ID: 1152408577

View in Genome Browser
Species Human (GRCh38)
Location 17:80110868-80110890
Sequence GGGGTAGTCCCCAGAGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152408577_1152408580 -6 Left 1152408577 17:80110868-80110890 CCAAGGCCTCTGGGGACTACCCC No data
Right 1152408580 17:80110885-80110907 TACCCCACCCTCCTCACTCTGGG No data
1152408577_1152408588 28 Left 1152408577 17:80110868-80110890 CCAAGGCCTCTGGGGACTACCCC No data
Right 1152408588 17:80110919-80110941 ACCAGCAGCGCTTCTCTTGCAGG No data
1152408577_1152408579 -7 Left 1152408577 17:80110868-80110890 CCAAGGCCTCTGGGGACTACCCC No data
Right 1152408579 17:80110884-80110906 CTACCCCACCCTCCTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152408577 Original CRISPR GGGGTAGTCCCCAGAGGCCT TGG (reversed) Intergenic