ID: 1152419379

View in Genome Browser
Species Human (GRCh38)
Location 17:80183899-80183921
Sequence CCATGAGACCTGTGGGCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152419379_1152419391 28 Left 1152419379 17:80183899-80183921 CCATCTGCCCACAGGTCTCATGG 0: 1
1: 0
2: 7
3: 28
4: 252
Right 1152419391 17:80183950-80183972 TGGGGCCATCGGCAGCCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 199
1152419379_1152419385 8 Left 1152419379 17:80183899-80183921 CCATCTGCCCACAGGTCTCATGG 0: 1
1: 0
2: 7
3: 28
4: 252
Right 1152419385 17:80183930-80183952 AAGCTGACCGAGTGCCTGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
1152419379_1152419386 9 Left 1152419379 17:80183899-80183921 CCATCTGCCCACAGGTCTCATGG 0: 1
1: 0
2: 7
3: 28
4: 252
Right 1152419386 17:80183931-80183953 AGCTGACCGAGTGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 139
1152419379_1152419387 10 Left 1152419379 17:80183899-80183921 CCATCTGCCCACAGGTCTCATGG 0: 1
1: 0
2: 7
3: 28
4: 252
Right 1152419387 17:80183932-80183954 GCTGACCGAGTGCCTGGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 173
1152419379_1152419389 17 Left 1152419379 17:80183899-80183921 CCATCTGCCCACAGGTCTCATGG 0: 1
1: 0
2: 7
3: 28
4: 252
Right 1152419389 17:80183939-80183961 GAGTGCCTGGCTGGGGCCATCGG 0: 1
1: 0
2: 2
3: 33
4: 352
1152419379_1152419383 4 Left 1152419379 17:80183899-80183921 CCATCTGCCCACAGGTCTCATGG 0: 1
1: 0
2: 7
3: 28
4: 252
Right 1152419383 17:80183926-80183948 ATCCAAGCTGACCGAGTGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152419379 Original CRISPR CCATGAGACCTGTGGGCAGA TGG (reversed) Exonic
900242395 1:1623375-1623397 GCTCGGGACCTGTGGGCAGAGGG - Exonic
900242410 1:1623417-1623439 GCTCGGGACCTGTGGGCAGAGGG - Exonic
900253488 1:1684079-1684101 CCAGGAGACCCGTGGGCCGCAGG + Intronic
901230488 1:7639319-7639341 CCAGAATACCTGTGGGCAGCTGG + Intronic
901574493 1:10189885-10189907 CCATAAGACCTCTGGGCTGCTGG - Intergenic
904312135 1:29635718-29635740 CCATGAAGCCTGAGGGCAGGTGG - Intergenic
904411771 1:30329029-30329051 CCACCAGTCCTGAGGGCAGAAGG - Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905253874 1:36667396-36667418 CCCTGAGACCTCTGGTCAGCTGG + Intergenic
905462128 1:38128924-38128946 CCATGTGAGGTGTGGCCAGAGGG - Intergenic
906216169 1:44042044-44042066 CCAGGGGCCGTGTGGGCAGAAGG - Intergenic
906279152 1:44541845-44541867 CCAGGAGACATATGGGAAGAAGG - Intronic
907291286 1:53414691-53414713 CCCTGATAGCTGTTGGCAGACGG + Intergenic
907677256 1:56529939-56529961 TCATGAGACTTGTGGGCACAGGG - Intronic
913140039 1:115932025-115932047 CCATGAGAGCTGTGGTCTGTTGG + Intergenic
913171404 1:116235532-116235554 TCATGATACCTGGGGGCAGGTGG + Intergenic
915123790 1:153649327-153649349 CCATGGGGGATGTGGGCAGATGG + Intergenic
915496628 1:156286441-156286463 CAAAGAGACCAGTGAGCAGAGGG - Exonic
921338080 1:214108006-214108028 CAATGAGGCCTGTGTGCAGTGGG - Intergenic
921969813 1:221135754-221135776 CCCGGAGGCCTGTGGGCAGTGGG + Intergenic
922143793 1:222917955-222917977 CTGTCAGACCTCTGGGCAGAAGG + Intronic
922159981 1:223072442-223072464 CCATGTTACCTTTGGGCTGAAGG + Intergenic
922239753 1:223748024-223748046 CCAGGGAACCTGTGGTCAGAGGG - Intronic
922611988 1:226937461-226937483 ACAGGATACCTGTGGTCAGAAGG - Intronic
923216360 1:231851696-231851718 CCATGAGAAGTGAGGACAGAAGG + Intronic
923298494 1:232618278-232618300 CCCAGAGACCTGGGGGCGGAAGG + Intergenic
924029851 1:239875211-239875233 CCATGAGGCTTGAGAGCAGATGG + Intronic
924259215 1:242212412-242212434 CCATGCGAGCGGTGGGCAGAAGG + Intronic
924455750 1:244217655-244217677 CCAGGACACCAGTGGGCAGGAGG + Intergenic
924904002 1:248432931-248432953 CCGTCAGACCTCTGGGCAGAAGG + Intergenic
924923870 1:248659067-248659089 CCGTCAGACCTCTGGGCAGAAGG - Intergenic
1062898203 10:1121097-1121119 CCATGGGACCTGTGGGCTGAGGG + Intronic
1063445566 10:6112457-6112479 CAATGAGGCGTGTGGCCAGAGGG + Intronic
1063597874 10:7453561-7453583 CCATAAGACTTGGGGGCACAGGG - Intergenic
1064417050 10:15159050-15159072 TGGTGAGACCTGTGGGCAAAGGG - Intronic
1064424906 10:15222047-15222069 CGATGGCAGCTGTGGGCAGAAGG + Intronic
1066454851 10:35564326-35564348 CACTGGGACCTGTGGGCAGGCGG - Intronic
1067096056 10:43300861-43300883 CCGCCAGACCTCTGGGCAGAAGG - Intergenic
1067252838 10:44602175-44602197 ACATTAGAAATGTGGGCAGATGG + Intergenic
1067661767 10:48241414-48241436 CCATGAGACCTGAGTGGAGCTGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1070313352 10:75289311-75289333 CCCAGAGGCCTGTGGGCAGGCGG - Intergenic
1073493686 10:103872545-103872567 CCATGACACCTGTTGCCAGAGGG - Intergenic
1075740478 10:124692976-124692998 CCATGAGAGCTGGGGACAGTTGG - Intronic
1076258104 10:129044846-129044868 CCAGGAGGCCAGTGGGCAGTCGG + Intergenic
1076402476 10:130193091-130193113 CCATGGGGACTGTGGGCAGATGG - Intergenic
1078413987 11:11150228-11150250 CCTTGAGACTTGTGGGGAAAGGG + Intergenic
1078426314 11:11253857-11253879 CCAGGACACCTGCAGGCAGAAGG - Intergenic
1078456880 11:11482405-11482427 GAATGAGGCCTCTGGGCAGATGG + Intronic
1078467434 11:11560619-11560641 CCATGATGCCTGTAGCCAGAGGG - Intronic
1078679726 11:13463944-13463966 CCATGAGCTCTGGGAGCAGACGG + Intergenic
1082183654 11:49151772-49151794 CCATGAGACATTTTGTCAGAGGG + Intronic
1083188998 11:61036057-61036079 CCGTGTGACCTGTGGGCTTATGG - Intergenic
1083891937 11:65599884-65599906 CCATGGGACCTGTGGGACCAGGG - Intronic
1084514053 11:69626254-69626276 GCATGAGGCCTGTGGGCCGTGGG - Intergenic
1085427649 11:76419301-76419323 TCATTTGAGCTGTGGGCAGAAGG + Intergenic
1085692119 11:78672370-78672392 CCATGAGAACTTTGGTCTGATGG + Intronic
1085695170 11:78697964-78697986 CCAGCAGACCTGTGGGCTGAGGG + Intronic
1087323722 11:96695973-96695995 TCATGATACATGAGGGCAGAAGG + Intergenic
1088428154 11:109728069-109728091 CTATGAGAACTGTGAGTAGAGGG + Intergenic
1089826640 11:121283837-121283859 CCGCCAGACCTCTGGGCAGAAGG + Intergenic
1090183424 11:124720186-124720208 CCAGGAGACCTCTGGGTTGATGG - Intergenic
1090446507 11:126769137-126769159 AGATGGGACCTGTGGGAAGAGGG - Intronic
1091020575 11:132096019-132096041 TCATGGGGCCTGGGGGCAGAGGG - Intronic
1091037064 11:132243970-132243992 CCATGAGACGGGATGGCAGACGG - Intronic
1096193355 12:49633973-49633995 CCAGGAGGCCTGTGGGCACTGGG - Exonic
1101746217 12:107543921-107543943 CCAGGTCACCTGTGGACAGAAGG - Exonic
1101961762 12:109256126-109256148 CCTTCAGAGCTGTGGACAGAAGG - Exonic
1102439314 12:112949166-112949188 CCATGAGAACTGTGTTCACAAGG + Exonic
1103643267 12:122370078-122370100 GCTTGAGCCCTGTAGGCAGAGGG + Intronic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1107189290 13:37560273-37560295 CCGTCAGACCTCTGGGCAGAAGG + Intergenic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1108459105 13:50647345-50647367 CCATGGCACCTGTGGTGAGAGGG + Intronic
1108556183 13:51595192-51595214 CCAGGAGACCAGTGGGGACAAGG - Intronic
1109674590 13:65658376-65658398 CCATGAGTAATGTGGGCACAAGG + Intergenic
1110198715 13:72822880-72822902 CCATGAGAGCTGTGCTCAGTGGG + Intronic
1110866162 13:80398690-80398712 CCGTCAGACCTCTGGGCAGAAGG + Intergenic
1111328304 13:86729380-86729402 CCATGAGATCTGTGGACAAGGGG + Intergenic
1112322613 13:98421131-98421153 CCATCAGACCTCTGTGCAGTTGG - Intronic
1113302718 13:109039411-109039433 CCATGGGACATGTGTCCAGATGG + Intronic
1113305213 13:109070227-109070249 CAATGAGACTTATGGGAAGATGG - Intronic
1113420175 13:110164982-110165004 CCGGGAGACCTGTGGGAATAGGG + Exonic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117323107 14:54642983-54643005 CCTTGAGACCTTTGGGGAAAGGG - Intronic
1118401506 14:65383875-65383897 CCATGGGACCTTTGGGCCTAGGG - Intergenic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1120893626 14:89510532-89510554 ACATGAGACCAGTGTGGAGAGGG + Intronic
1121098465 14:91233892-91233914 CCCTGAGGCCCGTGGGCTGAAGG + Exonic
1121407329 14:93727245-93727267 CCCTGGGAGCTGTGGGCCGAGGG + Intronic
1122573443 14:102724907-102724929 ACATAAAACCTGAGGGCAGAAGG - Intronic
1122781676 14:104146404-104146426 CCTAGAGGCCTGTGGGGAGAGGG + Intronic
1124802174 15:32843665-32843687 CAATGAGCTCAGTGGGCAGACGG + Intronic
1124955348 15:34356586-34356608 CCCAGTGATCTGTGGGCAGAAGG + Exonic
1125431593 15:39600447-39600469 ACATGAGACAAGTGGGAAGAAGG + Exonic
1126406418 15:48327432-48327454 CCATGGGAGGTTTGGGCAGAAGG + Intergenic
1126614553 15:50563730-50563752 GCATGTGGCCTGTGGGCCGAGGG - Intronic
1127503158 15:59573417-59573439 CCATAAGGCCTGTGTACAGAGGG + Intergenic
1127659998 15:61091551-61091573 CCATGAAACCTCTGGGATGAAGG + Intronic
1128329235 15:66745039-66745061 CCAGGTGACCTCTGGCCAGAGGG + Intronic
1129937714 15:79464528-79464550 CCATGAGACTTATTGCCAGATGG - Intronic
1130900214 15:88201350-88201372 CCATGAGACCCGTGGGTGGTAGG - Intronic
1131451846 15:92547820-92547842 CCATCACACCACTGGGCAGATGG - Intergenic
1132897063 16:2234089-2234111 CCAGGGGATCTGTGGGCAGGTGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134192961 16:12136593-12136615 GCATGACACCAGTGCGCAGAGGG - Intronic
1134198084 16:12174476-12174498 CCATTTGAGCTCTGGGCAGATGG + Intronic
1135233015 16:20727439-20727461 ACATGAGAGCTATGGACAGACGG + Intronic
1136113313 16:28078673-28078695 CCAGGGGGTCTGTGGGCAGAAGG - Intergenic
1136492939 16:30622348-30622370 CCATCAGACCTCTGGGCAGAAGG - Intronic
1136777116 16:32877834-32877856 CCCACAGACCTGTGGGCAAAGGG + Intergenic
1136893505 16:33983679-33983701 CCCACAGACCTGTGGGCAAAGGG - Intergenic
1138588898 16:57988708-57988730 CCATCCCACCTGTGGGCAGCTGG + Intergenic
1139926901 16:70493722-70493744 CCCTGTGACCTGTGGACAGTGGG + Intronic
1141225859 16:82114327-82114349 CCCACAGACCTGTGAGCAGACGG - Intergenic
1141770022 16:86084314-86084336 CCATGAGGGCTGTTGGAAGAAGG - Intergenic
1142004498 16:87683024-87683046 CCATTGTACCTGTGGGCAGCCGG - Intronic
1142125228 16:88406859-88406881 TCAGGAGACCTGGGGGCCGACGG - Intergenic
1203079531 16_KI270728v1_random:1139943-1139965 CCCACAGACCTGTGGGCAAAGGG + Intergenic
1144471949 17:15551582-15551604 GCATGAGGCCTGTGGGCAGAGGG - Intronic
1144650697 17:17005104-17005126 CCCTGGGACCTGAGGGCTGAGGG - Intergenic
1144924529 17:18793127-18793149 GCATGAGGCCTGTGGGCAGAGGG + Intronic
1147250674 17:39151216-39151238 CCAGGAGAGCTGTGGGCTGTGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150320574 17:64210880-64210902 CCATGACACCTCTCTGCAGAAGG - Intronic
1151483327 17:74383266-74383288 GGAGGAGACCTGGGGGCAGAGGG + Intergenic
1151514781 17:74586367-74586389 CCGTCAGACCTTTGGGCAGAAGG + Intronic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1152436345 17:80278588-80278610 CCATGGGCCCTGGAGGCAGACGG + Intronic
1156465253 18:37344700-37344722 CCATGTTACATGTTGGCAGAGGG + Intronic
1157295299 18:46437873-46437895 ACCTGGGACCTGTGGGCAGAGGG + Intronic
1158510978 18:58090350-58090372 CCATGAGATCTGAGTGCAGCTGG + Intronic
1159202903 18:65210247-65210269 CCATAAGACCTATGGGATGAAGG - Intergenic
1159902444 18:74060271-74060293 CCAGGAGAGCTGTAGACAGAGGG - Intergenic
1161447599 19:4327218-4327240 GCAAGAGAACTGGGGGCAGATGG + Exonic
1161966257 19:7550835-7550857 CCATTAGAGCTCTGGGGAGAGGG - Intronic
1162344970 19:10113619-10113641 ACTTGGCACCTGTGGGCAGAAGG - Exonic
1163798056 19:19348550-19348572 CCGTGAGCCCTGTGGGCTGTGGG - Intronic
1164013896 19:21235070-21235092 CCATCAGATCTCTGGGCAGAAGG + Intronic
1164675398 19:30097192-30097214 CCAGCAGGCCAGTGGGCAGATGG - Intergenic
1165232100 19:34393668-34393690 CCCTGCGTCCTGTGGGCAGTGGG - Intronic
1165439501 19:35816558-35816580 CCCTGACACCTGAGGGCAGGTGG - Intergenic
1165621491 19:37252098-37252120 CCATGAGACCTGTGGACGGACGG - Intergenic
1166682050 19:44774802-44774824 CCACGAGACCTTTGGACAAATGG - Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166798190 19:45440423-45440445 TCAGGAGACCTGCGGGCTGAGGG + Intronic
1167169780 19:47823468-47823490 CCATGAGACCTGGGGGAAGCTGG - Intronic
1167508001 19:49881277-49881299 CCAGGAGCCCTGGGGGCAGCTGG - Exonic
1168289082 19:55348226-55348248 CCCTGAGAGCTGTCGGGAGAGGG + Intergenic
1168644882 19:58053497-58053519 TCCTCAGACCTGCGGGCAGAAGG + Exonic
1168679932 19:58307565-58307587 CCATCAGACCTCTGGGCAGAAGG + Intronic
925091105 2:1156656-1156678 CCATGACAGGTGAGGGCAGAAGG + Intronic
925141849 2:1556378-1556400 CCCTGAGACCTGTGGGCCAAGGG - Intergenic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
925973078 2:9121301-9121323 TCACCTGACCTGTGGGCAGAAGG - Intergenic
928234725 2:29529708-29529730 CCATGAGATCTGTGTGGTGAGGG - Intronic
929226267 2:39514513-39514535 CCATGAGACCTGGGGGAATTGGG + Intergenic
929556787 2:42930489-42930511 GCATGAGGTCTGGGGGCAGATGG + Intergenic
931878807 2:66544173-66544195 TCACTAGACCTGTGGGCAGAAGG + Intronic
932815913 2:74861587-74861609 CAAGGTCACCTGTGGGCAGATGG + Intronic
933935321 2:87199169-87199191 CCAGGGTGCCTGTGGGCAGATGG + Intergenic
934081972 2:88476535-88476557 CCATGAGACTTGTGGCAAAAGGG + Intergenic
936357827 2:111766730-111766752 CCAGGGTGCCTGTGGGCAGATGG - Intronic
938320575 2:130359654-130359676 ACATGAAACCTGGGGGCAGAGGG - Intronic
939573688 2:143870299-143870321 CCATTAGACCTATTGGAAGAAGG + Intergenic
939584331 2:143988295-143988317 TCATGCAACCTGTGGGCAGATGG + Intronic
939643848 2:144672204-144672226 CCATGGTCCCTGTGAGCAGATGG - Intergenic
939864639 2:147459261-147459283 CCATAAAACCTGGAGGCAGAGGG + Intergenic
940905662 2:159167287-159167309 CCATGAGGCATGTGAGGAGAAGG + Intronic
943869527 2:192976123-192976145 GCCTGAGAACTGGGGGCAGATGG + Intergenic
948524115 2:238559921-238559943 GCAAGAGAGCTGTGGGCTGAGGG - Intergenic
948810302 2:240471905-240471927 CCAGGAGATCCCTGGGCAGATGG - Intergenic
948863090 2:240762326-240762348 CCATGAGCCTTGTGGTCAGCAGG + Intronic
948929461 2:241122780-241122802 CCATGAGCCCGCTGGGCAGTGGG - Exonic
1169605167 20:7309441-7309463 CCAGGAGAGCTGTGCACAGAGGG - Intergenic
1169969688 20:11256117-11256139 CCAGGAGACCTATGGGGAGGAGG - Intergenic
1170381012 20:15759655-15759677 CCATCAAACCTAAGGGCAGAAGG - Intronic
1172828113 20:37807450-37807472 CCATGATAACTGTGGGCAAATGG + Intronic
1174447838 20:50602362-50602384 GCAGGAGACCTGGGGGCAGGGGG + Exonic
1174668018 20:52278415-52278437 CCATGAGACTTGAGGGCACAAGG + Intergenic
1175108507 20:56630383-56630405 CCCCGAGACCCCTGGGCAGATGG + Intronic
1175786028 20:61712282-61712304 CCATGAGCCCTGGAGGCAGTGGG + Intronic
1179537046 21:42059477-42059499 CCATGGGACCACTGGCCAGATGG - Intergenic
1181062134 22:20286600-20286622 CCAGGAGACCTGTGGGGTGGGGG + Intergenic
1181102852 22:20552952-20552974 ACAAGAGACCTGGGGGCAGAGGG - Intronic
1181361933 22:22344207-22344229 CCATGAGAGCTCTGTGCACATGG - Intergenic
1181404432 22:22672738-22672760 ACATTGGTCCTGTGGGCAGAGGG + Intergenic
1181838032 22:25627028-25627050 CCATGACACCTGTCCCCAGATGG - Intronic
1183300635 22:37057384-37057406 GGGTGGGACCTGTGGGCAGAAGG - Exonic
1185254209 22:49823246-49823268 CCATGTGACGTGTGCCCAGAAGG - Exonic
949351708 3:3129932-3129954 CCATGAGAACTGAAGGAAGAAGG + Intronic
950691394 3:14660937-14660959 CCATAAGCCCTGCAGGCAGAGGG + Intronic
952389100 3:32864671-32864693 GCCTGAGCCCTGAGGGCAGACGG - Intronic
953391182 3:42534764-42534786 CCAGGAGGGCTGGGGGCAGAAGG + Intronic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
955828210 3:62971919-62971941 TGATGAGACGTGTAGGCAGAGGG + Intergenic
955952412 3:64255594-64255616 CCATAAGGCCTCAGGGCAGATGG + Intronic
959156353 3:102671101-102671123 CCATGAGATCTATGGGGAGAGGG - Intergenic
960976815 3:123183892-123183914 CAATGACACTTGTGTGCAGATGG + Intronic
961467266 3:127089417-127089439 TCAAGGGACCTGTGGACAGAGGG - Intergenic
961556166 3:127697892-127697914 CCATGGGACCTGTGGGGTGGGGG + Intronic
961692025 3:128676817-128676839 GCATGAGTTCCGTGGGCAGATGG - Intronic
962891832 3:139678786-139678808 CCATGAGCCCTGGGGGCTTATGG - Intergenic
963843637 3:150132902-150132924 CCATGTGGCCTGTGGGCCGCAGG - Intergenic
968480091 4:829421-829443 CCAGGAGGGCTATGGGCAGATGG - Intergenic
968898756 4:3420734-3420756 CCCTGAGGCCTGTGGGACGAGGG - Intronic
969259910 4:6026772-6026794 ACATGGGGCCTGTGGGTAGAGGG - Intronic
969664703 4:8550492-8550514 CCATGAGAACTGTGGGCTGTGGG + Intergenic
970146534 4:13042059-13042081 CAAAGAGACCAGTGGGCACATGG + Intergenic
977550132 4:98433116-98433138 CCATGAGAAATGAGGGCAGATGG + Intronic
981490657 4:145336111-145336133 GCATGGCACCTGGGGGCAGAGGG + Intergenic
982097664 4:151937568-151937590 CCATGCTACCTGTGGGTGGATGG - Intergenic
984658520 4:182346810-182346832 CCATGAGACTTTGGGGCAGGGGG + Exonic
985489345 5:170193-170215 CACTGAGTGCTGTGGGCAGATGG + Intronic
985807704 5:2059350-2059372 CCATGAGACCCATGTCCAGAGGG - Intergenic
985843705 5:2329103-2329125 CCATGAAATCTGTGGGAGGAAGG + Intergenic
985851077 5:2389503-2389525 CCATGGGACGTGTCAGCAGAAGG - Intergenic
988541087 5:32110686-32110708 CAATGAGATGTGTGGGAAGATGG - Exonic
991353537 5:65745041-65745063 AAATGAGACCTGGGTGCAGAGGG + Intronic
992485310 5:77189137-77189159 CAATGAGAGCTGTGAGCAGCAGG + Intergenic
993069010 5:83134835-83134857 CCATGAACCCTCTGGGCAGAAGG + Intronic
994040216 5:95250300-95250322 CCATGGGACTTGGGGGCTGAGGG + Intronic
994407451 5:99363090-99363112 CCACGAGGCCTCTGAGCAGAGGG + Intergenic
996874091 5:128222404-128222426 CCGCCAGACCTCTGGGCAGAAGG - Intergenic
997585714 5:135041832-135041854 TCCTGAGTCCTGTGGACAGAGGG + Intronic
1000939054 5:167338219-167338241 CCTTTAGTCCTGTGGGTAGAGGG - Intronic
1001691655 5:173637456-173637478 CCATGAGATCTGTGGTGATATGG + Intergenic
1002027286 5:176404271-176404293 CCATGAGACCTGGGGGCAACCGG - Intronic
1002079489 5:176728883-176728905 CCTTGGGCCCTGTGGGCTGAAGG + Intergenic
1006238795 6:32659788-32659810 CCAGCAAACCTGTGGCCAGAAGG - Exonic
1006297301 6:33175582-33175604 CCATGAGCCCTGGGGGCCCAGGG + Exonic
1006741688 6:36313364-36313386 ACCTGAGGCCTGTGGGCAGCTGG - Intergenic
1006783572 6:36649701-36649723 CCAGGAGAAGTGTGGTCAGAGGG + Intergenic
1007736405 6:43984927-43984949 ACCTGAGCCCTGTGGGCAGGCGG - Intergenic
1007825694 6:44599018-44599040 AGATGAGACTGGTGGGCAGAAGG + Intergenic
1008013555 6:46492051-46492073 CCATCAGACCTGAGGACAGAAGG + Intergenic
1008060793 6:46994614-46994636 GCATGCAACCTGTGGGCAGAGGG + Intergenic
1009040502 6:58170534-58170556 GCATGGGATCTGCGGGCAGAGGG + Intergenic
1009216358 6:60925071-60925093 GCATGGGATCTGCGGGCAGAGGG + Intergenic
1009907074 6:69883346-69883368 CTATGAGACCTCTTGGAAGATGG + Intronic
1010209448 6:73351629-73351651 CCCTGAGACCTGTGGCTGGAAGG - Intergenic
1010778615 6:79916853-79916875 CCATGTGACCATTGGGCACACGG - Exonic
1017005750 6:150027209-150027231 CATCTAGACCTGTGGGCAGAAGG + Intergenic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1019716750 7:2542701-2542723 CCCTGGGCCCTGTGGGCAGCAGG + Intronic
1019749655 7:2721053-2721075 CCACCAGACCTGTGGGCGTAAGG - Intronic
1020460842 7:8427977-8427999 CCATGAGATCTTTTGGCAAAGGG + Intergenic
1020664933 7:11028764-11028786 CCATGTGACCTGTGCTCAAAAGG + Exonic
1021791247 7:24208056-24208078 CCATGAGAGCTGCTGGCCGATGG - Intergenic
1022316179 7:29247471-29247493 CAAGGAGGGCTGTGGGCAGAAGG - Intronic
1028774574 7:94662814-94662836 TCATCAGCCCTGTGGGCAGGAGG - Intronic
1032820095 7:135516445-135516467 CCATGTGGCCTGTGGGCTGCAGG - Intergenic
1033236959 7:139645807-139645829 CCAGGAGTGCTGTGAGCAGACGG - Intronic
1034106117 7:148491265-148491287 CCATGAGACCTGGGGGCAAAGGG + Intergenic
1035628483 8:1091067-1091089 CCCGGAGCCCTGTGCGCAGACGG - Intergenic
1036212628 8:6854582-6854604 CCATGGGAGCTGAGGGCTGAAGG - Intergenic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1036915128 8:12797209-12797231 CCATGAGACCACTGGGAGGAAGG + Intergenic
1037672847 8:21029941-21029963 TCATGACACCTGCTGGCAGAGGG + Intergenic
1043502316 8:80870391-80870413 CGATGAGAGGTGTGGACAGAGGG - Intronic
1045140949 8:99281588-99281610 CTGTGAGACTTGTGGGCAAAGGG + Intronic
1045174015 8:99700725-99700747 GCATGGGAAGTGTGGGCAGAAGG + Intronic
1045520238 8:102896942-102896964 CCGGGAGACCTGTGGGTAGCTGG + Intronic
1046941184 8:119933120-119933142 GCATGAGTCCTCTAGGCAGAGGG - Intronic
1048277364 8:133077153-133077175 GCATGAGAGGTGTGCGCAGAAGG + Intronic
1049367839 8:142249289-142249311 GGAGGAGAACTGTGGGCAGAGGG + Intronic
1049388515 8:142356285-142356307 GCCTGAGACCTGTGGAGAGAGGG - Intronic
1051175026 9:14351982-14352004 CCGTCAGAACTGTGGGCAAATGG - Intronic
1052354203 9:27487522-27487544 CCATGAGACCTGGGGGGCCAGGG + Intronic
1053119661 9:35537258-35537280 CCATGAGAGCTCTGGGCCCAGGG - Intronic
1054922458 9:70555691-70555713 CCATGAGGCCTGTGGCCAAGTGG - Intronic
1056021379 9:82441521-82441543 CCATGAGATTTGTGGGAGGAAGG + Intergenic
1059416692 9:114166917-114166939 CCCAGAGTCCTGTGGGGAGAAGG + Intronic
1059449766 9:114363209-114363231 CCATGAGCTCTGGGGCCAGAGGG - Intronic
1059542302 9:115143059-115143081 CCTGGAGACCTGTGGTCAGTGGG + Intronic
1059693923 9:116713005-116713027 CCATGTGACCTTTGGACACATGG + Intronic
1059897266 9:118880544-118880566 CTATCAGCCTTGTGGGCAGATGG + Intergenic
1060199715 9:121645397-121645419 CCAGGGCTCCTGTGGGCAGAAGG + Intronic
1060221730 9:121767695-121767717 CCCTGACAGCAGTGGGCAGATGG + Intronic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1062364105 9:136200838-136200860 CCCTGAGTCCTGTGGGCCGGAGG - Intronic
1062728961 9:138097785-138097807 CCAGGAGCTCTGTGGGCAGTAGG - Intronic
1196314449 X:114206316-114206338 CCATGGGACCTGTGGGACAATGG + Intergenic
1196812082 X:119636821-119636843 CCAGGAGAGCTGTGGGGAGCAGG - Intronic
1198873265 X:141197530-141197552 CCGTCAGACCTCTGGGCAGAAGG - Intergenic
1201772790 Y:17632925-17632947 CAATGACACCTGAGGGCAGGTGG - Intergenic
1201828765 Y:18273062-18273084 CAATGACACCTGAGGGCAGGTGG + Intergenic
1202037161 Y:20646921-20646943 CCTGGAGAACTGTGGGCATAAGG + Intergenic