ID: 1152409941

View in Genome Browser
Species Human (GRCh38)
Location 17:80118138-80118160
Sequence GCCTCCACCTCCACCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152409932_1152409941 0 Left 1152409932 17:80118115-80118137 CCTAGCATTCCCGGGCCCTGGAG No data
Right 1152409941 17:80118138-80118160 GCCTCCACCTCCACCAGGGTGGG No data
1152409935_1152409941 -10 Left 1152409935 17:80118125-80118147 CCGGGCCCTGGAGGCCTCCACCT No data
Right 1152409941 17:80118138-80118160 GCCTCCACCTCCACCAGGGTGGG No data
1152409927_1152409941 16 Left 1152409927 17:80118099-80118121 CCTGGTGCTGTACCAGCCTAGCA No data
Right 1152409941 17:80118138-80118160 GCCTCCACCTCCACCAGGGTGGG No data
1152409930_1152409941 4 Left 1152409930 17:80118111-80118133 CCAGCCTAGCATTCCCGGGCCCT No data
Right 1152409941 17:80118138-80118160 GCCTCCACCTCCACCAGGGTGGG No data
1152409934_1152409941 -9 Left 1152409934 17:80118124-80118146 CCCGGGCCCTGGAGGCCTCCACC No data
Right 1152409941 17:80118138-80118160 GCCTCCACCTCCACCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152409941 Original CRISPR GCCTCCACCTCCACCAGGGT GGG Intergenic
No off target data available for this crispr