ID: 1152410310

View in Genome Browser
Species Human (GRCh38)
Location 17:80119736-80119758
Sequence CAGCCGGGCAGCGGTCGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152410310_1152410322 19 Left 1152410310 17:80119736-80119758 CCAACGCGACCGCTGCCCGGCTG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1152410322 17:80119778-80119800 GCCGGTCCCCGAGCAAGCCTGGG 0: 1
1: 0
2: 2
3: 6
4: 57
1152410310_1152410327 27 Left 1152410310 17:80119736-80119758 CCAACGCGACCGCTGCCCGGCTG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1152410327 17:80119786-80119808 CCGAGCAAGCCTGGGAACTCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1152410310_1152410321 18 Left 1152410310 17:80119736-80119758 CCAACGCGACCGCTGCCCGGCTG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1152410321 17:80119777-80119799 TGCCGGTCCCCGAGCAAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 76
1152410310_1152410319 1 Left 1152410310 17:80119736-80119758 CCAACGCGACCGCTGCCCGGCTG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1152410319 17:80119760-80119782 CCAGAGGGCTGGATGCCTGCCGG 0: 1
1: 0
2: 2
3: 24
4: 262
1152410310_1152410314 -10 Left 1152410310 17:80119736-80119758 CCAACGCGACCGCTGCCCGGCTG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1152410314 17:80119749-80119771 TGCCCGGCTGCCCAGAGGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152410310 Original CRISPR CAGCCGGGCAGCGGTCGCGT TGG (reversed) Intergenic