ID: 1152411831

View in Genome Browser
Species Human (GRCh38)
Location 17:80129152-80129174
Sequence GCTCCTGAAACCACTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152411820_1152411831 0 Left 1152411820 17:80129129-80129151 CCATCCCCCTCCTCCCCCCTCAA No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411821_1152411831 -4 Left 1152411821 17:80129133-80129155 CCCCCTCCTCCCCCCTCAAGCTC No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411818_1152411831 11 Left 1152411818 17:80129118-80129140 CCTTGTTTCACCCATCCCCCTCC No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411822_1152411831 -5 Left 1152411822 17:80129134-80129156 CCCCTCCTCCCCCCTCAAGCTCC No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411825_1152411831 -10 Left 1152411825 17:80129139-80129161 CCTCCCCCCTCAAGCTCCTGAAA No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411817_1152411831 16 Left 1152411817 17:80129113-80129135 CCACTCCTTGTTTCACCCATCCC No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411819_1152411831 1 Left 1152411819 17:80129128-80129150 CCCATCCCCCTCCTCCCCCCTCA No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411823_1152411831 -6 Left 1152411823 17:80129135-80129157 CCCTCCTCCCCCCTCAAGCTCCT No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data
1152411824_1152411831 -7 Left 1152411824 17:80129136-80129158 CCTCCTCCCCCCTCAAGCTCCTG No data
Right 1152411831 17:80129152-80129174 GCTCCTGAAACCACTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152411831 Original CRISPR GCTCCTGAAACCACTGTGAA TGG Intergenic
No off target data available for this crispr