ID: 1152412523

View in Genome Browser
Species Human (GRCh38)
Location 17:80135347-80135369
Sequence CCGTCTCCCTTCCTTTGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152412523_1152412528 29 Left 1152412523 17:80135347-80135369 CCTCTTCAAAGGAAGGGAGACGG 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1152412528 17:80135399-80135421 AAACCCCATTAAGTAGAATCTGG 0: 1
1: 1
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152412523 Original CRISPR CCGTCTCCCTTCCTTTGAAG AGG (reversed) Exonic
902289951 1:15429159-15429181 CCGTCTCCCAGCCTGGGAAGGGG - Exonic
902613992 1:17613871-17613893 CGGTTTCCCTGCCTTTGAAATGG + Intronic
903062949 1:20682995-20683017 CGGTTTCCCTCCCTGTGAAGTGG - Intronic
904614966 1:31744614-31744636 CCGCCTCCCTTCCTCTGCGGCGG - Intronic
906069471 1:43006765-43006787 CCTCCTCGCTTCCTTTGATGTGG + Intergenic
916167342 1:161975906-161975928 CTGTGTCTCTTCCTTTCAAGTGG + Intergenic
920242905 1:204566581-204566603 TCGTTTCCCTTCCTTAGATGGGG - Intergenic
920293185 1:204938543-204938565 CCGGCTCCCATACTTTTAAGTGG + Intronic
922090970 1:222394745-222394767 CCCTCTCCCCTCCTTTGCATGGG + Intergenic
923305129 1:232681665-232681687 AGGTCCCCCTTCCTTTGGAGTGG + Intergenic
923541280 1:234889972-234889994 CCATCTCCATTCCTTTCATGGGG - Intergenic
1063314644 10:4990388-4990410 CCTTCTGCCTTACATTGAAGAGG + Intronic
1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG + Intronic
1067787629 10:49262200-49262222 TCTTCTCTCTTCCATTGAAGAGG - Intergenic
1068499247 10:57822073-57822095 CTGGCTCACTTGCTTTGAAGAGG - Intergenic
1071219856 10:83452663-83452685 CTGTCTCTTTTCCTTAGAAGAGG - Intergenic
1077358166 11:2128122-2128144 CCCTCTCCCTTCCCTTGGAGTGG + Intergenic
1082814499 11:57499370-57499392 CCTTCCCCCTTCCCCTGAAGTGG + Intronic
1085498796 11:76998003-76998025 CCCTCTCCCTTCCTTCTTAGAGG - Intronic
1090161703 11:124502043-124502065 CCACCTCCCTTCCTAGGAAGTGG - Intergenic
1090482432 11:127080215-127080237 CCGTCTCCCTTCCTCAGGGGCGG + Intergenic
1096914420 12:55016533-55016555 CTGTCTCCATACCTTTGAATGGG + Intergenic
1099120219 12:78680406-78680428 CCAGCTCTCTTCCTTTGAACAGG - Intergenic
1100457619 12:94767722-94767744 CAGCCACCCTTCCTTTTAAGAGG - Intergenic
1100737752 12:97556337-97556359 CTGACTCCCTTCCTTTCTAGGGG - Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1101557467 12:105823832-105823854 CTGTTTCCTTACCTTTGAAGGGG - Intergenic
1103866224 12:124054111-124054133 TCCACTCACTTCCTTTGAAGTGG + Intronic
1103954827 12:124570078-124570100 CCCTCTCCCTTCCTGTAAAATGG - Intergenic
1105002629 12:132701230-132701252 CCGCCTTCCCTCCTTTGCAGGGG + Exonic
1109332262 13:60944369-60944391 GCATTTCCCTTCCTTTGAAATGG - Intergenic
1110366084 13:74687547-74687569 CGGTCTGCCTTCTTTTGAAAAGG + Intergenic
1113885230 13:113655312-113655334 CAGTTTCCCTTCCTGTGATGGGG - Intronic
1116479970 14:45385622-45385644 CCATCTCCCTTCTTTTGGAAAGG - Intergenic
1121807439 14:96841883-96841905 CTTTCTCCTTCCCTTTGAAGGGG + Intronic
1122610061 14:102976267-102976289 CCATTTCCCCTCCTTTGCAGAGG - Intronic
1127380751 15:58428766-58428788 CTGTCTCCCTTCCACTTAAGAGG - Intronic
1127781502 15:62320446-62320468 CTGTTTCCCTTCCTTTCAATGGG - Intergenic
1128822395 15:70670576-70670598 CCGAATCCTTTCCTCTGAAGAGG + Intronic
1130859795 15:87875767-87875789 CTGGCTCCCTTCCTTGGCAGTGG + Intronic
1131369402 15:91867174-91867196 CCTGCTCCCCTGCTTTGAAGTGG + Intronic
1134203949 16:12221967-12221989 CCTTCTCCCTGCCTTGGAACTGG + Intronic
1135895616 16:26399240-26399262 CTTTCTCCCTTTATTTGAAGGGG + Intergenic
1139016536 16:62696324-62696346 CCAGCTCCCTTCCATAGAAGTGG - Intergenic
1142125998 16:88411001-88411023 CCGTCTCCCTTCTCTTCATGGGG + Intergenic
1147263022 17:39219779-39219801 CCGTCTCCCTTCCCGTTGAGAGG + Intronic
1149114159 17:53071700-53071722 CCTTCTTCCTTCCTTAGAACTGG - Intergenic
1152412523 17:80135347-80135369 CCGTCTCCCTTCCTTTGAAGAGG - Exonic
1153675917 18:7455468-7455490 CCTTCTCCCTTCCTCTCAGGCGG + Intergenic
1157086693 18:44587424-44587446 CCATCTCCCCTCCTTTCAAAGGG + Intergenic
1157256034 18:46140476-46140498 CCTTTTCCTTTCCTTTGACGGGG + Intergenic
1157433141 18:47646579-47646601 CCGTCTCTCCTTCTTTCAAGTGG - Intergenic
1157495878 18:48157060-48157082 CCCTCTCCCACCCTTTGAAATGG - Intronic
1157687742 18:49656365-49656387 CACTCTCCCTGCCTGTGAAGCGG - Intergenic
1158864107 18:61620442-61620464 CCTTCTCCCTTTCTGGGAAGTGG + Intergenic
1159263146 18:66042634-66042656 CCTACTCCCTTCCATAGAAGAGG + Intergenic
929455537 2:42062206-42062228 CCCACTCCCTTCCTTTGGTGGGG - Intergenic
930370439 2:50494586-50494608 CCGTCTCCCTTCTTTCACAGTGG - Intronic
935827723 2:106968329-106968351 CCATCTCCCCTCCTTGGAGGTGG - Intergenic
937282955 2:120732955-120732977 CCTTCTCCCTTTCTGTGAAATGG - Intergenic
937707167 2:124934487-124934509 TCTGCTCCCCTCCTTTGAAGGGG - Intergenic
941225024 2:162838357-162838379 CGGTCTCCCCACCTTGGAAGCGG + Intronic
941725681 2:168857564-168857586 CCCTTTCCCTTCCTCTGAAGTGG - Intronic
944328825 2:198440919-198440941 CCCTTTCCATTGCTTTGAAGAGG - Intronic
946149883 2:217757003-217757025 TTGTGTCCCTTCCTTGGAAGAGG - Intergenic
947748546 2:232521618-232521640 CCGCCTCCCTGCCTTTGCACAGG - Intronic
947794148 2:232883770-232883792 CAGTTTCCCTTCCTGTAAAGTGG - Intronic
1174900216 20:54491661-54491683 CAGTCACCCTTCCTGTGCAGAGG - Intronic
1176104146 20:63377800-63377822 CCGTCTCCCTGCTGCTGAAGGGG - Intronic
1178321471 21:31609310-31609332 CCGGCTCCCTTGCCTCGAAGTGG - Intergenic
1184795245 22:46728377-46728399 CAGAGTCCCTGCCTTTGAAGAGG + Intronic
952179844 3:30906223-30906245 CCATTCCCCTTCCTTTGAGGTGG - Intergenic
954622107 3:52002247-52002269 CCATCTCCCCACCTGTGAAGTGG - Intergenic
954947854 3:54442354-54442376 CCTTCTCCCTTCCTTTGGCCTGG + Intronic
954952819 3:54490273-54490295 CTGTTTCTCTTCCTGTGAAGTGG - Intronic
955828561 3:62976200-62976222 CAGTCTCCCTTCATTTTAATAGG + Intergenic
956439836 3:69269388-69269410 CAGTCTCCCCACCTATGAAGGGG - Intronic
957347793 3:78984236-78984258 CCATTTCCCTTTCTTTAAAGTGG - Intronic
962597319 3:136959838-136959860 CAGTTTCCCTTCCTGTGAAATGG + Intronic
963366806 3:144345395-144345417 CAGTCTTTCCTCCTTTGAAGTGG + Intergenic
964670130 3:159216029-159216051 TTTTCTCCCTTCCCTTGAAGAGG + Intronic
965375689 3:167921040-167921062 CCATGTGCCTTCCTTGGAAGAGG + Intergenic
967777402 3:193398717-193398739 CTGTCTCTCTTCTTTTGATGAGG - Intergenic
968360013 3:198140002-198140024 CAGTCTCCCGTCCTGTGAAATGG + Intergenic
969601096 4:8176850-8176872 CCCTCTCCCATCCATGGAAGGGG + Intergenic
970600629 4:17638793-17638815 CAGTCTCCCTTCATTTTATGAGG - Intronic
971295461 4:25385842-25385864 CCCTCTCTCTTCCTTTGCACAGG - Intronic
978728030 4:111993347-111993369 GCGTTTTCCTTTCTTTGAAGAGG - Intergenic
981201400 4:141983769-141983791 TCGTCTCCCTGCCTGTGCAGGGG + Intergenic
985378805 4:189370963-189370985 CAGTCTCCCCTTCTGTGAAGGGG + Intergenic
988897981 5:35698858-35698880 ACCTCCCCCTTCCTCTGAAGTGG + Intronic
1000316053 5:160092766-160092788 CTTTTTCTCTTCCTTTGAAGAGG + Exonic
1002058163 5:176610331-176610353 CAGTCTCCCTGTCTGTGAAGTGG - Intergenic
1003247882 6:4399699-4399721 CCTTCTTCTTTCCTATGAAGGGG - Intergenic
1009608069 6:65899597-65899619 CATTCTCCCTTCTTTTGAATAGG - Intergenic
1014397287 6:120940803-120940825 CCTTTTCCTTTCTTTTGAAGAGG + Intergenic
1019998230 7:4738920-4738942 CTGAGTCACTTCCTTTGAAGCGG + Intronic
1021359105 7:19689839-19689861 CCTTCTGCCTGCATTTGAAGGGG + Intergenic
1021490385 7:21213977-21213999 CTGTCTTCCTTCCTTTAAAAGGG + Intergenic
1022622877 7:32002763-32002785 CTGTCCCTCTTCCTTTGAACTGG + Intronic
1025155817 7:56605429-56605451 CCGACTCCCTCCCTGGGAAGCGG - Intergenic
1025812098 7:64882010-64882032 CCGTGTCCTTTCCTTTGTCGTGG + Intronic
1030341385 7:108384513-108384535 AAATCTCCTTTCCTTTGAAGAGG - Intronic
1030457660 7:109794542-109794564 CAGCCTCCCTTTCATTGAAGGGG + Intergenic
1031476349 7:122227323-122227345 CCCTCTCCCTTCATCTGAGGGGG - Intergenic
1033008135 7:137589789-137589811 CCTTCTTCCTTCTTTGGAAGGGG - Intronic
1035336791 7:158134579-158134601 CCGTCTCCCCTTCTGTGAACTGG - Intronic
1037989193 8:23308519-23308541 CTGTCTCCCTTCCTTTCCAAGGG + Intronic
1040446062 8:47494759-47494781 AAGTCTCCCTTGCTTTCAAGAGG - Intronic
1045325057 8:101111891-101111913 CCCCATCCCTTCCTTTGCAGGGG - Intergenic
1047337222 8:123947907-123947929 CCGTAGGCCTTCCATTGAAGGGG - Intronic
1047719902 8:127630097-127630119 GCCTGTCCCTTCCTTTTAAGAGG - Intergenic
1048680045 8:136831511-136831533 CCGTCTCATGTCCTGTGAAGGGG - Intergenic
1048943071 8:139419307-139419329 CAGTCTCCCTTCCTATGAAATGG + Intergenic
1051855914 9:21565235-21565257 CCATTTCCCTTCCTTTGTAATGG + Intergenic
1052419419 9:28223302-28223324 CCGTCTCACATCCTCTGGAGGGG + Intronic
1054425402 9:65062223-65062245 CCGTCACCCTTTCTTTGACTCGG - Intergenic
1055232522 9:74083470-74083492 TAGTCTGCTTTCCTTTGAAGTGG - Intergenic
1058628823 9:106964545-106964567 CAGTTTCCATTTCTTTGAAGTGG + Intronic
1058679015 9:107425345-107425367 CAGTCTACATTCCTCTGAAGAGG + Intergenic
1060154148 9:121307591-121307613 CAGTTTCCTTGCCTTTGAAGTGG + Intronic
1062744719 9:138203843-138203865 CAGTCTCCCGTCCTGTGAAATGG + Intergenic
1185761475 X:2692176-2692198 CTGTTTCCCTCCCTTTGAAACGG + Intronic
1191182588 X:57579108-57579130 CTGTCTCCCTTCTTTTCAAAAGG + Intergenic
1193406172 X:81105452-81105474 TGATGTCCCTTCCTTTGAAGTGG + Intergenic
1194129777 X:90066990-90067012 CCATCTCCCTTTCTCTAAAGAGG + Intergenic
1196375373 X:115027255-115027277 CCCTCTCCCTTCCCTGGATGAGG + Intergenic
1196599838 X:117589491-117589513 CCGCCTCCCTTGGTTGGAAGTGG - Intergenic
1199640411 X:149855687-149855709 ATATCTCCCTTCCTTTGAAGAGG - Intergenic
1201975069 Y:19839990-19840012 CTGTCACCCTTTCTTTGAATAGG + Intergenic