ID: 1152409979

View in Genome Browser
Species Human (GRCh38)
Location 17:80118254-80118276
Sequence CCAAGGGTGGGGAGGCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152409958_1152409979 22 Left 1152409958 17:80118209-80118231 CCACAGAGTCCCGCCAGCAGCCC 0: 1
1: 0
2: 3
3: 37
4: 322
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409966_1152409979 1 Left 1152409966 17:80118230-80118252 CCATGGCCCTGGCTGTGGCCCTG 0: 1
1: 4
2: 98
3: 218
4: 1235
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409960_1152409979 13 Left 1152409960 17:80118218-80118240 CCCGCCAGCAGCCCATGGCCCTG 0: 1
1: 1
2: 6
3: 55
4: 506
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409968_1152409979 -6 Left 1152409968 17:80118237-80118259 CCTGGCTGTGGCCCTGACCAAGG 0: 1
1: 0
2: 3
3: 42
4: 360
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409963_1152409979 9 Left 1152409963 17:80118222-80118244 CCAGCAGCCCATGGCCCTGGCTG 0: 1
1: 0
2: 2
3: 77
4: 697
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409967_1152409979 -5 Left 1152409967 17:80118236-80118258 CCCTGGCTGTGGCCCTGACCAAG 0: 1
1: 0
2: 2
3: 43
4: 408
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409965_1152409979 2 Left 1152409965 17:80118229-80118251 CCCATGGCCCTGGCTGTGGCCCT 0: 1
1: 0
2: 3
3: 47
4: 384
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409957_1152409979 30 Left 1152409957 17:80118201-80118223 CCTCACAACCACAGAGTCCCGCC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247
1152409961_1152409979 12 Left 1152409961 17:80118219-80118241 CCGCCAGCAGCCCATGGCCCTGG 0: 1
1: 0
2: 3
3: 60
4: 571
Right 1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG 0: 1
1: 0
2: 1
3: 22
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152409979 Original CRISPR CCAAGGGTGGGGAGGCCCGA GGG Intergenic
900332739 1:2144349-2144371 GCAGGGCTGGGGAGGCCCGGGGG + Intronic
900366378 1:2313520-2313542 CCAGGGGTGTGGAGGGTCGAGGG + Intergenic
900466745 1:2829301-2829323 CCAAGGGTGGGAAGGACCGTAGG + Intergenic
900522942 1:3114971-3114993 CCAGGGGTGGGGTGGGCCCAGGG - Intronic
900588348 1:3444898-3444920 CCAAGGGTGGGGTGGCCAGCTGG - Intergenic
900950959 1:5858177-5858199 CCCAGGGTGGGGTGGCCTGAGGG - Intergenic
901170337 1:7252481-7252503 CCAAGGGTGGGGAAGCCCAGGGG + Intronic
901364642 1:8735833-8735855 GCAAGGCTGGGGAGGCCTCAGGG - Intronic
902218981 1:14952743-14952765 CCTGGGCTGGGGAAGCCCGAAGG + Intronic
902403207 1:16169220-16169242 CCAAGGGTGGGGATGCACTGGGG - Intergenic
902867507 1:19288991-19289013 CCAAGGGTGAGGGGGTCCAAGGG + Exonic
903360751 1:22775658-22775680 GCCGGGCTGGGGAGGCCCGATGG - Intronic
904330711 1:29756186-29756208 CAGAGGGAGGGGAGGCCGGAGGG + Intergenic
905215265 1:36402014-36402036 CCAAGAGTGGGGAGACTCCAGGG + Intergenic
905275712 1:36816702-36816724 CCAAGGGCGGGAAGCCCCTAGGG + Intronic
905517134 1:38570037-38570059 CAAAGGCTGCGGAGGCGCGAGGG - Intergenic
907474819 1:54698648-54698670 CCGTGGGTGGGGAGGCCAGTGGG + Intronic
908102431 1:60805292-60805314 CCAAGGGTGGGGAGGGGGCATGG + Intergenic
908142803 1:61204658-61204680 CCAAGGGTGGGGGGGGCAGAAGG - Intronic
910393833 1:86771859-86771881 CCAAGGGTGGGCATTCCCGTTGG + Intergenic
915402219 1:155631653-155631675 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
916009878 1:160695012-160695034 CCCAGGTTGGAGAGGCCCCATGG - Intronic
916244205 1:162670888-162670910 ACAAGTGGTGGGAGGCCCGAGGG + Intronic
920450929 1:206060630-206060652 ACATGGGTGAGGAGGCCCCAGGG + Intronic
920550351 1:206855442-206855464 TCAAGGGTGGGGAGGGCGGATGG + Intergenic
922028261 1:221773691-221773713 GGAAGGGTGGGGAGGCCTGTAGG + Intergenic
923790313 1:237106039-237106061 ACAGTGGTGGGGAGGCCAGAGGG + Intronic
1067087490 10:43250616-43250638 CCAAGTGTGGGGTGTGCCGAAGG + Intronic
1067349807 10:45465503-45465525 CCAAGGGTCGGGGGTCCCAAAGG - Intronic
1069834114 10:71297837-71297859 CCAAGGGGAGGGAGGCTGGAGGG + Intronic
1070299670 10:75194041-75194063 AAAAGGGTGGGGAGGCCATAAGG - Intergenic
1070329120 10:75405466-75405488 ACAGGGGTGGGGAGGCCCCCGGG - Intergenic
1071518951 10:86317136-86317158 CCCAGGGTGGGCAGGTCCGGGGG - Intronic
1074140529 10:110668241-110668263 CCTTGGGTGGGGAGGCCAAAAGG + Intronic
1076149422 10:128150265-128150287 CCAAGGATGCGCGGGCCCGAGGG + Intergenic
1076526897 10:131117622-131117644 CCAAGGGTGGGGAGGAAGGGAGG + Intronic
1077585877 11:3452749-3452771 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
1078532061 11:12144376-12144398 CCAGAGGAGGGGAGCCCCGAAGG - Intronic
1080660664 11:34293434-34293456 CCCAGGGTGGAGAGGCCCAAGGG + Intronic
1081527352 11:43936041-43936063 CAAAGGGTGGGCAGGCCTGGGGG - Intronic
1081629844 11:44681638-44681660 CCATGGGTGGGGTGGCCTGGAGG + Intergenic
1082243316 11:49892552-49892574 CAGAGGGCGGGGAAGCCCGAGGG - Intergenic
1082774613 11:57235813-57235835 CAAAGGCCGGGGAGGGCCGAGGG + Exonic
1083300586 11:61737872-61737894 CTAAGGGTGGGGAGGGGCGTGGG - Intronic
1086581169 11:88400577-88400599 CCAAGGATGAGCAGGCCCTAGGG + Intergenic
1086850097 11:91798797-91798819 CCAGGGGTGGGAAGGCCTGAGGG + Intergenic
1087724213 11:101699233-101699255 CCCAGGTTGGAGAGGCCCCATGG - Intronic
1088710023 11:112499473-112499495 CCCAGCGTGGGAAGGCCCCAAGG + Intergenic
1089071158 11:115700684-115700706 CAGAGGGTGGGGAGACCAGAGGG + Intergenic
1089103459 11:115983061-115983083 CCCAGGGGGAGCAGGCCCGAGGG + Intergenic
1089471629 11:118725987-118726009 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
1090199921 11:124846501-124846523 CCAGGGCTGTGGAGGCCCGGGGG + Intergenic
1090752983 11:129763696-129763718 CCACAGGTGGGGAAGCACGAAGG + Intergenic
1091587312 12:1823554-1823576 CCAAGGCTGGGGAGGCCATGGGG - Intronic
1091796846 12:3302270-3302292 CCAAGGGAGGGGAGCCAGGAAGG - Intergenic
1091802633 12:3334202-3334224 CCACGGTTGGGGAGGACCCAGGG - Intergenic
1092294856 12:7189787-7189809 GCAAGGGTGGGGAGGGCCCAGGG - Intronic
1095278986 12:40327245-40327267 TCAAGGGTATGGAGGCCTGAAGG + Intronic
1096106287 12:48998465-48998487 GCAAGGCTGGTGGGGCCCGACGG - Exonic
1096521484 12:52187075-52187097 CCAAGGGAGGAGAGGCCCCAAGG - Intronic
1097330969 12:58332723-58332745 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
1100029156 12:90164607-90164629 CCAAGGGTGTGGAGGACACAAGG - Intergenic
1101445189 12:104732337-104732359 CAAAGGCTGGGGAGGCCCTTAGG - Intronic
1104028310 12:125045651-125045673 ACAAGGGTGGGGAGGCACTGAGG - Intergenic
1104756596 12:131273498-131273520 ACAAAGGTGGGGAGACCTGACGG + Intergenic
1105055416 12:133094445-133094467 CCCAGGTTGGAGAGGCCCCATGG + Intronic
1105413561 13:20191635-20191657 CCCAGGGTCGGGAGGCCAGGAGG - Intronic
1106995871 13:35478858-35478880 CCGAGGACGGGGAGGCCCCAGGG + Intronic
1107450552 13:40504858-40504880 CCAAGGGTGCGGAGTCCCTGGGG - Intergenic
1108185526 13:47884879-47884901 CCAAGGATGGGAAGGGCCAATGG - Intergenic
1108782908 13:53858416-53858438 CCAAGGGTGGGGAGGGGTGGGGG - Intergenic
1111918153 13:94383193-94383215 CATAGGGTGGGGAGGCTGGATGG + Intronic
1112365534 13:98752506-98752528 CCGAGGGCCGGGAGGCGCGAAGG - Intronic
1112370405 13:98788421-98788443 CCAAGGGAGGGGAGGCACGGGGG - Intergenic
1113421431 13:110174375-110174397 CCAGGGGATGGGAGGCCCCAAGG - Intronic
1113779292 13:112966969-112966991 CCAAGGCTGGGCAGGCTGGAGGG + Intronic
1113927361 13:113949166-113949188 CCCAGGCTGGGGAGCCCCCACGG + Intergenic
1114270547 14:21098056-21098078 CCAAGGGAGGGGGGGCCAGGTGG - Intronic
1114273803 14:21123006-21123028 CGAAGGGTGGGGTGCCCCCAGGG + Intergenic
1116498059 14:45586781-45586803 CCAAGGGTGGAGAGGCACAGTGG + Intergenic
1118934436 14:70273784-70273806 CCAAGGGTTGGGAGGTAGGATGG - Intergenic
1120158584 14:81121182-81121204 AAAAGGGTGGGGAGGCATGAAGG + Intronic
1120972855 14:90222979-90223001 CAATGGCTGGGGAGGCCTGAGGG + Intergenic
1122138168 14:99646312-99646334 CCTGGGGTGGAGAGGCCCCAGGG + Intronic
1122302552 14:100739210-100739232 CCTTGGGTGGGGAGACCAGAGGG - Intergenic
1123035956 14:105472051-105472073 CCAAGGGCAGGGAGGCCCTGAGG + Intergenic
1123071785 14:105645729-105645751 CGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123097219 14:105772346-105772368 CGCAGGGTGGGGAGGGCCAAGGG - Intergenic
1123991501 15:25687034-25687056 GAGAGGGTGGGAAGGCCCGAAGG + Intronic
1124962368 15:34408647-34408669 CCAAGGGAGGGCAGGACCGGGGG - Intronic
1124978992 15:34554869-34554891 CCAAGGGAGGGCAGGACCGGGGG - Intronic
1126688444 15:51267933-51267955 CCCAGGGTGGGGAGGGGCGAAGG - Intronic
1127322136 15:57857079-57857101 CCAAGGGTGGGAAGGAGGGATGG - Intergenic
1129271095 15:74419602-74419624 CCAAGGGAGGGGCAGCCCAAGGG + Intronic
1129659039 15:77542904-77542926 CCCGGGGTGGGGAGCCCCGCGGG - Intergenic
1131150459 15:90044332-90044354 GCCAGAGTGGGGAGGCCCGTGGG - Intronic
1131387804 15:92021823-92021845 CCAGGGCTAGGGACGCCCGAGGG + Intronic
1131719292 15:95149842-95149864 CCCAGGGTGGGGAAGCTGGAGGG - Intergenic
1132163703 15:99565525-99565547 CCCAGGGCGGGGCGGCCCGGCGG - Intronic
1132514811 16:361317-361339 TCGAGGGTGGGGTGGGCCGAGGG + Intergenic
1134680871 16:16124599-16124621 CGCAGGGTAGGGAGGGCCGAAGG - Intronic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1138370706 16:56524370-56524392 CCAAGGGTGGGGGAGCCCGATGG + Intergenic
1138485607 16:57341085-57341107 CCGAGGGTTGGGAGGCACTACGG + Intergenic
1139708784 16:68760823-68760845 CCCAGAGTGGGGAGGCCAGGGGG + Intronic
1139951511 16:70674483-70674505 CCAAGGGTGGCGGAGCCCCATGG - Exonic
1141754719 16:85983447-85983469 CCGAGGGTGGGGAGGCTCTAAGG + Intergenic
1142428091 16:90011367-90011389 CCAAGGGAGCTGAGGCCCGCAGG + Intronic
1142715642 17:1745519-1745541 GAGAGGGTGGGGAGGACCGAAGG + Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1144692964 17:17280907-17280929 CCGAGGGAGGGGAGGCCGGCCGG + Intronic
1144783250 17:17818164-17818186 CCAAGGGTGGGGTGGGGCTAGGG + Intronic
1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG + Intergenic
1146373836 17:32281344-32281366 CCCAGGCTGGGGAGGGCCGTGGG - Intronic
1147341679 17:39756216-39756238 CCTGGGGTGGGGAGGCCCTCTGG - Intergenic
1147869787 17:43579099-43579121 CCGAGGGAGGGGACGCCCCAGGG - Intronic
1150450249 17:65260763-65260785 CCAGGGGTGGGGTGGCAAGAGGG - Intergenic
1151517431 17:74605459-74605481 CCAAGGGTGCGGCGGCTCCACGG + Intergenic
1152409979 17:80118254-80118276 CCAAGGGTGGGGAGGCCCGAGGG + Intergenic
1152778451 17:82216035-82216057 CCAAGGGTGCCGAGGCTGGAAGG - Intergenic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1160347949 18:78150468-78150490 GCAAGGCTGGGGAGGCCTCAGGG - Intergenic
1160418271 18:78726949-78726971 CCAGGCGTGGGGAGGCCGGTGGG - Intergenic
1160910914 19:1473450-1473472 CCAAGGGAGGGCAGGCTCCAGGG + Exonic
1161085933 19:2334871-2334893 CCAGGGTTGGGGAGGCCCAGGGG - Intronic
1161387955 19:4007079-4007101 CCATGGGTGGGGAGGCAGGATGG + Intergenic
1161589024 19:5120463-5120485 GGGAGAGTGGGGAGGCCCGAGGG - Intronic
1161628485 19:5339936-5339958 CCCTGGGTGGGGAGGCTGGAAGG + Intronic
1162015918 19:7846427-7846449 CCGAGGGTGGGCAGGCAGGATGG + Intronic
1163175858 19:15563719-15563741 CCAAGGCTGGGGTGGCTCCAGGG + Intergenic
1163311576 19:16518195-16518217 CGAAGGGAGGGGAGGCCAGGAGG - Exonic
1163587433 19:18171789-18171811 CCAGGGTTGGGGAGGGCTGAAGG - Intronic
1164561917 19:29298382-29298404 CCAAGGGTGGGGAGGATGGAGGG + Intergenic
1166663602 19:44663450-44663472 TCAAGGGTGAGGAGGCCAGTGGG + Exonic
1166706945 19:44913253-44913275 CCAAAGGGGGTGAGGCCCGGTGG + Intergenic
1166709119 19:44925808-44925830 CCAAAGGGGGTGAGGCCCGGTGG + Intergenic
1166825571 19:45607052-45607074 CAAAGGATGGGGCGGCCCCAGGG + Intronic
1166932309 19:46308646-46308668 ACAGGGCTGGGGAGGCCCGGGGG - Exonic
925148408 2:1598589-1598611 CCGAGAGTGGGGAGCCCAGAGGG - Intergenic
925364388 2:3301915-3301937 ACAAGGGTCAGGAGGCCAGAAGG + Intronic
926392101 2:12403838-12403860 CCATGGCTGGGGAGGCCTCATGG - Intergenic
926445874 2:12942370-12942392 CCATGGCTGGGGAGGCCTCATGG + Intergenic
927146570 2:20170051-20170073 CCTGGGGTGGGAAGACCCGATGG + Intergenic
927886242 2:26720662-26720684 CCAAGAGTGGGGAGTCCAGGAGG + Intronic
928749233 2:34452828-34452850 ACATGGCTGGGGAGGCCTGAAGG + Intergenic
931348961 2:61471258-61471280 CCGAGGGCGGGGAGGCCGGACGG - Intergenic
932566800 2:72916051-72916073 CCAGGGGTGGGGAGGCGAGGCGG - Intergenic
936040458 2:109145728-109145750 ACACGGGTGGGGAGGCTCAACGG - Intronic
937032537 2:118752751-118752773 GCAAGGCTGGGGAGGCCAGCAGG + Intergenic
938743139 2:134251896-134251918 CCAGGGGTGGGGAGGAGAGAGGG - Intronic
944451686 2:199850679-199850701 CCGCGGGTGGGGAGGCGCGGGGG - Intronic
947390165 2:229630786-229630808 ACAAGAGTGGGGAGGCAGGAAGG - Intronic
947963287 2:234258019-234258041 CCAAGGATGGGAAGGCCGGGAGG + Intergenic
948786841 2:240357154-240357176 GCATGGGCGGGGAGGCCCCACGG + Intergenic
1168799221 20:633749-633771 CCAGGCGTGGGCAGGCCAGAGGG + Intergenic
1169324629 20:4665239-4665261 CCTAGGGAGGGGAGGCCACAGGG - Intergenic
1169386479 20:5154329-5154351 CCAAGGGTGGTGAACCCAGAAGG - Intronic
1171240579 20:23564309-23564331 CCAAAGGCGGGGAGGCCCTGAGG + Intergenic
1171402061 20:24880086-24880108 CCAAGGGTGCTGAGGCCCAGCGG - Intergenic
1172639505 20:36432280-36432302 CCAAGGCTGGGGAGCCCAAACGG + Exonic
1175155416 20:56967987-56968009 CCCAGGGTGGGAAGCCCAGAAGG - Intergenic
1176025858 20:62985328-62985350 CCAAGTGGGTGGAGGCCCCAGGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1177539471 21:22472476-22472498 CCAAGGGTGGGGAGGGAGAAAGG + Intergenic
1178718923 21:34991269-34991291 CCAAGGGAAGAGAGGACCGAGGG - Intronic
1179574749 21:42301137-42301159 GCAAGGGTGGAGAGGACCAAAGG - Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179876854 21:44273036-44273058 CCAGGGGTGGGGGTGCCAGAGGG + Intergenic
1180995218 22:19962140-19962162 CCAGGGGTAGGGAAGCCCCATGG - Intronic
1181312491 22:21952775-21952797 CCAGGGGTGAGGAGGCCGGGGGG - Exonic
1181624884 22:24116529-24116551 CAAAGGGTGGGCAGGCAAGATGG - Intronic
1182112924 22:27735980-27736002 CCAAAGATGGGGAGGGCAGAGGG + Intergenic
1183029791 22:35094869-35094891 CTAAGGCTGGGGAGGCAGGAGGG + Intergenic
1183107140 22:35622721-35622743 CCAAGGCTGGGGAGGGTGGAGGG - Intronic
1183237791 22:36632693-36632715 CCAAGCGAGGGGGTGCCCGAAGG - Intronic
1183455761 22:37922291-37922313 GCAGGGGTGGGGCGGCCCGCAGG - Exonic
1184273023 22:43395578-43395600 CCCAGTGTGGGGGGGTCCGATGG + Intergenic
1184275042 22:43405227-43405249 CTGAGGGTGGGGAGGGCCGGAGG + Intergenic
1184533546 22:45071588-45071610 GCAGGGGTGGGGAGGCGAGAGGG + Intergenic
950004534 3:9683266-9683288 CCAAGGGTGCAGTGGCTCGAGGG - Intronic
950965859 3:17145314-17145336 CCAAAGGTGGTGAGGTCAGAGGG - Intergenic
951563735 3:23992218-23992240 CCAATGGAGGGGAAGCCAGAAGG + Intergenic
952111081 3:30124507-30124529 ACATGGCTGGGGAGGCCTGAGGG + Intergenic
953494034 3:43371391-43371413 CCAAGGCTGGGGTGGCTCGGGGG - Intronic
954371699 3:50172394-50172416 CCAAGGGGAGGGAGAGCCGAGGG - Intronic
956510236 3:69985449-69985471 CAAAGGGTGGGGAGGGGTGATGG + Intergenic
957069454 3:75554582-75554604 CCCAGGTTGGAGAGGCCCCATGG - Intergenic
957857418 3:85895831-85895853 CAAAGGCTGGGGAGGCCTCATGG - Intronic
960847969 3:122022177-122022199 CCGAGGGAGGGGAAACCCGAGGG - Exonic
961559317 3:127717797-127717819 CTAAGGGTGGGAAATCCCGAGGG + Intronic
963695722 3:148564384-148564406 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
964007085 3:151844142-151844164 CCAACCTTGGGGAGGCCTGATGG - Intergenic
968760893 4:2442417-2442439 AGAAGGGCGTGGAGGCCCGAGGG + Intronic
968946814 4:3669217-3669239 CCAAGGCTGGGGAGGCCCAGCGG + Intergenic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
970317004 4:14838806-14838828 CCAAGGGTGAGCAGGACAGAGGG + Intergenic
976035896 4:80820555-80820577 CCAAGGGTGGGGAGGGACGGAGG + Intronic
976225021 4:82789078-82789100 GCAACAGTGGGGAGGCCTGAGGG - Intronic
979431551 4:120638855-120638877 AGAAGGGTGGGGAGACTCGATGG + Intergenic
983905609 4:173178567-173178589 CCAAGGCTGGGAAGCCCAGAAGG - Intronic
985776453 5:1846556-1846578 CCAGGGGTGGGGAGGGCGGTGGG + Intergenic
986127806 5:4899501-4899523 CCATGCGTGGGGAGGCTCCACGG - Intergenic
991621338 5:68548579-68548601 CCAGGGAAGGGGAGGCCCTAGGG - Intergenic
991704447 5:69344787-69344809 GCATGGCTGGGGAGGCCTGAGGG - Intergenic
992487298 5:77209887-77209909 CCAAGGGATGGGAGGCCCTGCGG - Intergenic
993168266 5:84384190-84384212 CCAAGGGTGGCGAGCGCCGCTGG - Intronic
993207862 5:84908145-84908167 GGAAGGGTGGGGAGGGGCGAGGG - Intergenic
995272900 5:110242576-110242598 CCAATGTTGGGGAGGCCTGGTGG - Intergenic
995869644 5:116730969-116730991 CCAAAGGTGGGGAGCCCTGGAGG - Intergenic
998691691 5:144594995-144595017 CCAAGGCTGAGGAGGCACCAAGG - Intergenic
1001277230 5:170359732-170359754 GCAAGGGTGGTGAGGCCAGTAGG - Intronic
1001458159 5:171883377-171883399 CCCAGTGTGGGGAGGCGGGAGGG + Intronic
1003106546 6:3220987-3221009 CGAGGGGTGGGGAGGCAGGAAGG + Intergenic
1004356442 6:14933520-14933542 CTGAGGGTGGGAAGGCCAGAGGG + Intergenic
1005610511 6:27519272-27519294 CCGAGGCTGGGGAGCCCCGCAGG + Intergenic
1006271312 6:32969103-32969125 CCAATGGTGGGGAGTCCGGGAGG + Intronic
1007381461 6:41492785-41492807 CCAAGGCTGGGGAGAAACGATGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1013633728 6:112009294-112009316 GCAATGGTGGGAAGGGCCGAGGG - Intergenic
1015984590 6:138872463-138872485 CCCAGGGTGGGAACGCCAGATGG + Intronic
1018447825 6:163874477-163874499 CCATGGGTGGGGAGGCCTCAAGG + Intergenic
1018523425 6:164679189-164679211 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1019186449 6:170223371-170223393 CCAAGGGAGAGCAGGCCAGAGGG - Intergenic
1022465231 7:30649079-30649101 CCTAGGGCTGGGAGGCCCAATGG - Intergenic
1023986484 7:45100118-45100140 CCAAGCCTGGGAAGGCCCCAGGG + Exonic
1024729505 7:52238812-52238834 GGAAGGGTGGGGAGGACAGAGGG - Intergenic
1024894875 7:54246217-54246239 CCAGGGGTGGGGAGACCCCTGGG - Intergenic
1025245493 7:57313467-57313489 GCAAGGGTGGGGTGGGCTGAAGG + Intergenic
1029110845 7:98212370-98212392 CCCGGGGAGGGGACGCCCGACGG + Exonic
1032333994 7:131007585-131007607 CCAAGGGTGGGGAGAGAGGAGGG + Intergenic
1035059631 7:156059461-156059483 CAAGGGGTGGGGAGGTCCCAGGG + Intergenic
1035287252 7:157814383-157814405 AGAAGGGTGGGGAGGCCACAAGG + Intronic
1036376156 8:8201347-8201369 CCCAGGTTGGAGAGGCCCCATGG - Intergenic
1036853373 8:12221791-12221813 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
1036874749 8:12464313-12464335 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
1040074001 8:43211253-43211275 GCAAGGGTGTGGAGGCACAAGGG - Intergenic
1040317152 8:46270002-46270024 CCCAGGTTGGAGAGGCCCTATGG + Intergenic
1043345705 8:79295837-79295859 GCAAGGATGGAGAGGCCCCAGGG - Intergenic
1043506539 8:80908449-80908471 CCAAGGCTGTGGAGGCCTGTTGG - Intergenic
1047894922 8:129356254-129356276 CCAAGGCTGGGGTGGACAGAGGG - Intergenic
1048882731 8:138883781-138883803 GCATGGCTGGGGAGGCCCCAGGG - Intronic
1049419392 8:142510342-142510364 CCAGGGGTGATGAGGCCCGGGGG + Intronic
1049436055 8:142586782-142586804 CCAAGGGTGAGGAGGAGCAAAGG + Intergenic
1049439362 8:142602177-142602199 CCAGGGGTGGGGAAGCCCTGCGG - Intergenic
1049978256 9:880795-880817 GCAAGGGTGGGGAAGGCCGCTGG - Intronic
1050098514 9:2093535-2093557 CCAATGGTGGTGAGGCCTTATGG + Intronic
1051242569 9:15075362-15075384 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1056523564 9:87422027-87422049 CCAAGGGAACTGAGGCCCGAAGG - Intergenic
1056630361 9:88288293-88288315 CAAAGGATGGGGAGGCACCAGGG - Intergenic
1056917286 9:90756815-90756837 CCAAGGCTGGGGCTGCCAGAAGG + Intergenic
1060475523 9:123983787-123983809 GCAATGGTGGGGAGACCCGAGGG + Intergenic
1060985877 9:127818673-127818695 CCAGGAGCTGGGAGGCCCGAGGG + Intronic
1061551019 9:131334801-131334823 CCAGGGGTGGGCAGGGCCGGTGG + Intergenic
1061589216 9:131588055-131588077 TCAGGGGTGGGGAGGCCGGTGGG + Intronic
1062145582 9:134988008-134988030 CCCAGGGTGGGGAAGGCCAAGGG - Intergenic
1062439147 9:136561845-136561867 CCAGTGGTGGGGAGGCCCCGTGG + Intergenic
1062497537 9:136838784-136838806 CCTGGGGTGGGGTGGCCCCACGG + Intronic
1062583991 9:137240842-137240864 CCGAGGGAGGGCGGGCCCGACGG - Intergenic
1187090120 X:16087707-16087729 GCAAGGGAGGGGAGGCAAGAAGG + Intergenic
1188208637 X:27392107-27392129 CCAAAAGTGGGGAGGCTGGAGGG + Intergenic
1188662483 X:32776475-32776497 ACATGGGTGGGGAGGCCCCCAGG + Intronic
1191062217 X:56310661-56310683 CCCAAGGTGGGGAGGCCACATGG + Intergenic
1191939797 X:66466198-66466220 CCCAGGTTGGAGAGGCCCCATGG + Intergenic
1192533866 X:71911602-71911624 CCCAGGGTCGGGAGTCCCAAGGG - Intergenic
1192591451 X:72363317-72363339 CCAAGGGTGGGGATGGAAGAAGG + Intronic
1195881818 X:109600777-109600799 TTAAGGATGGGCAGGCCCGAGGG + Intergenic
1197799005 X:130329497-130329519 CCAGGGGTGGGGAGATCAGATGG - Intergenic
1197936072 X:131741484-131741506 CCAAGTGTGGGCAGGACTGAAGG + Intergenic
1198311021 X:135425796-135425818 CCCCGGGTGGAGAGGCCCCATGG + Intergenic
1200000022 X:153055661-153055683 CCAAGGAAGGGCAGGCCCAAGGG + Intergenic
1200227844 X:154428924-154428946 CGAGGGGTGGTGAGGCCCGGAGG + Intronic