ID: 1152415804

View in Genome Browser
Species Human (GRCh38)
Location 17:80160997-80161019
Sequence GTGGAGTCGTATCCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152415795_1152415804 11 Left 1152415795 17:80160963-80160985 CCAGTTATCCCAATCTGTGGTCA No data
Right 1152415804 17:80160997-80161019 GTGGAGTCGTATCCCTTGGTGGG No data
1152415796_1152415804 3 Left 1152415796 17:80160971-80160993 CCCAATCTGTGGTCAGCCTATCG No data
Right 1152415804 17:80160997-80161019 GTGGAGTCGTATCCCTTGGTGGG No data
1152415797_1152415804 2 Left 1152415797 17:80160972-80160994 CCAATCTGTGGTCAGCCTATCGC No data
Right 1152415804 17:80160997-80161019 GTGGAGTCGTATCCCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152415804 Original CRISPR GTGGAGTCGTATCCCTTGGT GGG Intergenic
No off target data available for this crispr