ID: 1152414058

View in Genome Browser
Species Human (GRCh38)
Location 17:80147498-80147520
Sequence TCTGGGGACCCCGCCCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152414058_1152414067 10 Left 1152414058 17:80147498-80147520 CCGCTCCGGGCGGGGTCCCCAGA No data
Right 1152414067 17:80147531-80147553 TCGAATAAAAATGACGAGCACGG No data
1152414058_1152414069 22 Left 1152414058 17:80147498-80147520 CCGCTCCGGGCGGGGTCCCCAGA No data
Right 1152414069 17:80147543-80147565 GACGAGCACGGGTCCTCTCTCGG No data
1152414058_1152414068 11 Left 1152414058 17:80147498-80147520 CCGCTCCGGGCGGGGTCCCCAGA No data
Right 1152414068 17:80147532-80147554 CGAATAAAAATGACGAGCACGGG No data
1152414058_1152414070 23 Left 1152414058 17:80147498-80147520 CCGCTCCGGGCGGGGTCCCCAGA No data
Right 1152414070 17:80147544-80147566 ACGAGCACGGGTCCTCTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152414058 Original CRISPR TCTGGGGACCCCGCCCGGAG CGG (reversed) Intergenic
No off target data available for this crispr