 2:156026337-156026359 GTTGATTTTTAAGAAAATAGAGG + Intergenic
941270173 2:163416128-163416150 ACTGAATTAAAAGAAGAAACAGG + Intergenic
941428324 2:165379400-165379422 GTTAACTTGAAAGAAAAAGCAGG + Intronic
941688750 2:168476208-168476230 GGTGATTAAAAAAAAAAAAGAGG - Intronic
941732420 2:168933165-168933187 ATTTTTTTAAAAGAAAAAGCAGG + Intronic
941832338 2:169976105-169976127 ATGGATTTAAAAAAAAAAAGTGG - Intronic
941995459 2:171597576-171597598 GATGATCCAAAAGAAAAAATAGG - Intergenic
942080600 2:172396327-172396349 GTTGTTTTTAGAGAAAAAATAGG + Intergenic
942369233 2:175264268-175264290 TTTGATTAAAAAGAAAAACAAGG + Intergenic
942893164 2:181017058-181017080 TTTGATTTAAAAGAGAAAACTGG + Intronic
943057715 2:183003976-183003998 GTTGATTTTAAAAGAAAAATTGG - Intronic
943764277 2:191644075-191644097 GTTTATCTTAAAGAATAAACAGG + Intergenic
943936847 2:193929482-193929504 ATTTAATTAAAAAAAAAAACTGG - Intergenic
944004697 2:194890479-194890501 GTTGGTTTTAAAGAACAAATAGG - Intergenic
944501052 2:200360583-200360605 GTTCATTTGAAAGAATAAACAGG - Intronic
944540133 2:200746613-200746635 TTGATTTTAAAAGAAAAAACTGG - Intergenic
944606666 2:201357800-201357822 CTTTATTTAAAAAAAAAAATCGG - Intergenic
944759970 2:202804664-202804686 CTTGATTTAACAGATATAACCGG + Intronic
944815041 2:203367322-203367344 TTTGTTTTAAAAAAAAAAAAAGG - Intronic
944820070 2:203421057-203421079 GTTGGATTAAAAAAAAAATCTGG + Intronic
944913569 2:204334145-204334167 TTTTATTTAAAAAAAAAAAAAGG + Intergenic
944941115 2:204628275-204628297 GTTAATTAAAAAAAAAAAACGGG - Intronic
944969391 2:204974967-204974989 GTTGACTTAAAATAAATTACTGG + Intronic
945055816 2:205868023-205868045 GTTGATTGAAATGAAAAGACTGG + Intergenic
945181410 2:207095346-207095368 GTTGTTTTAAGAACAAAAACAGG - Intronic
945331058 2:208539839-208539861 GATAATTTAAAAAAAAAAACAGG - Intronic
945704760 2:213215510-213215532 GTTTATTAAGAACAAAAAACAGG + Intergenic
945957134 2:216096779-216096801 GCTGATTTATACGCAAAAACTGG + Intronic
947322629 2:228938962-228938984 GATCAGTTAAAAGAAAAAAAAGG + Intronic
947374007 2:229476768-229476790 GTTGATTTAAAAACAGAAGCAGG + Intronic
947429508 2:230013739-230013761 GTTGATTGAAAAGATGAAAAAGG - Intergenic
948057760 2:235021650-235021672 GTTTATTTGGAAGAAAAAAAAGG + Intronic
948338376 2:237229381-237229403 ATTTATTTAAAAAAAAATACAGG - Intergenic
948448942 2:238057065-238057087 TTTTATTTAAAAAAAAAAATAGG - Intronic
948734953 2:239996808-239996830 GATGAGTTAAAAAAAAAAAAAGG - Intronic
948925551 2:241094550-241094572 TTTTATTTAAAAGAAAAATAAGG - Exonic
1168801565 20:646611-646633 TTTAATTTAAAAAAAAAAAGGGG - Exonic
1169067134 20:2700386-2700408 CTTAATTTAAAAGAAAGAAAGGG - Intronic
1169419782 20:5450686-5450708 GTTGATTTAAAGAAAACTACTGG + Intergenic
1169522778 20:6391016-6391038 GTTAATGTAAAAGAATAGACAGG + Intergenic
1169525202 20:6416947-6416969 TTTGCTTTAAAAAAAAAAAAAGG - Intergenic
1170045318 20:12079274-12079296 GTAGATATAAGAGAAAAAAATGG - Intergenic
1170173015 20:13436342-13436364 GTTGTTTTAAAAAAAAAAAAAGG + Intronic
1170417063 20:16155993-16156015 CTTTCTTTAAAAGAAAAAAGTGG + Intergenic
1170441981 20:16388624-16388646 TCTGATTTAAAAAAAAAAATAGG - Intronic
1170829953 20:19831350-19831372 GTGCATTTAAAAGAAAAACTTGG - Intergenic
1171440095 20:25153173-25153195 GGTGATTTAAAAAATAAAAAAGG - Intergenic
1171518174 20:25756065-25756087 GTTAATGTAAAAGAACAAACAGG + Intergenic
1171558687 20:26100137-26100159 GTTAATGTAAAAGAACAAACAGG - Intergenic
1173394520 20:42666507-42666529 GTTGATCTGAAAGAAAATACAGG - Intronic
1173968047 20:47128820-47128842 ATTCATTTAAAATAAAAAAATGG + Intronic
1174002561 20:47385527-47385549 TTTAATTTAAAAAAAAAAAAAGG - Intergenic
1174527202 20:51182505-51182527 GTTGGTTTACAAGAAAAAAATGG - Intergenic
1174540262 20:51283834-51283856 GTTCATGTAAATGAAAAACCAGG + Intergenic
1174747091 20:53073751-53073773 GTCAAGTTAAAAAAAAAAACTGG + Intronic
1175093869 20:56526640-56526662 TTGGATTTAAAAAAAAAAAAAGG + Intergenic
1175348353 20:58299631-58299653 GTAGATGCAAAAGAAAAAAATGG + Intergenic
1176511139 21:7749074-7749096 CTTGATTAAAAAGAAAAAGTAGG + Intronic
1176652330 21:9562471-9562493 GTTAATGTAAAAGAACAAACAGG + Intergenic
1177001856 21:15622980-15623002 GTTGATATAAAAGTAAAAAGAGG - Intergenic
1177003369 21:15640617-15640639 GATGATTAAAAATTAAAAACAGG - Intergenic
1177299233 21:19219238-19219260 TATCATTTAAAAGACAAAACTGG - Intergenic
1177326121 21:19591176-19591198 GTTGATCAAAGAGAAAAAAAAGG - Intergenic
1177404692 21:20650064-20650086 CATGATTAAAAAGAAAAAAGTGG + Intergenic
1177432262 21:21005369-21005391 GTTTATTTAACAGAAAAAAAAGG + Intronic
1177582632 21:23046618-23046640 GTTCATTTAAAAAATAAAACTGG + Intergenic
1177800798 21:25826651-25826673 GTTTTTTTAAAAAAAAAAAAAGG - Intergenic
1178645253 21:34379603-34379625 CTTGATTAAAAAGAAAAAGTAGG + Intronic
1178735557 21:35146558-35146580 GTTGCTTTACAAAAAAAAAGGGG - Intronic
1178801248 21:35797847-35797869 GTTGATTGAAAAAATAAAAGTGG - Intronic
1178842053 21:36145638-36145660 GCTGATTAAAAACAAAAAAGTGG - Intronic
1179151797 21:38815627-38815649 GTTGAGTTAAAAAAGAAAAGAGG + Intronic
1179417727 21:41211813-41211835 GTTGCATTAAAGGGAAAAACTGG - Intronic
1181289195 22:21778026-21778048 TTTAATTTAAAAAAAAAAAGTGG + Intronic
1181711234 22:24691564-24691586 GTTTGTTAAAAAGAAAAAAAAGG + Intergenic
1181742084 22:24929281-24929303 GATGGTTTAAAAAAAAAAATTGG - Intergenic
1182202033 22:28582995-28583017 CTTGATTAAAAAGAAATACCAGG + Intronic
1182233946 22:28860943-28860965 CATGATTTAAAAAAAAAAAAAGG - Intergenic
1182397885 22:30049689-30049711 CTTGATTGAAAAGAAACAGCCGG + Intergenic
1183221852 22:36519584-36519606 TATGGCTTAAAAGAAAAAACTGG - Intronic
1183790962 22:40068883-40068905 ATGGATTTAAAAGAAAAATCTGG - Intronic
1183804657 22:40197910-40197932 GTTGCTTAAAAAGAAAAAATGGG - Intronic
1184888000 22:47358527-47358549 GACTATTTAAAAGAAAACACAGG - Intergenic
1185217761 22:49612453-49612475 CTAGATTTAAATGGAAAAACTGG - Intronic
949255442 3:2039693-2039715 ATTGATTTGAAAGAAGGAACTGG + Intergenic
949300189 3:2574836-2574858 GTAGATTGAAAAAAAAAGACTGG - Intronic
949897210 3:8776822-8776844 TTTCATTTAAAAAAAAAAAAAGG + Intronic
950308222 3:11933009-11933031 GATTATTAAAAAAAAAAAACTGG + Intergenic
950458972 3:13109790-13109812 ATTTATTTAAAAAAAAAAAAAGG - Intergenic
950824225 3:15799747-15799769 GTTGACTTAGAACAAGAAACAGG - Intronic
950842620 3:15982120-15982142 GTTTATATAAAGAAAAAAACTGG - Intergenic
950981515 3:17312114-17312136 GTTGATATAAAGGAAAACTCAGG - Intronic
951521637 3:23615940-23615962 GTTCATTAAAAACAAAAAACAGG - Intergenic
951581638 3:24170953-24170975 GAAGATATAAAAGAACAAACTGG - Intronic
952002891 3:28807768-28807790 GTTAATTTAAAAAAAAAAAGCGG - Intergenic
952232966 3:31450770-31450792 TTAGATTTAAAAGAAAAGACAGG + Intergenic
952502243 3:33974510-33974532 TATGGTATAAAAGAAAAAACGGG + Intergenic
952926319 3:38322615-38322637 GTTAATTAAAAAAAAAAAACTGG + Intergenic
953187305 3:40650448-40650470 ATTGATTTCAAAGAAAGATCTGG - Intergenic
953527640 3:43707106-43707128 GGAAAATTAAAAGAAAAAACCGG - Intronic
953576930 3:44120258-44120280 GGTGATGTACAAGAAGAAACAGG - Intergenic
954064773 3:48097236-48097258 CTTCATTTAAAAAAAAAAATAGG + Intergenic
954470331 3:50688762-50688784 CTGCATTTAAAAGAAAATACCGG - Intronic
954544799 3:51424126-51424148 GTAGTTAAAAAAGAAAAAACCGG + Intronic
954592144 3:51792143-51792165 GTTGAGGTGAAAGAGAAAACAGG + Intergenic
954821004 3:53327487-53327509 TTTTATTAAAAAGAAAAAGCTGG + Intronic
955061589 3:55497081-55497103 GTTGATTAAAATGGACAAACCGG - Intergenic
955081505 3:55661824-55661846 GGTTATTTAAAAAAAAAAAGTGG + Intronic
955413804 3:58673567-58673589 TATGATTTAAAAAAAAAAATTGG - Intergenic
955447378 3:59028208-59028230 TTTGATCTTAAAGAAAAAAGAGG + Intronic
955491628 3:59488804-59488826 GTTGATGTAAACAAAAACACAGG + Intergenic
955535981 3:59924153-59924175 GCTGACTTAAAAGCAAAACCAGG + Intronic
955915058 3:63899468-63899490 TTTGATTTAAAAAAACAAAAAGG + Intronic
956091851 3:65676481-65676503 GTTAATTTAAAAAATAAATCTGG + Intronic
956223626 3:66931694-66931716 GAAGATTTAAAAGAAGAAAAAGG - Intergenic
956499817 3:69870139-69870161 TTTGAATTAATAAAAAAAACAGG + Intronic
956571115 3:70696345-70696367 GTGGAGTTGCAAGAAAAAACAGG - Intergenic
956599067 3:70999376-70999398 CTGGATTCAAAAGAATAAACTGG - Intronic
956785853 3:72641607-72641629 CTTGATAAAAAAAAAAAAACAGG + Intergenic
956958842 3:74374280-74374302 TTTTATTAAAAAAAAAAAACTGG - Intronic
957087362 3:75693308-75693330 GCTGATTTAAAAGAAAGTAAGGG + Intergenic
957180412 3:76870413-76870435 GTTGGCTAAACAGAAAAAACTGG - Intronic
957612146 3:82481971-82481993 GTTGATTTGATAGGAAAAAAAGG - Intergenic
957682426 3:83454163-83454185 GTATATTAAAAAGAAAATACAGG - Intergenic
957793968 3:84978585-84978607 GTTCATTTAAAACAATAAAAGGG + Intronic
957865355 3:86015885-86015907 CTTGATTTATAAGCAAAACCTGG + Intronic
958743856 3:98109809-98109831 GGTATTATAAAAGAAAAAACAGG - Intergenic
958991565 3:100851937-100851959 GTTGCTTAAAAAAAAAAAAAAGG + Exonic
959347980 3:105223107-105223129 TTAGATAAAAAAGAAAAAACCGG + Intergenic
959635557 3:108563580-108563602 TATCATTTAAAAGAAAAAAATGG + Intronic
959636054 3:108571891-108571913 GTTGATTAAAATGAAAAATAAGG - Intronic
959757886 3:109921111-109921133 GCTCATTTTAAAGAGAAAACTGG - Intergenic
959786698 3:110307313-110307335 GATGAATTCAAAGAAACAACAGG - Intergenic
960016512 3:112895570-112895592 GTTAATTAAAAAGGAAAAACTGG + Intergenic
960290292 3:115876249-115876271 TCTGATTTAAAAAAAAAAAAAGG + Intronic
960786693 3:121380590-121380612 GCTCACTTAAAAAAAAAAACAGG - Intronic
961005549 3:123402952-123402974 GGTGATTTAAAAAGAAAAAAAGG + Intronic
961376719 3:126471693-126471715 GTTAAGTTAAAAAAAAAACCTGG + Intronic
962172105 3:133112255-133112277 GATAATTTAAAAACAAAAACAGG - Intronic
962630822 3:137273819-137273841 GTTTATTAAAAAAAAAAAACTGG - Intergenic
962853522 3:139325319-139325341 GGTGATTTATAAGGAAAAAGAGG + Intronic
963270301 3:143279826-143279848 TTTTATTTAAGAAAAAAAACAGG + Intronic
963648935 3:147952450-147952472 GTTTATATAATAGTAAAAACTGG - Intergenic
963700475 3:148619272-148619294 GTTTGTTTAAAAAAAAAAAAAGG + Intergenic
964165639 3:153701796-153701818 CATGGTTTACAAGAAAAAACGGG + Intergenic
964239348 3:154573834-154573856 ATTTATTTAAAAAAAAAAAGAGG + Intergenic
964566771 3:158064825-158064847 ATTGAATCAAAAGAAAAACCTGG - Intergenic
964777888 3:160299101-160299123 GTTTATTGAAAACAAAAATCTGG + Intronic
964858424 3:161172445-161172467 GTTGTGTTACAAGAAAAACCTGG - Intronic
965028908 3:163337585-163337607 CTTGATGTAAGAAAAAAAACTGG + Intergenic
965379618 3:167972181-167972203 CTTGAGTTAAAAAAAAAAAAAGG - Intergenic
965408417 3:168299676-168299698 GATCATTTAAAAGAAAAGAGGGG + Intergenic
965759544 3:172061195-172061217 GCCGTTTTAAAAGAAAAAATTGG - Intronic
966031214 3:175350048-175350070 CTTGATTGAAAAAAAAAAAAAGG + Intronic
966071749 3:175886231-175886253 TCTGGTTTAAAAGAGAAAACTGG - Intergenic
966570122 3:181432007-181432029 GTTCATTTAAAAGGACTAACTGG - Intergenic
966577837 3:181523068-181523090 ATTGATTTAAAAGAGAGAAAAGG - Intergenic
966742206 3:183244199-183244221 TCTGATTAAAAAAAAAAAACAGG + Intronic
966998799 3:185311820-185311842 ACTGTTTTAAAAGAAAAAAAAGG + Intronic
967051057 3:185784986-185785008 GTTAATTGAAAAGAAAACACAGG - Intronic
967060848 3:185871317-185871339 TTTCATTTAAAAAAAAAAAGCGG - Intergenic
967640874 3:191861709-191861731 GCTGTGTGAAAAGAAAAAACAGG + Intergenic
967695918 3:192530124-192530146 GTCAAATTAAAAAAAAAAACAGG - Intronic
967761623 3:193232373-193232395 GATAATTTAACAGAAAGAACTGG + Intergenic
969109529 4:4834754-4834776 GGTAATTTATAAGGAAAAACAGG + Intergenic
969665722 4:8556399-8556421 GTTGATTTAAAAAATAACACAGG - Intergenic
969985041 4:11199761-11199783 GTTCATTTAAAAGAAGATAAAGG - Intergenic
970176801 4:13347820-13347842 GTTTATTTAAAAGAGAAACCAGG - Intergenic
970303121 4:14702525-14702547 GTTTAATTCAAAAAAAAAACTGG + Intergenic
970363730 4:15337133-15337155 GGTGATTTATAAGGAAAAAGAGG + Intergenic
970493975 4:16607164-16607186 GTAGAATTAAAATAATAAACTGG + Intronic
970835016 4:20393556-20393578 GTTGATTTAGAAAAAACACCAGG + Intronic
970863182 4:20727791-20727813 ATTGTTTTAAAAGAGAAAAGCGG + Intronic
970895434 4:21097821-21097843 TTTGATTTAAACTAAAAGACGGG - Intronic
970982009 4:22109780-22109802 GTTGCTTTTACAGAAAAATCAGG - Intergenic
971444034 4:26723263-26723285 CTTGAGTTAAAAAAAAAAGCGGG - Intronic
971872088 4:32254522-32254544 TTTGATTTAAAAAAAAAATTTGG - Intergenic
971887513 4:32472633-32472655 GTTAATTTAAAAGACAAACATGG + Intergenic
971935648 4:33143862-33143884 TATGAGTTAGAAGAAAAAACTGG + Intergenic
971989372 4:33870875-33870897 TTTGATTTGAAAAAAAAAAAAGG - Intergenic
972586314 4:40439850-40439872 ATTGGTTTGGAAGAAAAAACAGG - Intronic
972944455 4:44237027-44237049 GGTGATTTAAAAAGAAAAACAGG - Intronic
973034360 4:45387611-45387633 GTTTATTTAAATGACAAAAGAGG - Intergenic
973666639 4:53166285-53166307 TTTGATATAAAGAAAAAAACAGG + Intronic
973677624 4:53281869-53281891 GATGATTTAAAAGACGAAAGAGG - Intronic
973707296 4:53593092-53593114 TATTATTTAAAAGAAAAAAAGGG + Intronic
973777373 4:54255804-54255826 GTTGTTTTAAAAAAAAAAGGAGG - Intronic
974053128 4:56959920-56959942 GTAGAATTAAAACAAAAAACAGG - Intergenic
974079374 4:57196346-57196368 TGAGTTTTAAAAGAAAAAACTGG - Intergenic
974729698 4:65846296-65846318 GAAGATTTAAAAAAAAAAAATGG + Intergenic
974750494 4:66134217-66134239 ATGGATTTAAAATAAAACACTGG + Intergenic
975239322 4:72038665-72038687 GTTGATTTCAAAGAATAATCTGG + Intronic
975417278 4:74119481-74119503 CTGCATTTAAAAGAAAATACTGG + Intronic
975473970 4:74800670-74800692 CTTTATTAAAAAGAAAAAAGTGG - Intergenic
975605808 4:76153169-76153191 GTAAATTTAAAAAAAAAAAAAGG + Intergenic
975988294 4:80227544-80227566 GTAGATTTAAAAAAAAAAGTTGG - Intergenic
976001929 4:80384905-80384927 GTTGATTTAAATAAATAAATGGG - Intronic
976014042 4:80528309-80528331 TTTGTTTGAAAAGAAAAAAAAGG + Intronic
976091974 4:81468342-81468364 ATTGATCTAAAAGAGAAAAATGG - Intronic
976172205 4:82315929-82315951 GGTGAATTAAAAGCAAAAAAAGG + Intergenic
976292111 4:83430149-83430171 GTTGCATTAAAAAAAAAAAAAGG + Intronic
976443382 4:85102893-85102915 GTTAATCTTACAGAAAAAACTGG + Intergenic
976615625 4:87072838-87072860 GTTTATTTAAAAAGAAATACTGG + Intronic
976643904 4:87367717-87367739 GTTGGTTTACAGGAATAAACAGG - Intronic
976644135 4:87369736-87369758 TGTTATTTAAAAGAAAAATCTGG - Intronic
976699057 4:87949339-87949361 TTTGGTTAAAAAAAAAAAACAGG + Intergenic
976860237 4:89656424-89656446 TTTGATTTTAATGAAAAACCTGG + Intergenic
977048180 4:92092678-92092700 GTAGATTTCAAAGAAAAGAGAGG - Intergenic
977098625 4:92778230-92778252 GTCGATTTAAAAAAAAACAATGG - Intronic
977450539 4:97190557-97190579 TTTCATTAAAAACAAAAAACAGG - Intronic
977528361 4:98171512-98171534 GTGGCTTAAAAACAAAAAACCGG - Intergenic
977890669 4:102307973-102307995 TTTGAAAAAAAAGAAAAAACAGG + Intronic
978040262 4:104051834-104051856 GTAGATTTAAAGGAAGAAAATGG - Intergenic
978048629 4:104167228-104167250 AATGCTTTAAAAGTAAAAACAGG + Intergenic
978095617 4:104772733-104772755 CTTTATTTAAAAAAAAAATCCGG + Intergenic
978141187 4:105319083-105319105 TTTAATTAAAAAAAAAAAACAGG + Intergenic
978187768 4:105877704-105877726 TCTGATTTAAAAAAAAAAAGGGG + Intronic
978266503 4:106832801-106832823 CTTTATTTATAATAAAAAACTGG + Intergenic
978358134 4:107899558-107899580 ATTGACCTAAAAGAAAAAATAGG - Exonic
978374223 4:108058196-108058218 GTTAGTTTAAAAGAAGGAACAGG - Intronic
978374511 4:108060742-108060764 GTTGATTAAAAAAAACAAACAGG - Intronic
978386814 4:108184538-108184560 TTTAATTTAAAAGGAAAAAGGGG + Intergenic
978865606 4:113506451-113506473 TTTGATTTAAAGGAAAAAAAAGG - Intronic
979004435 4:115273460-115273482 GTAGGTTTAAAACAAACAACAGG + Intergenic
979443918 4:120788002-120788024 GTTGACTAAAGAGTAAAAACAGG + Intronic
979588803 4:122453253-122453275 TTTGTCTTAAAAAAAAAAACTGG - Intronic
979737934 4:124111773-124111795 GTTCATTTTAAAGTAAATACAGG - Intergenic
979752056 4:124291064-124291086 GTGAATTAAAAAGAAAAAAAAGG - Intergenic
979897568 4:126178679-126178701 GCATTTTTAAAAGAAAAAACTGG - Intergenic
981100856 4:140827820-140827842 TTTTATTTAAAAGAAAAAAAAGG - Intergenic
981449105 4:144875179-144875201 GTTAATATAAAAAAAAAAGCTGG + Intergenic
981861287 4:149359682-149359704 GATAATTTAAAAGAAAATATAGG - Intergenic
982160663 4:152565785-152565807 GATGAGCTAAAAGAAAAAAATGG - Intergenic
982257441 4:153464955-153464977 GTTGATGTGAAAAAAAAAAAGGG - Intergenic
982282710 4:153701763-153701785 ATTTATTTAAAAAAAAAAAGAGG + Exonic
982536698 4:156615881-156615903 GTTTATTTAAAAGGAGAGACAGG + Intergenic
982539140 4:156645434-156645456 TTTGCTTAAAAAGAAAACACTGG - Intergenic
982763619 4:159317799-159317821 GGTGCTTTAAAAAAAAAAATTGG + Intronic
983057537 4:163115705-163115727 TTTGATTTAAATGAGTAAACAGG + Intronic
983068906 4:163245982-163246004 CTTGTGTTAAAAAAAAAAACAGG - Intergenic
983113028 4:163776979-163777001 GTTGAATTAAAAAGCAAAACAGG - Intronic
983591092 4:169412260-169412282 GTTTCTTTAAAAGTACAAACTGG - Intronic
983691779 4:170479473-170479495 GTTTCTTTAAAAAAAAAAAAAGG - Intergenic
983760377 4:171397917-171397939 TTTTAGTTAAAAGAAAAAATTGG - Intergenic
983767556 4:171504282-171504304 CCTGATTTAAAAGAACAAACCGG + Intergenic
983900805 4:173131771-173131793 GTTGTTTTTAGAGAAAGAACTGG - Intergenic
984003830 4:174284245-174284267 TTTGATTTAAAAGAATGAAAAGG - Exonic
984445276 4:179828824-179828846 GTTCCTTTAAAAGAAAAGGCTGG - Intergenic
985134058 4:186767534-186767556 GATAATTTTAAAGAAAAAACAGG - Intergenic
985435092 4:189921085-189921107 GCTGATTTTAAAAAAAAAATCGG + Intergenic
985542961 5:495323-495345 GTTGTTTTTAAAGACAAAGCTGG - Intronic
985739373 5:1606061-1606083 TTTGATTAAAAAAAAAATACCGG + Intergenic
986432661 5:7696912-7696934 GTTCATTTATAAGAAAAGAAAGG + Intronic
986526168 5:8679195-8679217 GTAAATTAAAAAAAAAAAACAGG - Intergenic
986571583 5:9171174-9171196 CGTGTTTTAAAAGAAAAAAAAGG - Intronic
986952208 5:13102625-13102647 GTTGATTTAGATGAAATAAGTGG - Intergenic
986982398 5:13464221-13464243 ATGGATTTAAAAGAAAAAAAAGG + Intergenic
987004584 5:13697060-13697082 GTTTAGTCACAAGAAAAAACAGG + Intronic
987108519 5:14664074-14664096 TTTGATTTAAGAGAAACAAAAGG - Intergenic
987329150 5:16840110-16840132 GGCAATTTAAAAGAAAGAACAGG + Intronic
987493602 5:18614532-18614554 TTTGATTTATACGCAAAAACTGG - Intergenic
987634764 5:20525923-20525945 TCTGAATTTAAAGAAAAAACAGG + Intronic
987649956 5:20728125-20728147 GTAAACTTAAAAGAAAAAATAGG + Intergenic
988210261 5:28194650-28194672 GTTTATTTAAAAAGCAAAACAGG - Intergenic
988319806 5:29679777-29679799 GATGATTTAAAAACAATAACAGG - Intergenic
988637103 5:32996300-32996322 GAGGAATTAAAAGAAAAAAAAGG + Intergenic
988733410 5:33996156-33996178 GTTGATTTAATAAAAAAAAAAGG + Intronic
988922076 5:35952652-35952674 GTTGATTCAACAGAAAACACAGG + Exonic
989222472 5:38984047-38984069 TTTGTTTTAAAAAAAAAAACAGG - Intronic
989359118 5:40579214-40579236 GTTGATTTAAAAGAAGGAGGAGG + Intergenic
989501579 5:42174733-42174755 TATGATCTAACAGAAAAAACAGG - Intergenic
990347026 5:54881335-54881357 GGAGATTTTAAAGAAAAACCTGG + Intergenic
990383303 5:55235635-55235657 TTAGATTTAAAAAAAAAAAAAGG - Intergenic
990510336 5:56483818-56483840 ATATATTTAAAAAAAAAAACAGG + Intergenic
990602393 5:57372586-57372608 CTTTTTTTAAAAGAAAAAGCTGG + Intergenic
991118128 5:62978107-62978129 GTTGAGAGAAAGGAAAAAACAGG + Intergenic
991146865 5:63317319-63317341 GATTATTTAAAAGTAAAAACAGG - Intergenic
991441787 5:66658429-66658451 ATTGATTTAAAAGGAAAGAAGGG - Intronic
991510369 5:67370038-67370060 TTTAATTTAAAAAAAAAATCAGG + Intergenic
991512216 5:67392086-67392108 GATCATTTAAAAAAAAAAAAAGG + Intergenic
991582234 5:68168376-68168398 CTTGGTCTAAAAAAAAAAACCGG - Intergenic
992440057 5:76789977-76789999 GTTGCTGTATAAGGAAAAACGGG + Intergenic
992453123 5:76891164-76891186 TTTAATTTAAAGGAAGAAACTGG - Intronic
993173336 5:84450081-84450103 CTTGGTTTAAAGAAAAAAACAGG - Intergenic
993360126 5:86964716-86964738 GTTTTTTTAAAAAAAAAAAAAGG + Intergenic
993451019 5:88072162-88072184 GGTAATTTATAAGGAAAAACAGG + Intergenic
993633681 5:90318273-90318295 GATGATATTAAAGAAAATACTGG - Intergenic
993786800 5:92149034-92149056 ATTGAATTAAGAGAAAAAAGAGG - Intergenic
994127243 5:96181911-96181933 GTTGATTAAAAAGTAATAAATGG - Intergenic
994349369 5:98726833-98726855 TTAGTTTTAAAAGAAAAAAATGG - Intergenic
994938876 5:106293771-106293793 ATTAAATTAAATGAAAAAACTGG + Intergenic
994982311 5:106891278-106891300 GTTGTTTTCAAAGGAAAAAATGG - Intergenic
995296071 5:110523946-110523968 CTTGGTTTAAAAAAAAAAAAAGG + Intronic
995484393 5:112625237-112625259 CTTGATTCAAAATAAACAACTGG - Intergenic
995994196 5:118279983-118280005 GTTGGTTGAAAAAAAAAAAAAGG - Intergenic
996108276 5:119533288-119533310 ATGGATTTAAAAAAAAAAAAAGG - Intronic
996414360 5:123194172-123194194 TTGTATTTAAATGAAAAAACAGG + Exonic
996502505 5:124232353-124232375 GCTGTTTTAAAAGAAGAATCGGG + Intergenic
996676543 5:126181698-126181720 GAAGATTTAAAAGAATAAAAGGG + Intergenic
996834075 5:127771855-127771877 ATTGATTGAAAAGGAAAAAAAGG + Intergenic
997011805 5:129887290-129887312 TTTAGTTAAAAAGAAAAAACTGG - Intergenic
997035530 5:130186582-130186604 GTTTATTTAAAATAAAACACAGG + Exonic
997149612 5:131479162-131479184 AATGATTAAAAAAAAAAAACTGG + Intronic
997786982 5:136722624-136722646 GTTGTTTTAAAAAATAGAACAGG + Intergenic
997881611 5:137597031-137597053 GTTTATTTACAGGAAAAAAGGGG - Intronic
997917449 5:137942328-137942350 GTTGATTTATAACAAAGTACAGG - Intronic
998453783 5:142254673-142254695 CTTGAATTAAAATAAAACACTGG - Intergenic
999182397 5:149679232-149679254 GGTGATTTAAAAAAAACAAATGG - Intergenic
999917403 5:156278007-156278029 GTTCATATAAAAGAAAAAAGGGG + Intronic
1000177442 5:158771370-158771392 GTTTCTTTAAATGAAAAAATGGG - Intronic
1000390340 5:160716762-160716784 GATGATGGAACAGAAAAAACGGG - Intronic
1000561447 5:162794299-162794321 GTTAAATGAAATGAAAAAACAGG + Intergenic
1000630847 5:163588781-163588803 GTTAATTTAAAAAATAAAACAGG + Intergenic
1001339851 5:170832999-170833021 GTTGTTATAAAAGCAAAAAGGGG + Intergenic
1001512471 5:172333533-172333555 TTTTATTTAAAAAAAAAAAAAGG + Exonic
1001907623 5:175486167-175486189 TTTTATTTAAAGGAAAAAAGTGG + Intronic
1002814916 6:670485-670507 TTTAATTTAAAAAAAAAAAAGGG + Intronic
1003799280 6:9644286-9644308 GTTCACCTAAAAGAAAAAATAGG + Intronic
1004144217 6:13049729-13049751 GTTGTTTTAATATAAAAAATAGG + Intronic
1005555397 6:26975692-26975714 TTTGCTTTAAAAAAAAAAAGAGG - Intergenic
1005653306 6:27905156-27905178 GTTGATTCCAAGGAAAGAACTGG - Intergenic
1006498918 6:34444888-34444910 TCTGAATTAAAAAAAAAAACAGG + Intergenic
1006574582 6:35035370-35035392 GTTGATCTAAGACATAAAACAGG - Intronic
1008097848 6:47358265-47358287 ATTAATTTAAAAAAAAAACCTGG + Intergenic
1008331558 6:50251440-50251462 TTTGATTTAAAAAAATACACTGG + Intergenic
1008553158 6:52652638-52652660 GATGATTTAAAACAAAAACATGG + Intergenic
1008668518 6:53742383-53742405 GATAATTTAATAGAAAAAAGGGG + Intergenic
1009019189 6:57933903-57933925 CTTAATTTAAAAAAAAAAAAAGG - Intergenic
1009173501 6:60430109-60430131 GTTTAATTAAATTAAAAAACAGG + Intergenic
1009523234 6:64711179-64711201 TTTGATTTACAAGAAAATAAAGG + Intronic
1009548036 6:65047407-65047429 TTAGATTTGAAACAAAAAACAGG - Intronic
1009574632 6:65436623-65436645 GTTGATTTACAATATAGAACAGG - Intronic
1009668628 6:66715886-66715908 GTTGTATTAAATGAAAAAAAAGG + Intergenic
1009746217 6:67819979-67820001 GTAGATTTAAAAGAAAAATAAGG - Intergenic
1009812057 6:68680868-68680890 CTAGCTTTTAAAGAAAAAACTGG + Intronic
1009834042 6:68974465-68974487 GTAGAATTAAAACAAAAAATCGG + Intronic
1010017108 6:71117844-71117866 ATAGATTTAAAAGAAGAAATGGG + Intergenic
1010098916 6:72079934-72079956 GTTTTTTTAAAAAACAAAACGGG + Intronic
1010124331 6:72414572-72414594 ATTGGTTTAAAAAAAAAAAAAGG + Intergenic
1010371294 6:75111164-75111186 GCTGTTTAAAAAGAAAGAACGGG + Intronic
1010506301 6:76663879-76663901 CTTGATTTATAAGCAAAAGCTGG + Intergenic
1010535287 6:77020410-77020432 TTTGAATAAAAAAAAAAAACTGG + Intergenic
1010872591 6:81060465-81060487 GTTGGTTCAAAGGAAAAAGCAGG + Intergenic
1010939769 6:81902819-81902841 GTTGATTTTTAAGTAAAAAGTGG + Intergenic
1010964299 6:82185547-82185569 ATTGGTTTTAAAGAAAAAATTGG - Intronic
1011379546 6:86727853-86727875 GTTAATTACAAAGAAAAAAATGG + Intergenic
1011415888 6:87119884-87119906 GTTGAAGAAAAAGAAAAAAAAGG - Intergenic
1012072109 6:94635804-94635826 GTTAATTTAAAAGGAACAAAAGG - Intergenic
1012628949 6:101439473-101439495 GTTCATCTAAAAGATAAGACTGG - Intronic
1012661031 6:101892059-101892081 GTTAATTTAAAAAAAAACAAGGG - Intronic
1012684535 6:102228736-102228758 CTTAATTAAAAAAAAAAAACTGG - Intergenic
1012875150 6:104717445-104717467 ATTGTTTTAATAGTAAAAACTGG + Intergenic
1013191651 6:107808863-107808885 GATGATTTAACAGAGAACACAGG + Intronic
1013719202 6:113002411-113002433 GTTGATTTAAAAAAAAAAAGAGG + Intergenic
1013796042 6:113890222-113890244 GATAGCTTAAAAGAAAAAACAGG + Intergenic
1013887160 6:114981999-114982021 GTAGATTTAAGAAAAAAAAATGG - Intergenic
1013941813 6:115672986-115673008 GTTGATATAAAATAAAAGAGGGG + Intergenic
1014033899 6:116743038-116743060 GTTCATTTAAAAAAAAAAAAAGG - Intergenic
1014078179 6:117261722-117261744 TTTAATTTTAAAGAAAAAAAGGG - Intergenic
1015339124 6:132077656-132077678 ATAAATTTAAAACAAAAAACAGG - Intergenic
1015511524 6:134042662-134042684 GTTGATTTATAAGAAACTCCTGG + Intronic
1016166865 6:140956781-140956803 GATTATTTAAAATGAAAAACAGG + Intergenic
1016257503 6:142125624-142125646 ATTTATTCAAAAGAAAAAAGGGG + Intergenic
1016383530 6:143509806-143509828 ATTGATGTAAAAAATAAAACTGG - Intronic
1016732439 6:147441171-147441193 GTAGTTTTAAAAAATAAAACAGG - Intergenic
1017332185 6:153212560-153212582 GATGATTTGAAAGGAAAAACAGG - Intergenic
1017438267 6:154438457-154438479 GTTGAGTTAAAAAAGAAAAAAGG - Intronic
1017516626 6:155161876-155161898 GTGGATTAAAAAGACAAAAAAGG - Intronic
1018360661 6:163064084-163064106 ATTGATTTAAAAAAAAAAAAAGG - Intronic
1018365195 6:163112745-163112767 ATTTTTTTAAAAGAAAAACCTGG + Intronic
1018558505 6:165075051-165075073 GTTCATTTAAAAAAATAATCCGG - Intergenic
1018632377 6:165832414-165832436 CCTGATTTAAAAAAAAAAATTGG + Intronic
1019115203 6:169754936-169754958 GTTTAATTAAAAAAAAAATCAGG + Intronic
1019923266 7:4176117-4176139 GTTTCTTTAAAAAAAAAAAAAGG - Intronic
1020387977 7:7628453-7628475 CTTGTCTTAAAAGAAAAAAAAGG + Intergenic
1020782261 7:12532247-12532269 TTTCATTAAAAAGAAAAACCTGG + Intergenic
1020791392 7:12632429-12632451 ATTTATCTAAAATAAAAAACAGG - Intronic
1020802354 7:12747565-12747587 GTTTAATTAAAGAAAAAAACGGG + Intergenic
1020837003 7:13166254-13166276 TTTTATTTAAAAAAAAAAAAGGG - Intergenic
1021050413 7:15976444-15976466 GTTTATTTGGAAGCAAAAACAGG + Intergenic
1021178478 7:17478116-17478138 GATGTTTTAAGAGAAATAACTGG - Intergenic
1021318048 7:19175225-19175247 TTTGATTAAAAAATAAAAACAGG - Intergenic
1021370319 7:19836956-19836978 TATGAATTAAAAAAAAAAACTGG - Intergenic
1021705478 7:23363543-23363565 CCTTATTTAAAAGAAAAACCAGG - Intronic
1021811985 7:24411382-24411404 TTTTATTTAAAAGACAACACTGG + Intergenic
1022039303 7:26565055-26565077 GATCATTTAGAAGAAAATACAGG - Intergenic
1022322348 7:29298735-29298757 GTTGGTTTACAAGAACAAGCAGG + Intronic
1022489735 7:30807497-30807519 TTAGATTTAAAAAAAAAAGCCGG + Intronic
1022565884 7:31401409-31401431 GTTAATTAGAAAGAGAAAACGGG + Intergenic
1022644802 7:32220101-32220123 ATTTATTTAAAAAAAAAAAGAGG - Intronic
1022889956 7:34686742-34686764 GATGATTTTAAAGAAAATAAAGG - Intronic
1022890049 7:34687930-34687952 GCTGATTTAAAAGCAGAAACTGG + Intronic
1022982053 7:35613058-35613080 GTTGAAAAAAAAAAAAAAACAGG + Intergenic
1023316904 7:38947519-38947541 TTTGTTTTAAAAAAAAAAAAGGG + Intergenic
1024161555 7:46681590-46681612 GATTATTTTAAAAAAAAAACTGG + Intronic
1024313716 7:47993837-47993859 CTTAATTTAAAAAACAAAACAGG - Intronic
1024699932 7:51895973-51895995 GTTCAATTAAAAAAAAAAATAGG + Intergenic
1024881133 7:54086654-54086676 GTTTATTTAAAACAAAGACCAGG - Intergenic
1024885126 7:54132679-54132701 GTTTTTTTAAAAAAAAAATCAGG + Intergenic
1024976749 7:55120518-55120540 GCTGATTTAAAAGGAAAATGGGG - Intronic
1025278997 7:57613407-57613429 TTTAATGTAAAAGAACAAACAGG + Intergenic
1025305734 7:57852093-57852115 TTTAATGTAAAAGAACAAACAGG - Intergenic
1025814471 7:64898407-64898429 GTTCATTTAACACAAAGAACTGG + Intronic
1026081797 7:67228201-67228223 GGTAATTTATAAGAAAAAAGAGG + Intronic
1026654402 7:72244561-72244583 GCTGATTTAAAAAAAAAAAAAGG - Intronic
1026695271 7:72585788-72585810 GGTAATTTATAAGAAAAAAGAGG - Intronic
1026740967 7:72978287-72978309 CTGGAATTAAAACAAAAAACAGG - Intergenic
1027102766 7:75386786-75386808 CTGGAATTAAAACAAAAAACAGG + Intergenic
1027389067 7:77687598-77687620 GTTGTTTAAAAAAAAAAAAAAGG - Intergenic
1027403035 7:77828438-77828460 GTTGCTTTAAAAGACATATCAGG + Intronic
1027544265 7:79506479-79506501 ATTGAAGTAAGAGAAAAAACAGG - Intergenic
1027713142 7:81633194-81633216 GTAGATATAATATAAAAAACTGG - Intergenic
1027845099 7:83362705-83362727 AATGTTTTAAAAGAAAAAATTGG - Intergenic
1027943594 7:84717294-84717316 CTGGATTTAAAAAAAAAATCAGG - Intergenic
1028771590 7:94630777-94630799 AATGACTTAAAAGAAAGAACTGG - Intronic
1029006712 7:97218343-97218365 ATTGATTAAAAAAAAAAAAGAGG + Intergenic
1029565679 7:101335778-101335800 GTTTATTTAAAAGAGAAAGACGG - Intergenic
1029565774 7:101336668-101336690 AATAATTTAAAAAAAAAAACTGG - Intergenic
1030075144 7:105730390-105730412 GTTTATTTAAAAAAAAAACAAGG + Intronic
1030187218 7:106776000-106776022 GTTCATTTAAAAAAAAAAAAAGG + Intergenic
1031119717 7:117707348-117707370 GTTAATTTGAAAGAGAAGACTGG - Intronic
1031412680 7:121458386-121458408 GTTTATTGAAATGAAAAAATAGG + Intergenic
1031959858 7:127978988-127979010 GGTGGTTTAAAAAAAAATACAGG - Intronic
1032240765 7:130157045-130157067 TTTGTTTAAAAAGAAAAAATTGG - Intergenic
1032376534 7:131424992-131425014 TTTGATTTAAAAGAACACATAGG - Intronic
1032388633 7:131541385-131541407 GTTGCTTAAAAAGAACAAACAGG + Intronic
1032467710 7:132156908-132156930 CTAGATTTAAAAGGAAAAAAGGG + Intronic
1033007363 7:137581372-137581394 GTTTGTATAAAAGAAACAACAGG - Intronic
1033205118 7:139413473-139413495 GTTGTTATGAAAGAAAAACCTGG + Intronic
1033372637 7:140724984-140725006 GTTGTTTTTATAGAAAGAACTGG - Intronic
1033372979 7:140728542-140728564 ACTGATTTAAAAAAAAAAAAAGG + Intronic
1034712059 7:153201643-153201665 GGTGAGTTTAAAGAAAAAAGAGG - Intergenic
1034747734 7:153537984-153538006 TTTGATTTAAATAAATAAACAGG + Intergenic
1035094018 7:156338485-156338507 GTTGTTTTAAAACATAAAATGGG - Intergenic
1035463175 7:159058769-159058791 GATGAATTATAAGAAAAAAGTGG - Intronic
1035813428 8:2513038-2513060 TTTGTTATAAAAGAAAATACTGG + Intergenic
1035879176 8:3225668-3225690 ATTGATTTAAAAGAAACAAAGGG + Intronic
1036031052 8:4973837-4973859 GTTGATTTGAAAGGAATAATGGG - Intronic
1036049625 8:5182142-5182164 GTTCTTTTAAAAGAACAAGCTGG - Intergenic
1036717227 8:11136954-11136976 ATTCTTTTAAAAGAAAAAAATGG + Intronic
1037469120 8:19190232-19190254 GTTGAATAAAAAGAAACATCAGG + Intergenic
1037895444 8:22649674-22649696 GTTTATTTGAAAGAAAAATGTGG - Intronic
1038147992 8:24915431-24915453 TTAGATTTAAAAGAAAAAGGGGG + Intronic
1038881723 8:31621200-31621222 GTTAATATAAAAGAATCAACTGG + Intergenic
1038926804 8:32149661-32149683 TTTGATTTTAAAGAAAAAGGCGG + Intronic
1039147729 8:34467897-34467919 GTTGAATTAAAAAAAAAAAAAGG - Intergenic
1039312148 8:36328336-36328358 GTCAATTTAATAGAAAAAAGTGG + Intergenic
1039689311 8:39846465-39846487 GTTCATTTAAAAAAAGAAATGGG + Intergenic
1040046629 8:42971112-42971134 GCTGATTAAGAAGAAAAAAAAGG - Intronic
1040774194 8:51019434-51019456 GGTGATTTAGATGAAAAAAGTGG - Intergenic
1040955019 8:52970735-52970757 TTTGAGGTAAAAAAAAAAACAGG + Intergenic
1041010065 8:53532845-53532867 GTCTAATTAAAAGCAAAAACTGG + Intergenic
1041405658 8:57496527-57496549 GTAGAATTAGAAGAGAAAACGGG - Intergenic
1041720372 8:60969885-60969907 GATGATTTAAAATATACAACAGG + Intergenic
1041861014 8:62512362-62512384 GACCATTTAAAAGAGAAAACTGG - Intronic
1041983559 8:63892913-63892935 GTTAGTTTAAAAAAAAAAATCGG - Intergenic
1042128934 8:65567362-65567384 GTTAACTTAAAAGAATAAAGAGG + Intergenic
1042231969 8:66566934-66566956 GAAGTTTTAAAAGAAGAAACTGG - Exonic
1042324776 8:67517123-67517145 GTTGGTTTTAAAAAAAAAAATGG - Intronic
1042596504 8:70453571-70453593 CTTGATTTAAAATAAAGAAGGGG - Intergenic
1042716757 8:71781655-71781677 GTTTATTTAAAAGTAAAATATGG + Intergenic
1042748902 8:72136727-72136749 ATTGATTTATAACAAAACACTGG + Intergenic
1042841809 8:73131462-73131484 TTTAAATTAAAAAAAAAAACTGG - Intergenic
1043303082 8:78759359-78759381 CTTGATTTATAAGCAAAACCTGG - Intronic
1043680262 8:83015804-83015826 GTTCCTTTAAGGGAAAAAACAGG + Intergenic
1043724284 8:83590036-83590058 ATTAATTTAAAAGAACATACAGG - Intergenic
1043958302 8:86388158-86388180 GTTGTTTAAAAAAAAAAAAAAGG - Intronic
1044243070 8:89909548-89909570 GTTTCTTTAAAAAAAAAAAAGGG - Exonic
1044271750 8:90252911-90252933 GTTATTTTATAAGAAGAAACTGG - Intergenic
1044480208 8:92677576-92677598 CATTATCTAAAAGAAAAAACTGG + Intergenic
1044662687 8:94606795-94606817 CTTTATTAAAAAGAAAAAAGAGG + Intergenic
1044704081 8:94991804-94991826 GCTGCTTTAAAAAAAAAAAGGGG - Intronic
1045536463 8:103033346-103033368 GTTGATTTTATAGAAAAAACGGG + Intronic
1045792728 8:106003940-106003962 GTAGATTTAAATGAAAAGAAAGG + Intergenic
1045873946 8:106957261-106957283 GTTCATTTATAAGAAAAAACTGG - Intergenic
1045874397 8:106962189-106962211 ATTGATGGAAAAGAAAAAAAGGG - Intergenic
1045900743 8:107276621-107276643 AATGATTTAAAAAAAAAAAATGG + Intronic
1046029263 8:108764002-108764024 GTTGATACAAAAGGAAAAAAAGG - Intronic
1046050551 8:109016782-109016804 GTAGATTTCAAAGAAAACCCTGG - Intergenic
1046285715 8:112091256-112091278 GCAAATTTAAAATAAAAAACTGG - Intergenic
1046567520 8:115919971-115919993 ATGGATTTAAAAAAAAAAATGGG - Intergenic
1046803828 8:118458217-118458239 GCTTATTAAAAAGAAAAAACGGG - Intronic
1047452310 8:124976053-124976075 GAAGACTTAAGAGAAAAAACAGG - Intronic
1047670023 8:127135994-127136016 TTTTTTTTAAAAGAAAAAATTGG + Intergenic
1047888544 8:129280203-129280225 GTTAACTTAAAAAAAAAAAAAGG + Intergenic
1047996715 8:130343460-130343482 GTTTCTCCAAAAGAAAAAACTGG - Intronic
1048699183 8:137068523-137068545 GTTGCTTTGAAACAGAAAACAGG - Intergenic
1049092739 8:140529047-140529069 GTTTGTTTAAAAGAAAAACTGGG - Intergenic
1050026437 9:1339298-1339320 CTTGCTTTAAAAGACAAACCAGG + Intergenic
1050583810 9:7089053-7089075 GATGAGTTAAAAAACAAAACAGG + Intergenic
1050664836 9:7923987-7924009 CCTGATTTAAAAAAAAAAAAAGG - Intergenic
1050926853 9:11274691-11274713 GTTGATTCAAAGGAATAAGCAGG - Intergenic
1051692162 9:19726829-19726851 GTTGGTGTAAAAGAAAAGAAAGG - Intronic
1051817452 9:21125848-21125870 ATTGAAATAAAATAAAAAACTGG - Intergenic
1051877892 9:21810377-21810399 GTTTATTTAAAAGAAATGAAAGG + Intronic
1051976373 9:22954675-22954697 GTTGACCTTAAAGAAAAAACTGG - Intergenic
1052149788 9:25101794-25101816 CTTGATTAAAAAGAATAAAGTGG - Intergenic
1052376265 9:27721223-27721245 GTTTAAGTAAAAGAAAAAAAAGG + Intergenic
1052420704 9:28240327-28240349 CCTGAGTAAAAAGAAAAAACTGG + Intronic
1052730713 9:32281975-32281997 ATTGATTTGGAAGAGAAAACTGG + Intergenic
1052750514 9:32484975-32484997 TTGGATTTAAAAGGAAAAAAAGG + Intronic
1052933623 9:34075621-34075643 GATGATTTAAAAAAAAGAAAAGG - Intergenic
1053729502 9:41038649-41038671 GTTGATGGAAAAGAAAAAGCAGG + Intergenic
1054699005 9:68393413-68393435 GTTGATGGAAAAGAAAAAGCAGG - Intronic
1054760029 9:68996226-68996248 GTTGAGTTACAGGAAAAAGCAGG - Intronic
1054839895 9:69726261-69726283 GTTTATTTTTAAGAAAAATCTGG + Intronic
1055419162 9:76118965-76118987 GTTGGTTTAAAAAAACAAATGGG - Intronic
1055444969 9:76373499-76373521 GTTGCTTTAAAAAACAAAAAGGG + Intergenic
1055601920 9:77928469-77928491 GTTGTTTTAAAGGAAAAGACAGG + Intronic
1055882748 9:81021290-81021312 ATTCATTTGAAAGAGAAAACTGG - Intergenic
1056082283 9:83108038-83108060 GGTGATATAAAAGAGAAAAGTGG + Intergenic
1056169854 9:83974332-83974354 TTTTTTTTAAAAAAAAAAACAGG - Intronic
1056561657 9:87735165-87735187 TTTGACTTAAAAAAAAAAAATGG - Intergenic
1056677791 9:88690848-88690870 GTTGGTTCACAAGAACAAACAGG - Intergenic
1056696972 9:88866807-88866829 TTTGATATAAAGGAAAAAAGAGG + Intergenic
1057552394 9:96061497-96061519 GTTGGTTTAAAAGAAAAGTTTGG + Intergenic
1057759114 9:97858640-97858662 ATTGTTTTAAAAGAAATAACAGG + Intergenic
1057959985 9:99445886-99445908 TTTTATGTAAAAGACAAAACTGG - Intergenic
1058074127 9:100633635-100633657 GATGCTTTAAAAAAAAAAAGTGG - Intergenic
1058231568 9:102433233-102433255 GTTAAGTTAAAAAACAAAACAGG - Intergenic
1058282664 9:103135568-103135590 TTTGATTAAAACCAAAAAACTGG - Intergenic
1058741987 9:107952814-107952836 GTTGAATTAAAAAAAAACACAGG + Intergenic
1059135648 9:111803572-111803594 AATGATTTAAAAAAAAAAAAAGG + Intergenic
1060063972 9:120486395-120486417 TTTTTTTTAAAAGAAAAACCTGG - Intronic
1060622398 9:125079755-125079777 GGTGACTTAAAAAAAAAAACTGG + Intronic
1061529928 9:131202762-131202784 GTTGTTTAAAAAGAAAAAAGAGG + Intronic
1061778565 9:132982689-132982711 TTTTTTTTTAAAGAAAAAACAGG - Intronic
1062149364 9:135009671-135009693 GATGAGTTAAAAAAAAAAAAAGG - Intergenic
1062496646 9:136834963-136834985 GATGATTCAAAAAAAAAAAAAGG + Intronic
1203453501 Un_GL000219v1:143656-143678 ATTTATTAAAAAGAAAAAAAAGG - Intergenic
1203630059 Un_KI270750v1:66017-66039 GTTAATGTAAAAGAACAAACAGG + Intergenic
1185500075 X:590075-590097 GATTATTTAAAAGAAGAAAAGGG + Intergenic
1185675340 X:1844847-1844869 ATTTATTTAAAAAAAAAATCTGG + Intergenic
1185999393 X:4991746-4991768 TTTGATTTGAAAGAAATAACTGG - Intergenic
1186151619 X:6680617-6680639 TTTTTTTTAAAAAAAAAAACAGG - Intergenic
1186201043 X:7155165-7155187 GTTGTGTTAAAAAAAAAAATGGG - Intergenic
1186308684 X:8293070-8293092 ATTGAAATAAAACAAAAAACTGG + Intergenic
1186434353 X:9530113-9530135 GACGATTTAAAAAAACAAACAGG + Intronic
1186458086 X:9726659-9726681 CATGATTTAAAAGAAAACATTGG - Intronic
1186568940 X:10694280-10694302 GCTTATTTAAAAGAAACAAACGG - Intronic
1186718590 X:12279059-12279081 GTTTATTTAACAGATCAAACAGG - Intronic
1187214007 X:17257283-17257305 AATGAATTAAAAAAAAAAACTGG + Intergenic
1187290581 X:17949579-17949601 GTTGCATTCAAAGAAAAAACAGG - Intergenic
1187329693 X:18326290-18326312 TTTCATCTAAAAGAAAATACTGG + Intronic
1187370733 X:18703890-18703912 TTTAATTTAAAAAAGAAAACAGG - Intronic
1187582597 X:20624655-20624677 GTTCATCTGAAAGAATAAACAGG - Intergenic
1187658861 X:21515034-21515056 TGTGATTTAAAAAAAAAAACTGG + Intronic
1188215662 X:27473829-27473851 GTTGAATTAAAATGAAAAGCAGG - Intergenic
1188645883 X:32566693-32566715 GTTGATTTGAAAGGAATAAGTGG + Intronic
1188793649 X:34436474-34436496 TTAGATTAAAAAGAAAAAATAGG - Intergenic
1188941249 X:36240868-36240890 GGTCATTTAAAAGAAAAAATGGG + Intronic
1189254396 X:39626535-39626557 GTAGCCTTAAAAAAAAAAACTGG - Intergenic
1189428494 X:40925510-40925532 GTAGATTGGAAAGAAAACACAGG - Intergenic
1189842541 X:45096029-45096051 GATGATTCAAAGGAAAAAAAGGG - Intronic
1189909672 X:45797509-45797531 TTTGATTAAAAAGAAAAAAGGGG - Intergenic
1189991773 X:46602557-46602579 ACTGATTTAAAAACAAAAACTGG + Intronic
1190043923 X:47096823-47096845 TTCGATTTAAAAAAAAAAAAAGG + Intergenic
1190624717 X:52326006-52326028 GTGGAGGTAAAAGAAAGAACAGG - Intergenic
1190795731 X:53739435-53739457 GTTTCTTTAGAAGACAAAACAGG - Intergenic
1191724437 X:64264353-64264375 GTATATTTAAAAAAAAAAAAAGG + Intergenic
1192474142 X:71424923-71424945 CTTGCTTTAAAAAAAAAGACTGG - Intronic
1192971151 X:76232218-76232240 GTAGATTTAAAATAAAAGAATGG + Intergenic
1193239345 X:79148502-79148524 ATTGATTTATAAGAAATATCTGG - Intergenic
1193394942 X:80972279-80972301 GGTAATTTACAAGAAAAAAGGGG - Intergenic
1193497329 X:82231074-82231096 GGTAATTTATAAGAAAAAAGAGG - Intergenic
1193588296 X:83355180-83355202 TTTTATTTAAAAGAAGAAAAAGG - Intergenic
1193789900 X:85804885-85804907 GCTGAGTTAAAAAAAAAAACTGG - Intergenic
1194138288 X:90175386-90175408 GTTGATTTAACTTAAAAATCTGG + Intergenic
1194609716 X:96027338-96027360 TTTGATTAAAAAAAAAAAAAAGG - Intergenic
1195671189 X:107471338-107471360 TTTGTTCTAAAAAAAAAAACGGG + Intergenic
1196199962 X:112874796-112874818 CTGAATTTAAAAGAAAAACCTGG + Intergenic
1196363435 X:114895017-114895039 GTTTATTTAAAAAATAAATCTGG - Intronic
1196432545 X:115642209-115642231 GTTAAATTGAAATAAAAAACAGG - Intronic
1196664437 X:118301968-118301990 ATTGAGCTAAAAGTAAAAACAGG + Intergenic
1196997105 X:121396160-121396182 GTTGATTTAAAAGCAACAGAGGG - Intergenic
1197301468 X:124787063-124787085 TTTTATTTAAATGATAAAACAGG - Intronic
1197998382 X:132405581-132405603 GTTTATTTAAAAGCAACAACAGG + Intronic
1198363044 X:135914763-135914785 ATTGGTTGAAAAGAAAAAATAGG + Intergenic
1199064272 X:143395927-143395949 GCCAATTTAAAATAAAAAACTGG - Intergenic
1199329780 X:146545330-146545352 GTTGCTGTAAAAAAAAAAAGAGG + Intergenic
1199907477 X:152248198-152248220 TTCAATTTAAAAAAAAAAACTGG + Intronic
1200340923 X:155394861-155394883 GCAGATTTACAAGAAAAAAAAGG + Intergenic
1200635754 Y:5651857-5651879 CTTCATTTAAAAAAAAAAAAAGG + Intronic
1200876536 Y:8161595-8161617 GTTGATGGAAAAAAAAAAAAAGG - Intergenic
1201714332 Y:17027749-17027771 GTTGTTCTAAAGGACAAAACAGG + Intergenic
1202301875 Y:23424627-23424649 ATACATTTGAAAGAAAAAACAGG - Intergenic
1202568936 Y:26245971-26245993 ATACATTTGAAAGAAAAAACAGG + Intergenic