ID: 1152407287

View in Genome Browser
Species Human (GRCh38)
Location 17:80104920-80104942
Sequence CCTGCAAAGCAGGGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 426}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152407279_1152407287 -3 Left 1152407279 17:80104900-80104922 CCCGCGGCTGTTGCTACATCCCT 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG 0: 1
1: 1
2: 6
3: 47
4: 426
1152407276_1152407287 15 Left 1152407276 17:80104882-80104904 CCCAGGAACAGTGCGAGGCCCGC 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG 0: 1
1: 1
2: 6
3: 47
4: 426
1152407274_1152407287 21 Left 1152407274 17:80104876-80104898 CCATCACCCAGGAACAGTGCGAG 0: 1
1: 0
2: 1
3: 14
4: 125
Right 1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG 0: 1
1: 1
2: 6
3: 47
4: 426
1152407280_1152407287 -4 Left 1152407280 17:80104901-80104923 CCGCGGCTGTTGCTACATCCCTG 0: 1
1: 0
2: 0
3: 8
4: 173
Right 1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG 0: 1
1: 1
2: 6
3: 47
4: 426
1152407277_1152407287 14 Left 1152407277 17:80104883-80104905 CCAGGAACAGTGCGAGGCCCGCG 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG 0: 1
1: 1
2: 6
3: 47
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152407287 Original CRISPR CCTGCAAAGCAGGGGCTGCA GGG Intergenic
900096048 1:940505-940527 CCTGCATAGTGGGGGCTGCGGGG + Intronic
900189567 1:1347676-1347698 CCAGAGAAGCAGGGACTGCAAGG + Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900620774 1:3586740-3586762 CCTGCTGGGAAGGGGCTGCAGGG - Intronic
900978715 1:6034285-6034307 AATGCAAAGCAGGGGCTGTGGGG + Intronic
901833257 1:11906938-11906960 CCAGCAAAGGAGGGGCTGCAGGG + Intergenic
902118264 1:14139693-14139715 CCAGCAGGGCATGGGCTGCAGGG + Intergenic
902337333 1:15760999-15761021 CCTCCCAAGCAGTGACTGCAGGG - Intronic
903125204 1:21243065-21243087 CCTGCAGAGCAGAGGCTGAGTGG + Intronic
903839029 1:26225310-26225332 CCTGCAAAGCAGTTCCTGCCGGG + Intergenic
903967618 1:27100242-27100264 CCACCAGAGCAGGGGCTGCTGGG - Exonic
904007414 1:27370730-27370752 CCTGGAAAGAAGGGGAGGCAGGG + Exonic
904261491 1:29290218-29290240 TCTGCAGAGCTGGGGCTGCCTGG - Intronic
904292952 1:29499363-29499385 TCTGCAGAGCTGGGGCTGCCTGG + Intergenic
904595041 1:31638595-31638617 CCAACAAAGCAGGTGCTGCCAGG + Intronic
905405517 1:37729795-37729817 CCTGGAAAGTTGAGGCTGCAGGG + Intronic
905528514 1:38657680-38657702 TTTACAAAGAAGGGGCTGCATGG - Intergenic
905631394 1:39521008-39521030 CCTGTGAAGTAGGAGCTGCAGGG + Intronic
905666360 1:39765163-39765185 CCTGTGAAGTAGGAGCTGCAGGG - Intronic
907377827 1:54058594-54058616 CATATAAAGCAGGGGCTACAAGG - Intronic
909540998 1:76791328-76791350 TTTTCAAAGCAGGGGCTGCAGGG - Intergenic
909629019 1:77751530-77751552 CCTGAATAGCTGGGACTGCAGGG - Intronic
911068994 1:93817248-93817270 GCATCAAAGCAGGGGCTGAAGGG + Intronic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
914802547 1:150972057-150972079 CCTGCAAAACAGGGGGTGGGGGG + Intronic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
914900911 1:151710571-151710593 CTTGCAGAGCAGGCCCTGCAGGG + Intronic
915585535 1:156841906-156841928 CCTGGAAAGTAGGGGCTCAATGG + Intronic
915982202 1:160427241-160427263 CCTGGAAAACAGGGCCTGGATGG + Exonic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
922865859 1:228861077-228861099 CCTGCAAAGCAGGGACTGTGCGG + Intergenic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1063232749 10:4081692-4081714 CCTGCAAATCAGTGGCTGTGTGG + Intergenic
1063673928 10:8122729-8122751 CATGCAAAGAACAGGCTGCAGGG - Intergenic
1064388339 10:14919679-14919701 CCTGGAAAGCAGTGTTTGCAGGG + Intronic
1065862773 10:29885739-29885761 CCTGCAGAGCTGGGGATGCCTGG + Intergenic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066357148 10:34695759-34695781 CCTGCACAGGAGAGGCTGCCCGG + Intronic
1066433051 10:35371140-35371162 CCTTCAAAGCAGGGACTATATGG + Intronic
1067225629 10:44374147-44374169 CCTGGGGAGCAGGGTCTGCAGGG - Intronic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1068091695 10:52440296-52440318 CTTGCTAAGCAGGGTCTCCAGGG + Intergenic
1069820424 10:71224134-71224156 CCAGGAAAGCCGGGGCTGCTGGG + Intronic
1069820445 10:71224270-71224292 CCAGGAAAGCCGGGGCTGCTGGG + Intronic
1069983182 10:72266496-72266518 CCTGAATAGCTGGGGCTACAGGG + Intergenic
1070748103 10:78947315-78947337 CCTGCAGGGCAGCGGCTGCTGGG - Intergenic
1070912774 10:80132761-80132783 CGCGCAGAGCAGGGGCCGCATGG - Exonic
1071149940 10:82622078-82622100 CTTGCAAAGTAGGCTCTGCAAGG - Intronic
1071334192 10:84588363-84588385 CCTGCTGAGTGGGGGCTGCAGGG - Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1074849722 10:117429959-117429981 GCTGCACAGCTGGGGCTGCTGGG - Intergenic
1075120353 10:119660037-119660059 GCTGCAGGGCTGGGGCTGCAGGG + Intronic
1075482133 10:122790833-122790855 CCTGCATAGCAGGTGCTGAGGGG - Intergenic
1075679716 10:124323455-124323477 TCTGCAGGGCAGAGGCTGCAGGG - Intergenic
1076291392 10:129348543-129348565 CCCTCCAAGCCGGGGCTGCATGG + Intergenic
1076726431 10:132416269-132416291 CCTGCAGAGCCGAGGGTGCACGG - Intronic
1077008157 11:368961-368983 CCTGCAGGGCTGGGGCCGCAGGG - Intergenic
1077026707 11:442865-442887 GCTGCAAAGCTGGGGAGGCAGGG + Intergenic
1077155903 11:1090676-1090698 CCTGCAGAGAAGGGCCTGCCAGG + Intergenic
1077327480 11:1969988-1970010 CCTGCAGGGCTGGAGCTGCAGGG - Intronic
1077536099 11:3125018-3125040 TCTGCAGTGCTGGGGCTGCAGGG - Intronic
1078185942 11:9052378-9052400 TAGGCAAAGCAGGGGCAGCAGGG - Intronic
1078723721 11:13908728-13908750 CCTGCAATGCAGTGGCCTCAGGG - Intergenic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1080109260 11:28547004-28547026 CCTGCACAGCCCAGGCTGCATGG + Intergenic
1080262596 11:30365680-30365702 CCTCAAAAACAGGGGCTCCAGGG - Intergenic
1080532438 11:33190091-33190113 CAGCCAAAGCTGGGGCTGCAGGG + Intergenic
1081962605 11:47149299-47149321 ACTTCAAAGCAGGGGCGGCCGGG + Intronic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1083644514 11:64164842-64164864 CCTGAAAGGCAGGGGCAGCTGGG + Intronic
1084703356 11:70801886-70801908 CCTGCAAGTCTGGGGCTCCAGGG - Intronic
1085527729 11:77173866-77173888 CCTCTAATGCAGGGGGTGCAGGG + Intronic
1085804012 11:79617992-79618014 CCTGGAAAGCATGGTTTGCAAGG - Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087438826 11:98157529-98157551 CCTGAAAACTAGGGGCAGCAAGG + Intergenic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1089244525 11:117109379-117109401 CCTGCATAGCTGAGGCTACAAGG + Intergenic
1089581672 11:119485268-119485290 TGTGCTAAGCAGGGACTGCAGGG - Intergenic
1090199133 11:124841815-124841837 CCTGCAGGGCAGGGGGTCCAGGG - Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1090747634 11:129720139-129720161 GCATCAAAGCAGGGGGTGCAGGG + Intergenic
1091038337 11:132254016-132254038 CAAGCCAAGCAGGGGCTGGAAGG + Intronic
1202810462 11_KI270721v1_random:25168-25190 CCTGCAGGGCTGGAGCTGCAGGG - Intergenic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1091499941 12:1006505-1006527 CCTGCATAGCTGGGACTACAGGG + Intronic
1091544900 12:1495158-1495180 CCTGCCAGGCAGGGGCTTCAGGG - Exonic
1092173901 12:6390234-6390256 CCTCCAAAACTGGGGCTGCGGGG - Exonic
1092816938 12:12320603-12320625 TCTGGAAGGCAGGGGCTGCTGGG + Intergenic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1094397105 12:30019554-30019576 ACTGCAATGCAGGGGCTGCGAGG + Intergenic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1099854478 12:88146141-88146163 CCTGCAAAGTAGAGGTTGCAGGG - Intronic
1100349009 12:93760956-93760978 CCTGTAAAGCCAGGGCTGTAAGG + Intronic
1100834389 12:98552504-98552526 CCTGAGTAGCTGGGGCTGCAGGG - Intergenic
1101624810 12:106429226-106429248 CCCAAAAGGCAGGGGCTGCAGGG - Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102219637 12:111185855-111185877 CCTGCAATGTAGGAGCTGCTAGG + Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102281631 12:111623196-111623218 CCTGGGAAACAGAGGCTGCAGGG - Intergenic
1102337178 12:112091735-112091757 CCTGCATAGCTGGGACTACAGGG - Intronic
1102895254 12:116593542-116593564 CCTGGGAAGTAGAGGCTGCAGGG + Intergenic
1103524913 12:121561133-121561155 CCTTCAAAGCAGGGGCCACAGGG - Intronic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1104649911 12:130524044-130524066 CCAGCAGAGCAGAGGCTGCGAGG - Intronic
1105070972 12:133234452-133234474 TCTGCAAAGCAGGTGATGCACGG + Exonic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1110436514 13:75482254-75482276 CCTGGAAGGTCGGGGCTGCAGGG + Intergenic
1113831685 13:113300408-113300430 CCTGGGAGGCAGGGGTTGCAGGG + Intronic
1114046480 14:18880683-18880705 CGCGCAGAGCAGGGGCCGCATGG - Intergenic
1114117732 14:19638767-19638789 CGCGCAGAGCAGGGGCCGCATGG + Intergenic
1114567118 14:23640807-23640829 GCTGCTCAGCAGGGGCTGCAGGG - Intronic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1119890851 14:78181059-78181081 CCTGCAAAGCAGGTGTTGGGAGG + Intergenic
1122066324 14:99176313-99176335 CCTGCCTGACAGGGGCTGCAGGG + Intronic
1122255346 14:100472204-100472226 CCTGCCCAGCCGGGGCTCCAGGG - Intronic
1123126029 14:105946873-105946895 CCTGCACAGCCCAGGCTGCAGGG + Intergenic
1123406615 15:20023295-20023317 CCTGCACAGCCCAGGCTGCAGGG + Intergenic
1123515945 15:21029943-21029965 CCTGCACAGCCCAGGCTGCAGGG + Intergenic
1123581109 15:21715550-21715572 ACAGCAAAGCAGGGGCTGCAGGG + Intergenic
1123617758 15:22158173-22158195 ACAGCAAAGCAGGGGCTGCAGGG + Intergenic
1123997576 15:25729610-25729632 TGGGCCAAGCAGGGGCTGCAGGG - Intronic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1124483889 15:30099756-30099778 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1124490265 15:30151075-30151097 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1124519690 15:30397468-30397490 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1124538963 15:30568753-30568775 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1124753268 15:32387254-32387276 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1124759686 15:32438819-32438841 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1124955811 15:34359631-34359653 CATGCAAAGCTGTGGCAGCAGGG + Exonic
1124975008 15:34522954-34522976 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1125774930 15:42203853-42203875 CCTGCAGAGCACGCGCAGCATGG + Intronic
1125864663 15:43034315-43034337 CCTGCATAGCTGGGCCTGCAGGG - Intronic
1127394214 15:58530418-58530440 CCTGCAAACCAGGAGCAGCCAGG + Intronic
1127774296 15:62253428-62253450 AGCTCAAAGCAGGGGCTGCACGG + Intergenic
1129403573 15:75300372-75300394 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1129608659 15:77036985-77037007 CCTGCAGGGAAGGGCCTGCAGGG - Intronic
1129727636 15:77909632-77909654 CCTGGAAAACAGGGGCTGGAAGG - Intergenic
1129840251 15:78739338-78739360 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1130134034 15:81166874-81166896 ACTGTACAGCAGGGGCTGCAGGG - Intronic
1130275944 15:82476416-82476438 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1130462367 15:84168739-84168761 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1130468305 15:84203808-84203830 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1130473987 15:84247661-84247683 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1130481400 15:84361729-84361751 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1130490305 15:84426046-84426068 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1130495961 15:84469734-84469756 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1130501897 15:84504804-84504826 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1130590598 15:85208406-85208428 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1130596268 15:85252302-85252324 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1132524026 16:405430-405452 TCTGAAAAGCAGGGGCCTCAGGG - Intronic
1132584645 16:700891-700913 CCTGCTGAGCGGGGGCTGCCGGG - Intronic
1134051134 16:11138303-11138325 CATGCAAAGGTGTGGCTGCAGGG + Intronic
1135052727 16:19205513-19205535 CCTGGGAGGCAGGGGTTGCAGGG - Intronic
1137249246 16:46730433-46730455 CCTGTACAGCATGGGGTGCATGG - Intronic
1137567396 16:49542109-49542131 TCTGCAAGGCAGGGGCTGAGAGG - Intronic
1137633119 16:49962050-49962072 CCTGCAGAGAAGGGAATGCAGGG - Intergenic
1137678044 16:50313886-50313908 CCTGAGAAGCAGGGGCAGCCTGG + Intronic
1139092283 16:63662789-63662811 TCTGCAATGGAGGGGCTACATGG - Intergenic
1139673666 16:68508805-68508827 GCTGCAAAGCAGGAGATGGAAGG - Intergenic
1141667890 16:85475230-85475252 CCTGTAAACCAGGGGCAGCAGGG + Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1143025913 17:3941971-3941993 CCAGGGAAGCAGGGCCTGCAGGG - Intronic
1143916926 17:10301147-10301169 CCTGCAAAACAGGGGCTTCATGG + Intronic
1144358524 17:14469319-14469341 GCTGCAAAGCAGGCTCAGCATGG + Intergenic
1144521161 17:15953100-15953122 CCTGCAGAGCTGGGAGTGCAGGG + Intronic
1144582425 17:16466420-16466442 AGTGCACAGGAGGGGCTGCAGGG - Intronic
1146836901 17:36118257-36118279 GCTGGAAGGCAGGGTCTGCAGGG + Intergenic
1147158708 17:38558681-38558703 CATGCAAAGGGGGAGCTGCATGG + Intronic
1148602030 17:48901480-48901502 CCTGCAAGTCAGGGCCTGAAGGG - Intergenic
1150646807 17:66983738-66983760 CCTGCAAAACATGGGTTCCAGGG - Intronic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1151441247 17:74130583-74130605 CGTGCAGAGCAGGAGCTGGACGG + Intergenic
1151697454 17:75724797-75724819 CCTGCCAGGAGGGGGCTGCAGGG - Intronic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152624180 17:81380688-81380710 CATGGAGGGCAGGGGCTGCACGG + Intergenic
1152884408 17:82840892-82840914 GCTGCAGGGCAGAGGCTGCAGGG + Intronic
1153551846 18:6270753-6270775 GCTGCACTGCAGGGGCTGGAGGG + Intronic
1155914075 18:31538878-31538900 TCTGCATGGCAGCGGCTGCAGGG + Exonic
1158312317 18:56171458-56171480 CTTGCAAGGCAGGGGCTCCCAGG + Intergenic
1158518931 18:58154198-58154220 CCTGCAAAGCCAGGACTGCCTGG - Intronic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1159314487 18:66753856-66753878 CCTGCTAAGCTGGGCCTGGATGG + Intergenic
1160152538 18:76406109-76406131 CCTCCGGAGGAGGGGCTGCAGGG - Intronic
1160529447 18:79555028-79555050 CCTGCAAGGCAGCCGCTGCTGGG + Intergenic
1160568087 18:79798956-79798978 CCCACACAGCAGGGGCTGCGGGG + Intergenic
1161170688 19:2810996-2811018 CATTCAAAGCAGAGGCTCCAGGG - Intronic
1162413529 19:10520212-10520234 CCTGGAAAGTCGAGGCTGCAGGG - Intergenic
1162627167 19:11893999-11894021 CCTGCAAAGCAAGATATGCATGG + Intronic
1163191945 19:15683471-15683493 CCTGCAGAGCAAGGGCAGAAAGG - Exonic
1163765218 19:19160042-19160064 CCTGGGAAGCAGTGGTTGCAGGG - Intronic
1164654203 19:29909086-29909108 CCTGCACAGCAGGGGTGGTAAGG - Intergenic
1166789822 19:45392113-45392135 CCTCAAACGCAGGGGCTCCATGG - Exonic
1167353689 19:48991301-48991323 CATGAACAGCAAGGGCTGCAAGG - Exonic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167767464 19:51493016-51493038 CCTGCACAGCAGATGCTCCATGG + Intronic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168406200 19:56111876-56111898 TCTGCAAAGCAGGGACGGGAAGG + Intronic
925615651 2:5742374-5742396 TTTGCCAAGCAGGAGCTGCAAGG + Intergenic
925616816 2:5751582-5751604 GGTGCACAGCAGGGGCTGCGTGG + Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
926233483 2:11022251-11022273 CCTGCCAGGAGGGGGCTGCACGG + Intergenic
926810927 2:16754845-16754867 CCTTCAAAGTGGGGCCTGCAGGG + Intergenic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
928115597 2:28543337-28543359 CGTGCTGAGGAGGGGCTGCAGGG + Intronic
928500827 2:31893286-31893308 TCTGCAATGCAGGGGCTTCTTGG + Intronic
929864600 2:45707640-45707662 CCTCAAAAGCAGGGGCTGAGGGG - Intronic
930284758 2:49413874-49413896 CCTGGAAAGCTGGGTCTGAATGG + Intergenic
931771402 2:65501126-65501148 CCAGCAAAGGCAGGGCTGCAGGG - Intergenic
932573637 2:72951074-72951096 CCTGGAGGGCAGGGGCTGCAGGG + Intronic
932750915 2:74371176-74371198 CCTGCAAAGGAGAGGCCTCACGG + Exonic
933872068 2:86576310-86576332 CCTGGGAGGCAGGGGCGGCAGGG + Intronic
934057859 2:88267594-88267616 CGTGTAGAGCAGGGACTGCAAGG - Intergenic
934950408 2:98571754-98571776 TCATTAAAGCAGGGGCTGCAGGG + Intronic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
936028734 2:109054209-109054231 TGTGAAAAGCAGGGGCTCCAGGG - Intergenic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
937145225 2:119638799-119638821 CATGCAAAGAAGTGGCTCCAAGG + Intronic
937251906 2:120529228-120529250 GCAGCAAAGCAGGAGCTGCAGGG + Intergenic
937356345 2:121200329-121200351 CCTGCACAGCAGGGTCCCCACGG - Intergenic
937387611 2:121450522-121450544 CTTGCAAAGAAGTGACTGCAGGG + Intronic
937636056 2:124156569-124156591 CCTGGAAAGCGGAGGTTGCAGGG - Intronic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938266881 2:129934222-129934244 CGCGCAAAGCAGGGGCCGCATGG + Intergenic
939686401 2:145205986-145206008 CCTGCAAGGCATGGCCAGCATGG + Intergenic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
941230985 2:162912501-162912523 CCTGCAAGTCAGAGGCTGCAGGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941752510 2:169148006-169148028 GCTGCAAAGCAGCGGCTGGTGGG - Intronic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
944074319 2:195710894-195710916 CCAACACAGAAGGGGCTGCAGGG + Intronic
946158703 2:217823067-217823089 CTTGGCCAGCAGGGGCTGCAGGG - Intronic
946337058 2:219044906-219044928 CCTCCAAAACAGTAGCTGCAGGG - Intergenic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
947982287 2:234420693-234420715 CTTGCAGTGCAGAGGCTGCAAGG + Intergenic
948087649 2:235264943-235264965 CCTGCACAGCAGGAGGTGCGTGG + Intergenic
948404114 2:237704707-237704729 TCTAGAAGGCAGGGGCTGCAAGG + Intronic
948815410 2:240507784-240507806 CCCTGAAAGCAGGGGCTTCACGG + Intronic
948890948 2:240906869-240906891 CCCGCAAACCTGTGGCTGCAAGG - Intergenic
948890968 2:240906947-240906969 CCTGCAAACCTGTGGCTGCCAGG - Intergenic
948890987 2:240907025-240907047 CCTGCAAACCCGTGGCTGCCAGG - Intergenic
1169000270 20:2163349-2163371 CCAACAAAGCAGGGACTGGAGGG - Intronic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1170277357 20:14606523-14606545 CCTGAAAAGCAGGAGTTGCTGGG + Intronic
1171570780 20:26249362-26249384 CCAGCATAGCTGGGGCTACAGGG + Intergenic
1172095190 20:32457028-32457050 CGTGCAAAGCCGGGGCTGCAAGG + Intronic
1172869767 20:38128853-38128875 CCTGCAAAGAAGGGGTAGCTGGG + Exonic
1172939341 20:38643953-38643975 CCTGGAGAGCAGGGGCGGCACGG - Intronic
1172978216 20:38922002-38922024 CTTCCAAAGCAGGTGCTGCATGG + Exonic
1173475417 20:43355752-43355774 CATGCAAAGCAGAGGCTACAAGG - Intergenic
1173701566 20:45076422-45076444 CCCCCAAAGAAGGGGCTGCATGG - Exonic
1174399378 20:50267709-50267731 GCTGCTGAGCAGGGGCGGCAGGG + Intergenic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1175153477 20:56953578-56953600 CCAGCAAAGCAGGGACAGCCAGG + Intergenic
1175182228 20:57156688-57156710 CCATCAAAGACGGGGCTGCAGGG + Intergenic
1175225872 20:57443501-57443523 CCTGCAAAGCTGGAGAAGCAGGG + Intergenic
1175544817 20:59771403-59771425 CAGGCAGGGCAGGGGCTGCAGGG - Intronic
1175725922 20:61318269-61318291 TCTGCAAAGCCGGGGCTGTTGGG - Intronic
1175762390 20:61570485-61570507 CCTTGAGAGCAGGGGCTGCGAGG - Intronic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176284617 21:5012789-5012811 CCTGGAAACCAGGGGCCGCAAGG - Intergenic
1178098553 21:29241244-29241266 CCTACACAGCAGCAGCTGCAAGG - Intronic
1178701304 21:34835591-34835613 CGTGCAAAGCTGAGGCTCCAAGG + Intronic
1179033651 21:37741687-37741709 CCTGCACAGGAGGGGCCACATGG - Intronic
1179435291 21:41358461-41358483 CCAGCAAACCATGGACTGCATGG + Intergenic
1179872564 21:44250686-44250708 CCTGGAAACCAGGGGCCGCAAGG + Intronic
1179953653 21:44725720-44725742 CCCGGGAAGCAGAGGCTGCAGGG + Intergenic
1180465016 22:15603319-15603341 CGCGCAGAGCAGGGGCCGCATGG - Intergenic
1180572940 22:16746378-16746400 CCAGCATAGCTGGGGCTACAGGG + Intergenic
1181329693 22:22080298-22080320 GCTGCAGAGTAGGGGGTGCATGG - Intergenic
1181509260 22:23381753-23381775 CCCCCACGGCAGGGGCTGCAGGG + Intergenic
1182093220 22:27609882-27609904 ACTGCAAAGCATGGGCTGGGTGG - Intergenic
1182128190 22:27831585-27831607 CATGCAGAGCCGTGGCTGCATGG + Intergenic
1182259494 22:29063009-29063031 TCTGCAAAGCAGGGACAGGAGGG + Intergenic
1182329946 22:29544465-29544487 CCTGAAGAGCAGGGGTGGCAAGG - Exonic
1182749002 22:32626970-32626992 CCTCCAAAGCTGGGGGTGCAGGG - Intronic
1182832259 22:33313623-33313645 CCTGCAGGGAGGGGGCTGCATGG + Intronic
1183238784 22:36640325-36640347 CTTTCAAAGCAAGGGCTGGAGGG + Intronic
1183786516 22:40032068-40032090 CCTGCACAGCAGCTTCTGCAAGG + Exonic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184198684 22:42949982-42950004 CCTGGACCGCAGGGCCTGCATGG - Intronic
1184212392 22:43043694-43043716 TCTCCACACCAGGGGCTGCAGGG - Intronic
1184769610 22:46589582-46589604 CCTGCAAAGCAGGGGCAGCATGG - Intronic
1184859426 22:47164859-47164881 CCTCCTGCGCAGGGGCTGCAGGG - Intronic
1184985954 22:48134311-48134333 CCATCCAAGCAGGGGCTGCCAGG + Intergenic
1185173006 22:49304384-49304406 CCAGCAAAGCACAGGCTGGAGGG + Intergenic
1185181696 22:49367242-49367264 CCTGCAGTGCAGGGGCAGGAAGG - Intergenic
1185389660 22:50552262-50552284 CCTGGACAGCAGGTGCAGCAGGG + Intronic
1185393245 22:50573798-50573820 CGAGCAAAACAGGGTCTGCAGGG - Intronic
950123344 3:10496327-10496349 CCTGCAAAGAAGGGGCAGCCGGG - Intronic
950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG + Intergenic
950496002 3:13334994-13335016 CCTGCGGGGCAGGGGCTGCAGGG - Intronic
950526808 3:13529090-13529112 GCTGCACAGCAGGAGCTGCGTGG - Intergenic
950624651 3:14235998-14236020 CCGGCAAAGCAGAGTCTGCCTGG - Intergenic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955385428 3:58475535-58475557 CATGCAATGAAGGGGGTGCAGGG - Intergenic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
956587873 3:70883387-70883409 TCTGCAAATCAGAAGCTGCAAGG + Intergenic
957104751 3:75872540-75872562 CCAGCATAGCTGGGGCTACAGGG - Intergenic
957813275 3:85256162-85256184 GCTGCTAACCAGGAGCTGCAGGG - Intronic
958497345 3:94862538-94862560 TCTTCAAAGCATGGGTTGCAAGG - Intergenic
958885106 3:99717325-99717347 CCTGCCAAGCATAGGCTGAAAGG - Intronic
960109982 3:113836717-113836739 CCTGGAAAGTGGAGGCTGCAGGG - Intronic
960869013 3:122230686-122230708 CCTGCATAGAAGGGGCTTCCTGG + Intronic
961404513 3:126668724-126668746 CCTGCGGGGCAGGGGCCGCAGGG + Intergenic
962195789 3:133362364-133362386 GCTGGAAAGAAGGGGCTCCATGG - Intronic
962553164 3:136516430-136516452 CCTGGGAAGCGGGGGTTGCAAGG + Intronic
963863583 3:150335886-150335908 TCTTCAAAGCAGAGGCTGCCTGG + Intergenic
964682572 3:159358514-159358536 TCTGCACAGCAGGTGCTGCAGGG + Intronic
966807818 3:183820114-183820136 CCAGCAAGGCAGGTCCTGCAGGG + Intronic
967950754 3:194838410-194838432 CCTGTAAAGTAGGTGCAGCAGGG - Intergenic
968639019 4:1701050-1701072 CCTGCAAATCATTTGCTGCAGGG + Intronic
968645140 4:1736832-1736854 CCTGGGAGGCAGGGGTTGCAGGG + Intronic
968731675 4:2272038-2272060 CGTGCCATGCAGGGGCTCCAGGG - Intronic
969227669 4:5809590-5809612 CCTGCTAAGCGTGGGCTGCTAGG + Exonic
969530308 4:7726772-7726794 CAGGGAAAGGAGGGGCTGCAGGG - Exonic
969548169 4:7845739-7845761 CCTGTGAAGCAGGGGGTGCTTGG - Intronic
969720577 4:8891266-8891288 CTGGCAGTGCAGGGGCTGCAGGG - Intergenic
970534356 4:17014058-17014080 CCTGCAGTGAAGGGGCAGCATGG - Intergenic
971255157 4:25007831-25007853 CCTGCAAAGGAGGAAGTGCATGG + Intronic
971547383 4:27903484-27903506 ACTGAAAAGAAGGGGCTGCAGGG + Intergenic
972567990 4:40286032-40286054 CATGCAGAGCAGGGTCTCCAAGG - Intergenic
975365698 4:73524944-73524966 CCTTCCTAGCAGCGGCTGCATGG - Intergenic
981836278 4:149057958-149057980 CCTGCTTAGCTGGGGCTACAAGG - Intergenic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
985217257 4:187667164-187667186 CCTGCCACTCAGAGGCTGCAAGG + Intergenic
985693652 5:1327549-1327571 CCTGTAGAGCAGGAGCTGGATGG - Intronic
986314093 5:6574550-6574572 CCGCCAAAGGAGGGGCTGCAAGG + Intergenic
986843540 5:11726001-11726023 CCAACAAAGCAGGGGCTCCTGGG - Intronic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
992119940 5:73582507-73582529 CCTGAGAAGCTGGGGCTACAGGG + Intronic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
994508663 5:100675152-100675174 CCTGGAAGGCGGAGGCTGCAGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995717662 5:115096174-115096196 CCTGAGTAGCTGGGGCTGCAGGG - Intergenic
996572937 5:124952111-124952133 CCTGGAAAGCTGAGGCTGCGGGG - Intergenic
997255201 5:132423116-132423138 CCTCCAAAGTGGGAGCTGCAGGG + Intronic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
998092077 5:139377286-139377308 CATGCAATGCAGGCCCTGCAGGG - Intronic
998814607 5:146000236-146000258 CCTGCAGAGCGGGGGCGGCTGGG - Exonic
999781028 5:154850546-154850568 CCACCAAAGCGGGGGCTGAAAGG - Exonic
1001238670 5:170051252-170051274 ACTGCTAAGCAAGGCCTGCAAGG + Intronic
1001416441 5:171547708-171547730 CCTGCACAGCAGTGGTTGCCTGG - Intergenic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001845605 5:174918178-174918200 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002161386 5:177315699-177315721 CCCGGATAGCAGGGGCTGCCAGG - Intergenic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1002598353 5:180338946-180338968 TCTGCAAATCAGGGAGTGCATGG - Intronic
1004356419 6:14933403-14933425 TCTCCAAAGCAGGGTTTGCATGG - Intergenic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1006388660 6:33746282-33746304 CGTGGAAAGCTGGGGCTGCTGGG + Intronic
1009515508 6:64611051-64611073 CCTAAAAAGCAGAGGATGCATGG - Intronic
1012289872 6:97439877-97439899 CCTGCAAATCATTGACTGCAAGG + Intergenic
1012538836 6:100335779-100335801 CCTGGACAGCAGTGGTTGCAGGG - Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1017404321 6:154102013-154102035 CCTGGGAAGTAGAGGCTGCAGGG - Intronic
1017640096 6:156484594-156484616 CCTGCAAACCATGTGCAGCAAGG + Intergenic
1018206863 6:161444525-161444547 CCCACTAACCAGGGGCTGCAGGG - Intronic
1018280092 6:162176096-162176118 CCTGCTAAGCAGGGGGAGCTTGG + Intronic
1019196898 6:170288401-170288423 CCTGCACAGCAGCGGCCGCACGG - Exonic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1020148289 7:5662102-5662124 CCTGCACAGCTGCAGCTGCACGG - Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020264147 7:6549220-6549242 CCTGCAAATCAGGGGTTGCTTGG + Intronic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1021732366 7:23608385-23608407 CCTGCAACCCATGGGCTGCATGG + Intronic
1022473673 7:30697076-30697098 TCTGCAGAGCCGGGGCTCCAGGG - Intronic
1023089896 7:36608030-36608052 CCTGCAGAGGATGGCCTGCAGGG - Intronic
1023567448 7:41537728-41537750 CCAGCAAAGCATGGATTGCACGG + Intergenic
1023825832 7:44008016-44008038 CCTGGAAGGTCGGGGCTGCACGG + Intronic
1023900195 7:44470626-44470648 TCTGTAACTCAGGGGCTGCAAGG + Intronic
1024654012 7:51434082-51434104 CCTGCTAAGCGGGGGCATCAGGG - Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1026089403 7:67286867-67286889 CCTGGAAGGTTGGGGCTGCACGG + Intergenic
1026513202 7:71044527-71044549 CCTGCAAAGTGGTGGCTGCTGGG + Intergenic
1026724880 7:72863633-72863655 CCTGGAAGGTCGGGGCTGCACGG - Intergenic
1026767865 7:73171847-73171869 CCTGCCAAGGAGGGCCTGCCTGG - Intergenic
1026858300 7:73769203-73769225 CCCGCAAAGCCGTGGCTGCTGGG + Exonic
1027044333 7:74981555-74981577 CCTGCCAAGGAGGGCCTGCCTGG - Intronic
1027079308 7:75220803-75220825 CCTGCCAAGGAGGGCCTGCCTGG + Intergenic
1027118992 7:75502185-75502207 CCTGGAAGGTCGGGGCTGCACGG + Intergenic
1027137749 7:75637311-75637333 CCTGCAAAGCTTGGCCTGCAAGG - Intronic
1027272830 7:76533423-76533445 CCTGGAAGGTCGGGGCTGCACGG - Intergenic
1028933781 7:96443049-96443071 CCTGGAAGGCAGTGGTTGCAAGG + Intergenic
1029388536 7:100259384-100259406 CCTGCCAAGGAGGGCCTGCCTGG + Intronic
1029401877 7:100352083-100352105 CCTGGACAGCAGGGGGTGCCGGG - Intronic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1032019660 7:128400307-128400329 CCTGCAGGGCAGGGGAAGCAGGG - Intronic
1034655423 7:152725656-152725678 CCTGGAAGGTAGAGGCTGCAGGG - Intergenic
1034960368 7:155360897-155360919 CCGTGAAAGGAGGGGCTGCAGGG + Intronic
1035093051 7:156330513-156330535 CCTCCAGGGCAGGGTCTGCAGGG + Intergenic
1035544498 8:468938-468960 TCTGCAAAGGGGGGACTGCATGG + Exonic
1036560084 8:9894315-9894337 CTTGGAGAGCCGGGGCTGCAAGG + Intergenic
1036605505 8:10302321-10302343 CTGGCAAAGCAGGGCCTGCAAGG - Intronic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1038949585 8:32399933-32399955 CCTGCAAAACAAAGTCTGCAAGG - Intronic
1039117740 8:34111496-34111518 CCTGTAAAGCAGTGGCAGAAAGG + Intergenic
1039551903 8:38449795-38449817 CCTGCAAACTAGGGGCTGTGGGG - Intronic
1039702743 8:39978765-39978787 CCAGCCAAGCAGTGGCTTCAGGG + Intronic
1040306975 8:46217096-46217118 CATGCAAAACCGGGGATGCAGGG + Intergenic
1040337349 8:46422809-46422831 CGTGCAAAATTGGGGCTGCAGGG + Intergenic
1040481711 8:47832969-47832991 CCTGCAAAGCAGGGAGTCCAGGG + Intronic
1042255931 8:66803730-66803752 CCTGGAAGGTTGGGGCTGCAGGG - Intronic
1042449314 8:68925929-68925951 CCTGAAAAGGAGGGCCTGGAGGG - Intergenic
1043728708 8:83647335-83647357 TCTGGAAAGCAGGGACTGGAGGG - Intergenic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1047060986 8:121225659-121225681 CTAGCAAAGCAGAGGCTTCATGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048091627 8:131247418-131247440 CCTGAGAAGCAGGGACTGCTGGG - Intergenic
1048344493 8:133566520-133566542 CCTGCAATGCGGGGGATGCAGGG - Intronic
1048639850 8:136343465-136343487 CCTGGAAAGTTGAGGCTGCAAGG + Intergenic
1048846181 8:138605508-138605530 CGTGCAAAGCCTGGGCAGCATGG + Intronic
1048857609 8:138697741-138697763 CCTGCACTGCAGGGGCTCAAAGG + Intronic
1049245025 8:141557800-141557822 CCTGCCGGGGAGGGGCTGCAAGG + Intergenic
1049258984 8:141628721-141628743 CCCCCAAAGCATGGGCTGGATGG - Intergenic
1049427823 8:142545140-142545162 AGGGCAAAGCAGGAGCTGCAGGG - Intergenic
1051108099 9:13603720-13603742 CCACCAAAGCAGAGGCTGAAGGG - Intergenic
1051543449 9:18247709-18247731 GCTACAAAGCAGAGGCTTCAAGG + Intergenic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053791661 9:41690657-41690679 GCTGCACAGCAAGGGCTGGAAGG + Intergenic
1054180062 9:61902672-61902694 GCTGCACAGCAAGGGCTGGAAGG + Intergenic
1054657529 9:67678469-67678491 GCTGCACAGCAAGGGCTGGAAGG - Intergenic
1055828972 9:80358456-80358478 CATGCACAGCAGGGGCTCCCTGG - Intergenic
1056249011 9:84729056-84729078 CTTGTAAGGCAGGGGCTGCTTGG + Intronic
1057934196 9:99222595-99222617 CCAGCAAAGCAGTGGCCGCCCGG + Exonic
1059311116 9:113389686-113389708 CCTGCAAAGCAGAGTCATCAGGG + Exonic
1059727903 9:117027454-117027476 CCAGCAAGGCTGGGGCTCCATGG - Intronic
1061064465 9:128268718-128268740 AGCTCAAAGCAGGGGCTGCACGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061509565 9:131052338-131052360 CCTGCACAGCAGACCCTGCAGGG - Intronic
1062076819 9:134594228-134594250 CCTGGAAAGTGGTGGCTGCAGGG + Intergenic
1062349166 9:136130757-136130779 ACTGCCAAGAAGGGGGTGCAGGG - Intergenic
1062540340 9:137039224-137039246 CCTGCGTAGAAGGGTCTGCAGGG + Intergenic
1062545788 9:137063275-137063297 CCTGCAGACCAGGTGCAGCAGGG + Exonic
1062679889 9:137773512-137773534 CCTGCAGAAGAGTGGCTGCAGGG - Intronic
1062722433 9:138051376-138051398 CATGCAGAGCAGGGACGGCAAGG - Intronic
1185458182 X:320688-320710 CCTCCAATCCAGGCGCTGCAGGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1186626481 X:11298891-11298913 CATGGGAGGCAGGGGCTGCATGG - Exonic
1186780772 X:12909824-12909846 TCTGTAAAGCAGGGGCCTCATGG + Intronic
1190767631 X:53488662-53488684 CCATCAAAGCAGGGGCTTTAGGG - Intergenic
1192417598 X:70997375-70997397 CCTGAATAGCTGGGACTGCAGGG + Intergenic
1197838903 X:130724487-130724509 CTTGCAAAGCACAGGCTCCATGG - Intronic
1197839083 X:130726292-130726314 CTTGTAAAGCAGAGGCTCCATGG + Intronic
1198848872 X:140943397-140943419 CCTGCAAAGGATGAGCCGCATGG + Intergenic
1200011396 X:153123406-153123428 CCTTCAGAGCGGGGGGTGCAGGG + Intergenic
1200028204 X:153276516-153276538 CCTTCAGAGCGGGGGGTGCAGGG - Intergenic
1201368818 Y:13238106-13238128 CCTGGAAAGCAGGGGTTAGAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202376925 Y:24246391-24246413 CCTGGAAAAGAGGGGCTGGAAGG - Intergenic
1202493855 Y:25423730-25423752 CCTGGAAAAGAGGGGCTGGAAGG + Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic