ID: 1152419674

View in Genome Browser
Species Human (GRCh38)
Location 17:80185663-80185685
Sequence CTTTCCCCCAGCCCAGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 416}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152419667_1152419674 -3 Left 1152419667 17:80185643-80185665 CCCAGTGACTCCTTCACAGCCTT 0: 1
1: 0
2: 5
3: 9
4: 237
Right 1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG 0: 1
1: 0
2: 1
3: 43
4: 416
1152419666_1152419674 22 Left 1152419666 17:80185618-80185640 CCTGTGTTCTGGTTTTCTCATCT 0: 1
1: 2
2: 6
3: 70
4: 572
Right 1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG 0: 1
1: 0
2: 1
3: 43
4: 416
1152419664_1152419674 30 Left 1152419664 17:80185610-80185632 CCAATCCGCCTGTGTTCTGGTTT 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG 0: 1
1: 0
2: 1
3: 43
4: 416
1152419668_1152419674 -4 Left 1152419668 17:80185644-80185666 CCAGTGACTCCTTCACAGCCTTT 0: 1
1: 0
2: 2
3: 24
4: 262
Right 1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG 0: 1
1: 0
2: 1
3: 43
4: 416
1152419665_1152419674 25 Left 1152419665 17:80185615-80185637 CCGCCTGTGTTCTGGTTTTCTCA 0: 1
1: 0
2: 3
3: 33
4: 601
Right 1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG 0: 1
1: 0
2: 1
3: 43
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152419674 Original CRISPR CTTTCCCCCAGCCCAGGGTC GGG Intronic
900037662 1:431010-431032 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900059292 1:666753-666775 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900101409 1:963698-963720 CTTACCCCCAGTCCAGAGGCTGG + Intronic
900325700 1:2107787-2107809 ATTTCCCCCAGGGCAGTGTCGGG + Intronic
900374045 1:2345274-2345296 CCTTCCACCAGGCCAGGGCCAGG + Intronic
900657158 1:3764062-3764084 CTTGCCTCCAGCCCAGGGACAGG - Intronic
900788348 1:4663703-4663725 CTTTTCCCCACCCCTAGGTCTGG - Intronic
901654819 1:10763160-10763182 CTTTCCCACAGCCCAGGCCCCGG + Intronic
902700645 1:18169620-18169642 CCTGCCCCCAGCCCAGGGTAGGG + Intronic
902701974 1:18178759-18178781 CCCTACCCCACCCCAGGGTCTGG + Intronic
902955503 1:19922170-19922192 CATGCCTCCAGCCCAGGGTCTGG + Intronic
902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG + Intergenic
903129044 1:21266399-21266421 CTTCCCCCCAGCACAGGATGGGG - Intronic
903373644 1:22852572-22852594 ATTGCCCCCAGCCCCAGGTCTGG - Intronic
903673334 1:25049459-25049481 CTTACCCCCAAACCAGGGTGTGG - Intergenic
904360902 1:29971212-29971234 TCTTCCCCCATCCCAGGGTCAGG + Intergenic
904575468 1:31502508-31502530 CCTTCCCCCAGCACAGTGTGTGG + Intergenic
905182938 1:36177931-36177953 CCCTGCCCCAGCCCAGGGCCAGG + Exonic
905460453 1:38119311-38119333 CATTTCCCTAGCCCAGGGCCTGG + Intergenic
905485513 1:38293014-38293036 CCAGCCCCCAGCCCAGGGCCTGG + Intergenic
905647934 1:39637495-39637517 CCTATGCCCAGCCCAGGGTCTGG + Intronic
906580405 1:46930862-46930884 CTGCCTCCCACCCCAGGGTCCGG + Intronic
906603318 1:47148026-47148048 CTGCCTCCCACCCCAGGGTCCGG - Intronic
906798593 1:48716816-48716838 CTTGACCCCAGCCCAAGCTCAGG - Intronic
907457573 1:54585343-54585365 CCTGCCCCCAGGCCTGGGTCAGG - Intronic
908999904 1:70205703-70205725 CTGTCCTCCAGCCCAGGCGCTGG - Exonic
909324676 1:74335567-74335589 CTTTCCCCTTGCCCAGGGATTGG + Intronic
910098753 1:83554335-83554357 TGTTCCCCCAGACCAAGGTCTGG - Intergenic
910830286 1:91454331-91454353 ATTTACCACAGCCCATGGTCTGG - Intergenic
911043151 1:93607774-93607796 CTTTAACCCAGCCCTGGATCAGG - Intronic
912511887 1:110195330-110195352 CTCTGCCCCAGCACAGGGCCTGG - Intronic
912596102 1:110877997-110878019 CTTTCCACCGTCCCAGGCTCTGG - Intronic
912698863 1:111861425-111861447 CCCTCCCCCAGCCCAGTCTCAGG + Intronic
914665499 1:149829222-149829244 CTCTCACCCAGCCTAGGGTCAGG - Intergenic
914670266 1:149864572-149864594 CTCTCACCCAGCCTAGGGTCAGG + Intronic
915465820 1:156097350-156097372 CATTCCCCCAGCCCAGGCCTTGG + Intronic
915931326 1:160062429-160062451 CTGTCCCACAGCCGAGGGGCGGG + Intronic
916649181 1:166819145-166819167 CTTTCCCCCAGCTTATGGTGGGG - Intergenic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
919731112 1:200914109-200914131 TTCTCCCCCAGCCCAGGCTGGGG - Intronic
919755578 1:201064167-201064189 CTGGCCCCCTGCCCAGGGCCTGG - Intronic
919789897 1:201284224-201284246 CTGTCCCTGAGCCCTGGGTCTGG + Intronic
920181852 1:204137008-204137030 CCTACCCAGAGCCCAGGGTCAGG - Intronic
920670403 1:207999801-207999823 CTTTCTCCCAGCCTAGAGTCTGG + Intergenic
920916502 1:210262103-210262125 CCTTCACCCAGCCCAGGTGCGGG - Intergenic
920985357 1:210883953-210883975 CTTCCTCCCAGCCCATGCTCTGG + Intronic
922068280 1:222165874-222165896 CTTTCCTCCAGGCCAGGAACTGG + Intergenic
922841805 1:228648312-228648334 CTTTTCCCCTGCCCAAGCTCTGG + Intergenic
923280346 1:232437644-232437666 CTGACCCCCAGCCCAGGCTGAGG + Intronic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1062814266 10:488212-488234 TTTTCCCCCAAACCAGGGTCTGG + Intronic
1063016397 10:2081819-2081841 CTGTTCCCCAGGCCAGGCTCAGG - Intergenic
1064096228 10:12426578-12426600 CTGTCACCCAGCCCAGGCTGGGG + Intronic
1066318753 10:34278049-34278071 TTTTCCCCCTGCCCAGAGACAGG + Intronic
1067038932 10:42938417-42938439 CTTGCCCCCAGCCCAGCTCCTGG + Intergenic
1067238728 10:44472780-44472802 CTCTCCCCCAGCCCCTGGTGTGG + Intergenic
1067803573 10:49377233-49377255 CTCTGCCCCAGCACAGAGTCTGG - Intronic
1069867485 10:71512675-71512697 CTGGCCCCCAGCCCAAGGGCAGG - Intronic
1070587846 10:77780005-77780027 CTGGCCCCCACCCCAGGGGCAGG - Intergenic
1070679648 10:78439556-78439578 CTTCCCACCAGGCCTGGGTCAGG - Intergenic
1072678459 10:97487353-97487375 CTTTCGCCCAGGCCAGAGTGCGG + Intronic
1073330948 10:102669522-102669544 CTGTTCCCCAGCCCAGGCCCAGG - Intergenic
1073469285 10:103712801-103712823 AGTTGCCCCAGCCAAGGGTCAGG + Intronic
1074776925 10:116773747-116773769 CTTTGCCCCTGCCCAGGACCAGG - Intergenic
1074969564 10:118524785-118524807 CTTTCCCCCTTCCTAGGGGCTGG + Intergenic
1075124262 10:119687114-119687136 CCTTCCCCCACCCCACAGTCTGG - Intergenic
1075412907 10:122242147-122242169 CTTTGCCCCAGGACAGAGTCTGG + Intronic
1075806707 10:125194232-125194254 CCCTCTCCCAGCCCAGGCTCTGG - Intergenic
1075999793 10:126905591-126905613 CTCGCCCCAAGCCCAGGCTCCGG + Intronic
1076541756 10:131219414-131219436 CTTGCCCCCAGGCCAGGAGCAGG + Intronic
1076694262 10:132239594-132239616 CTTTCCAGCAGCACAGGCTCTGG - Intronic
1076964389 11:68933-68955 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1076998127 11:309002-309024 CTCTCCCCCAGTCTAGGGACAGG + Exonic
1076999349 11:314911-314933 CTCTCCCCCAGTCTAGGGACAGG + Exonic
1077000518 11:319979-320001 CTCTCCCCCAGTCTAGGGACAGG - Exonic
1077261888 11:1626496-1626518 CTGTCCCTCAGCTCATGGTCAGG + Intergenic
1079599674 11:22295482-22295504 CCTTCCCTCAGCCCAGTGTCAGG - Intergenic
1079635912 11:22740092-22740114 CTTTCCTCCAGCTCCGAGTCTGG + Intronic
1080041847 11:27767537-27767559 CTTGCCACCAGCACAGTGTCTGG + Intergenic
1080462011 11:32463012-32463034 CTATCACCTAGCACAGGGTCTGG + Intergenic
1080715415 11:34795588-34795610 CTTTCCCACTGCCCTGGTTCAGG - Intergenic
1081432938 11:42996516-42996538 CTTTCATCAATCCCAGGGTCTGG + Intergenic
1081993635 11:47350519-47350541 CTTTCTCCCAGCTCAGCGGCTGG + Exonic
1083304336 11:61754810-61754832 CCTTCCCCCATCGCAGGGGCTGG - Intronic
1083579231 11:63814027-63814049 CCTTTCCCCCGCCCAGGGTCTGG + Intronic
1084068770 11:66720484-66720506 CTTCCCTGCAGCCCAGGGCCTGG - Intronic
1084190232 11:67495336-67495358 CTTTCCCCCAGCACACAGCCTGG - Intronic
1084212649 11:67630974-67630996 TGGTCCCCAAGCCCAGGGTCTGG - Intergenic
1084428919 11:69100769-69100791 GGTACCCCCAGCCCAGGCTCGGG - Intergenic
1085784405 11:79438147-79438169 CTTCCCCCCAGCCCGCAGTCAGG - Intronic
1085823375 11:79817165-79817187 CTTTCCCCCTGCATAGTGTCAGG + Intergenic
1085839885 11:79999479-79999501 CTTTCCCCCAACCCCTGGACAGG - Intergenic
1089168993 11:116499647-116499669 CTCTCTCCCAACCCAGGGGCGGG + Intergenic
1089457547 11:118634288-118634310 CTCCCCTCCTGCCCAGGGTCGGG - Intronic
1089556923 11:119320169-119320191 CCTTCCTCCTGCCCTGGGTCAGG - Intronic
1091390540 12:123655-123677 CTTCCTCCCAGCCAAGGGTGGGG - Intronic
1091662182 12:2392693-2392715 CATTCCTCCAGCCCAAGTTCAGG - Intronic
1092343405 12:7695455-7695477 CTTTCTCCCAGACCAAGGTAAGG - Exonic
1092940927 12:13406204-13406226 CCTTCTCCCAGCCCAGAGTTGGG - Intergenic
1095945952 12:47753515-47753537 CTTCCGCCCAGCCCTGGGCCAGG - Intronic
1095975614 12:47939086-47939108 CTGTCCCCCAGACCAAAGTCGGG - Intronic
1096236649 12:49932875-49932897 CCATCACCCAGCCCAGTGTCTGG + Intergenic
1097275197 12:57808416-57808438 TTTTCCCCAGGCCCATGGTCTGG + Exonic
1099960457 12:89392151-89392173 CCCTCCCCCACTCCAGGGTCAGG + Intergenic
1101942678 12:109111451-109111473 CTGGCCCGCAGCCCAGGCTCAGG + Intergenic
1102238250 12:111308229-111308251 CTCTCCTCCAGCCCGGGGGCTGG + Intronic
1102441097 12:112964456-112964478 ATCTCTCCCAGCCCAGGGCCAGG + Intronic
1102533321 12:113562971-113562993 CATTCCACCAGCACAGTGTCAGG + Intergenic
1102637964 12:114341008-114341030 ATTTCCCCCAGCCTAGTGCCTGG + Intergenic
1102992757 12:117326900-117326922 CTCTCCCCCAGCCGACAGTCTGG - Intronic
1104386785 12:128357745-128357767 CCTTCTCCCAGCCAAGGGTAAGG + Intronic
1104558276 12:129821755-129821777 TTTTCCCCCAGCCCACAGACGGG - Intronic
1104853897 12:131893134-131893156 CTGGCCCCCAGTCCAGGGTCGGG + Intergenic
1104918931 12:132280590-132280612 CGTGCCCCCAGCCCAGAGTAGGG + Intronic
1105734869 13:23257409-23257431 CATTCCCCCACCCCATGGACAGG + Intronic
1105893415 13:24698475-24698497 CTTGGCCCCAGCCCAGAGTGGGG - Intronic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106012408 13:25837603-25837625 AGTTCCCACAGCCCAGGTTCAGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106411652 13:29515127-29515149 CTTACCACCTGCCCAGGGGCTGG + Intronic
1107886835 13:44880704-44880726 CTATCCCCAAGCCCAGTGTGAGG - Intergenic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1108451807 13:50574775-50574797 CTTTCCTACATCTCAGGGTCAGG - Intronic
1108705300 13:52980088-52980110 CTTTCCCGGAGCTGAGGGTCAGG - Intergenic
1108853518 13:54765272-54765294 CCTTCCCTCAGCCCAGCTTCAGG - Intergenic
1112503028 13:99956760-99956782 CTCTCCCCCAGCCCGCGGCCCGG - Intergenic
1113316382 13:109184251-109184273 CTTTCACACAGCCAAGGTTCAGG + Intronic
1113633879 13:111906853-111906875 CTTTCCTCAAGCTCAGTGTCTGG + Intergenic
1113843516 13:113373384-113373406 CCTGCACCCACCCCAGGGTCAGG - Intergenic
1113890241 13:113731713-113731735 TTGTCCCACTGCCCAGGGTCTGG - Intronic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1114218605 14:20676902-20676924 CATTCCCCCAGCCCAGTGCTAGG + Intergenic
1115644211 14:35356116-35356138 CCTGCCCCCAGCCCTGGTTCTGG - Intergenic
1117956239 14:61125759-61125781 CTCAGCCCCAGTCCAGGGTCTGG + Intergenic
1118711817 14:68525737-68525759 CTTCCAGCCAGCACAGGGTCTGG + Intronic
1119002843 14:70898693-70898715 CTTTCCTCCAGCCCAGAAACAGG - Intergenic
1121052380 14:90828012-90828034 CTTTCAACCAGCCAAGGGACTGG - Intergenic
1122204598 14:100142290-100142312 CTGTTCCCCAGCCCAGGGCCAGG - Intronic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122289727 14:100673962-100673984 CTTGAGGCCAGCCCAGGGTCTGG + Intergenic
1122886182 14:104711420-104711442 CTGTCCCCCAGATCAGGGACAGG - Intronic
1123697229 15:22887617-22887639 CTGGCCCCCTGCCCAGTGTCCGG + Intronic
1124221612 15:27854357-27854379 GTCTCCACCAGTCCAGGGTCTGG + Intronic
1125688027 15:41575191-41575213 GTTACCCACAGCCCAGGCTCAGG - Intronic
1125724833 15:41862870-41862892 CTTTCCCACAGTCCAGGGCCTGG + Exonic
1125950290 15:43746234-43746256 CCTGCCCCCAGCCCAGGACCGGG + Intergenic
1127302238 15:57666324-57666346 TTTTCTCCGAGCCCAGGATCAGG - Intronic
1128737144 15:70059651-70059673 CTGTCCCCTAGCCCAGGCCCCGG + Intronic
1128800626 15:70494702-70494724 CTTTTCCCCTGCACAGGGTAGGG - Intergenic
1129176212 15:73841507-73841529 CTTTCTCCCAGGTCAGGGGCAGG - Intergenic
1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG + Exonic
1129703119 15:77779324-77779346 TTTTTCCACAGCCCAGGGTTGGG + Intronic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1129750075 15:78056554-78056576 CTTTGCCCCGCCCCAGGGCCAGG - Intronic
1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG + Intergenic
1131432091 15:92395183-92395205 CCTTCCCCTTGCCCAGGGCCAGG - Intronic
1132206249 15:99988024-99988046 CCTTCCCCCAGCTCAGCCTCAGG + Intronic
1132314100 15:100878514-100878536 CTTTCCACAACCCCAGGGTAAGG + Intronic
1132376233 15:101329987-101330009 CTGTCCCCCCGCCCAGAGACTGG - Intronic
1132444161 15:101896250-101896272 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1132457136 16:30160-30182 CACTCCCCCAGCACAGGGCCTGG + Intergenic
1132649158 16:1012760-1012782 CTGCCCCTCTGCCCAGGGTCCGG + Intergenic
1132650811 16:1020743-1020765 CTTTCCCCCTGCCATGGGTGGGG - Intergenic
1132810554 16:1794713-1794735 CTTTCCCACTGCCGAGGGACTGG - Intronic
1134443129 16:14311055-14311077 CTTTCCACCTGCACAGTGTCGGG + Intergenic
1134644537 16:15856001-15856023 TTTTCTTCCAGCACAGGGTCTGG - Intronic
1134844155 16:17425714-17425736 CTTTCCCCCAGCACACAGCCAGG + Intronic
1136535486 16:30896744-30896766 GTTTCCGCCACCCCCGGGTCCGG + Intronic
1136569089 16:31086276-31086298 CCAACCCCCAGCCCAGGGTTAGG + Intronic
1138180426 16:54937255-54937277 CGTTCCCCCAGCCCGGGTGCGGG + Intergenic
1138477958 16:57283359-57283381 CTGGACCTCAGCCCAGGGTCTGG + Intronic
1138492015 16:57382458-57382480 CTTTGCCTCAGCCCAGAGGCTGG - Exonic
1139253857 16:65522042-65522064 CTTTCTCGAAGCCCAGTGTCTGG + Intergenic
1141274032 16:82568776-82568798 CTGTACCCCAGCACAGTGTCTGG + Intergenic
1141429974 16:83966382-83966404 CTTCCCCCCAGCCCAGTGCAGGG - Intergenic
1141674473 16:85510373-85510395 CTTCCCCGCAGCCCAGGACCAGG + Intergenic
1141976079 16:87517520-87517542 CTCTCTCCCTGCCCAGGGGCTGG - Intergenic
1141998296 16:87648652-87648674 CCCTCTCCCAGCCCAGGGCCGGG - Intronic
1142098691 16:88259796-88259818 CAGCCCCCCACCCCAGGGTCAGG - Intergenic
1142596915 17:1034299-1034321 TTAACCCCCACCCCAGGGTCGGG - Intronic
1142599805 17:1048078-1048100 CTCTAGCCCAGCCCAGGGACAGG + Intronic
1143153782 17:4823044-4823066 CTCCTCCCCAGCCCAGGGTTGGG - Exonic
1143174796 17:4949692-4949714 CTTGCCCCTAGCCCAGGCTCCGG - Intronic
1143344927 17:6242449-6242471 CATACCCCCAGCACAGGATCAGG - Intergenic
1143465543 17:7133991-7134013 GTTTCCCCCGGCCCGGAGTCGGG + Intergenic
1144949422 17:18985892-18985914 CCCTACCCCAGCCCAGGGCCTGG + Intronic
1145062848 17:19743563-19743585 CACTCACCCAGCCCAGGGTGGGG + Intronic
1145254938 17:21317269-21317291 CATTCCCCCACCTCAGGGACAGG - Intergenic
1145321664 17:21770696-21770718 CATTCCCCCACCTCAGGGACAGG + Intergenic
1145822084 17:27846552-27846574 CTTTCGCCCAGGCCAGAGTGCGG + Intronic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1146708642 17:35021382-35021404 TGTTCCCCCAGCCCAGGTTCAGG - Exonic
1146722056 17:35130565-35130587 CTTGGCCCCAGCCCAGGGGTGGG - Exonic
1146928594 17:36762144-36762166 CTTTCCCCCAGCCCAAGCCATGG - Intergenic
1147042455 17:37729225-37729247 CTTGTCCCAAGCCCAGGGACTGG - Intronic
1147961519 17:44170562-44170584 CCAACCCCCAGCCCAGGGTGAGG - Intronic
1148142545 17:45338725-45338747 CTTCCTCCCAGCCCCTGGTCTGG - Intergenic
1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG + Exonic
1148615765 17:48998440-48998462 CTTGCCTCCCGCCCAGGGCCTGG + Intronic
1148768139 17:50051332-50051354 CTTTCCTACTGCCCAGGGCCTGG - Intergenic
1150266905 17:63837855-63837877 CCTCCTCCCAGCCCAGGTTCTGG - Intronic
1151402657 17:73865952-73865974 CGTTCACCCAGCCCAGGCCCTGG - Intergenic
1151457580 17:74235500-74235522 CTTTCCCACAGCCCAGACCCAGG - Intronic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1151658808 17:75508063-75508085 CCTCCCTCCAGCCCAGGGACAGG + Intronic
1151679762 17:75617088-75617110 CTGTCCCCCAGCCCAGGAAAGGG + Intergenic
1151711053 17:75806899-75806921 CATTCCCACTGCCCTGGGTCAGG - Intronic
1151826578 17:76527288-76527310 CTGTCCCCCATCCCCGGTTCTGG - Intergenic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152022179 17:77785855-77785877 CTCTCCCCTGGCCCAGGGACAGG - Intergenic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152599257 17:81253229-81253251 CCTGCTCCCAGCCCAGGATCCGG - Exonic
1153768853 18:8399769-8399791 CTTTCTCCCAGCCTAGAGGCTGG + Intronic
1153823751 18:8855904-8855926 CCTGCACCCAGCCCAGTGTCTGG - Intergenic
1154300316 18:13186172-13186194 CTGTCACCCAGCCCAGGCCCAGG + Intergenic
1154940717 18:21111081-21111103 GTTGCCCCCGGCCCGGGGTCTGG - Exonic
1156201581 18:34838723-34838745 CTTTCCCCCTGCCCTGTTTCAGG + Intronic
1156275636 18:35581245-35581267 CTTTGTCCCGACCCAGGGTCGGG + Intronic
1157331951 18:46710663-46710685 CTTTCAGCATGCCCAGGGTCTGG + Intronic
1160054674 18:75467263-75467285 CTTTCCTCCAGCACAGGGGCTGG + Intergenic
1160641192 19:138565-138587 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1160738092 19:673929-673951 GTCTCCCCCAGGCCCGGGTCAGG + Intergenic
1160755140 19:752999-753021 CCTTCCTGCAGCCCAGAGTCTGG - Intronic
1160821151 19:1058810-1058832 CTGTCCCCAGGCCCAGGGTGAGG + Exonic
1161278721 19:3433745-3433767 CCTTCCCAGAGCCCAAGGTCAGG + Intronic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161581324 19:5082599-5082621 GTTTCGCTCAGCCCAGGGCCTGG + Intronic
1161608939 19:5230167-5230189 TTTTCACCCACCCCAGGGTTTGG + Intronic
1161701419 19:5797988-5798010 CTAGCGCCCAGCACAGGGTCTGG + Intergenic
1162746274 19:12800435-12800457 CTTGCACCCAACCCAGGGTGGGG - Intronic
1162923863 19:13919819-13919841 CTTCCCCCCAATCCAGGGCCTGG + Exonic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1163239409 19:16050931-16050953 TTTTCCCCCAGCCCATGTGCAGG - Intergenic
1163347036 19:16749842-16749864 CTTGCCCCCTGCCCAGGTTCTGG + Exonic
1163588216 19:18175402-18175424 TTTTCCCCCACCCCAGTGTGGGG - Intronic
1163745275 19:19043139-19043161 CTGTTTCCCAGGCCAGGGTCAGG - Intronic
1163933409 19:20420703-20420725 TTCTCCACCAGCCTAGGGTCTGG - Intergenic
1164883842 19:31760358-31760380 CTTGCTCCCAGGCCAGGGTGTGG + Intergenic
1165389353 19:35529480-35529502 CCTGGCCCCAGCCCAGGTTCTGG - Intergenic
1165774924 19:38398903-38398925 CTCTCACCCATCCCAGGGTCTGG - Intergenic
1165898717 19:39158448-39158470 CCTTCCCCCTGCCCAGCCTCAGG + Intronic
1166060201 19:40321198-40321220 CTCAGCCGCAGCCCAGGGTCTGG + Exonic
1166185639 19:41137158-41137180 CTCTGCCCCAGCCAAGGGGCAGG + Intergenic
1166343804 19:42153075-42153097 CTTGGCCTCACCCCAGGGTCTGG + Intronic
1166758895 19:45212433-45212455 CTTTCCCTCACCTCAAGGTCTGG - Intronic
1168181675 19:54666229-54666251 TCTTCCCCCAGCCCAGAGACAGG + Exonic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
925801915 2:7609949-7609971 CTTTTCCCTAGCACAGTGTCTGG + Intergenic
926726141 2:15999570-15999592 TTTTCCACCATCCCAGGGCCTGG + Intergenic
927081726 2:19636870-19636892 GTTTCCCCCAGCCTAGAGCCAGG - Intergenic
927971280 2:27307465-27307487 CTTTCCCCCACCCCAGAGTTGGG - Exonic
928208569 2:29305756-29305778 CTTTTCCACAGACCAGGGGCTGG + Intronic
928316830 2:30252883-30252905 CTCACCCTCAGCCCAGGGTAGGG - Intronic
929433207 2:41906379-41906401 CCTTCACCCAGCCCAGGGATCGG + Intergenic
929460448 2:42099205-42099227 CTTGCCCCCAGCCTTGGGCCAGG + Intergenic
929516921 2:42611776-42611798 CTGTCCCCCAGGCTAGGGTGTGG - Intronic
929856990 2:45645914-45645936 CCTTCCCCAACCACAGGGTCTGG - Intergenic
933538690 2:83610620-83610642 CTTTTCCCCACCCCAGCCTCAGG - Intergenic
934112835 2:88758265-88758287 AGTTCCCCCAGCCCTGGGACTGG - Intergenic
936457129 2:112683596-112683618 GTTTCCCCCATGCCAGGGGCTGG - Intergenic
937349952 2:121154522-121154544 CGTGTCCCCAGCCCAGGGCCAGG + Intergenic
937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG + Intergenic
938075146 2:128327893-128327915 CTCTGCCCCAGCCCAGGCCCAGG - Intergenic
938218891 2:129548750-129548772 GTTTCCTCCAGCCCAGCATCAGG + Intergenic
938986697 2:136583484-136583506 GTTTCCCACAGCCCAGTGCCTGG - Intergenic
940509620 2:154596649-154596671 CCTTCCCCCATCCCAGCCTCTGG - Intergenic
941171800 2:162146940-162146962 TTATCCCCCAGCCAAGGGTAAGG - Intronic
941951284 2:171160169-171160191 CCATCCCCCACCCCAGGGTCTGG + Intronic
946418115 2:219550759-219550781 CTCTACCCCTGCCCAGGGTAAGG + Exonic
947813033 2:233016090-233016112 CATTCCCTCAGCCCTGGGCCTGG - Intergenic
948024365 2:234765101-234765123 TTCTCCCCCAGCCCTGGGTGGGG - Intergenic
948238214 2:236406529-236406551 CTCTCCCCCACCCCAGGATACGG - Intronic
948394893 2:237638035-237638057 CTTTTCCACAGACCAGGGTGTGG + Intronic
948757654 2:240168761-240168783 CTTGCCCTCAGCCCAGGGGTTGG + Intergenic
948888637 2:240896433-240896455 CCTCCCCACAGCCCAGGGGCCGG + Intronic
1169225606 20:3854762-3854784 CCTGCCCCCAGGCCAGTGTCGGG - Intronic
1169268178 20:4180370-4180392 CTGTCCCCCAGCCCTGGGCTAGG - Intronic
1170248383 20:14249893-14249915 CTATCCCCCACCCCCGTGTCTGG - Intronic
1171452121 20:25243433-25243455 CTTTTCCCCAGCCCATGTTAGGG + Intergenic
1172689501 20:36780548-36780570 TTGTCCCCCACCCCAGGGCCAGG + Exonic
1172760395 20:37317306-37317328 CTTTCCCTCATCCCCGGGGCAGG - Intergenic
1173550917 20:43932728-43932750 CCTTCACCCAACCCAGGGTGCGG - Intronic
1174029426 20:47610259-47610281 CTGTCCCCCAGGCCAGAGTGCGG + Intronic
1174089727 20:48037548-48037570 CGTTCACCCCGCCCTGGGTCTGG + Intergenic
1174254376 20:49243351-49243373 ATTTTCCCCAGCCCAAGGTTGGG + Intronic
1174354105 20:49987099-49987121 CTGAGCCCCAGCCCAGGGCCTGG - Intronic
1175371724 20:58496865-58496887 CTTTCCTCCATGCCAGGCTCAGG - Intronic
1175466586 20:59193981-59194003 CTTTCTCCCAGCCCAGCCTCAGG + Exonic
1175877429 20:62237014-62237036 TTCTCCCCCACCCCAGGGGCTGG - Intronic
1175996759 20:62815422-62815444 CCCACCCCAAGCCCAGGGTCTGG - Intergenic
1176240373 20:64073106-64073128 CTTCTCCCCAGCCCTGAGTCTGG + Intergenic
1178509724 21:33194221-33194243 CATTCCCCAAGCTCATGGTCTGG + Intergenic
1178617324 21:34145438-34145460 CTTTCCTCCAGCCAGGGGGCAGG - Intergenic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1180233773 21:46444038-46444060 CTTTGGCCCAGCCCAGGGCAAGG + Intronic
1180955393 22:19739114-19739136 CTTCACCCCAGCACAGGGTGTGG + Intergenic
1182049985 22:27305280-27305302 CTTCCCCCCAGCCCTGACTCCGG + Intergenic
1182114621 22:27748959-27748981 CTCTCCCACAGCCCATGGTGGGG + Exonic
1183004971 22:34893725-34893747 CTTTACCTCAACCCAGGCTCTGG - Intergenic
1183655819 22:39184189-39184211 GTGTCTCCCAGCCCAGGGTGGGG - Intergenic
1183898484 22:40987988-40988010 CCTTGCCCCAGCCCAGCCTCTGG + Intergenic
1183904705 22:41031742-41031764 CTTTCCCCTAGCACAGGGTTGGG + Intergenic
1184918937 22:47592060-47592082 CTTGTCCGCAGCCCATGGTCGGG - Intergenic
1185250945 22:49801392-49801414 CCTGCCCCCACCACAGGGTCAGG + Intronic
1185375370 22:50480610-50480632 CTCCCCCCCAGACCAGGGTAGGG + Intergenic
949534599 3:4986320-4986342 CTTTCTCCCAGCCCAACGCCTGG + Intergenic
950023881 3:9807867-9807889 TTTTCCACCAGCCCAGTGGCTGG + Intronic
950124479 3:10503084-10503106 CGTTCCCCCAGCTCAGGCGCAGG - Intronic
950580467 3:13858598-13858620 CTTCCCCACAGCCCAGAGTGAGG + Intronic
951607541 3:24452606-24452628 CTTTCCTCCAACCCAGGAACCGG + Intronic
952945460 3:38475748-38475770 CTTTGCCCTCCCCCAGGGTCAGG + Intronic
953026489 3:39148170-39148192 CTTCCCCCAGGCCCAGGGTGGGG - Intronic
953119353 3:40024752-40024774 CTTTCCACCTGCTCAAGGTCAGG + Intronic
953158860 3:40399721-40399743 GTTTGGCCCAGCCCAGGCTCTGG - Intronic
954369137 3:50161095-50161117 CCCCTCCCCAGCCCAGGGTCTGG + Intronic
954391033 3:50267985-50268007 CTTTGCCCCAGCTGAGGGCCAGG + Intronic
954409218 3:50362988-50363010 CAGTCCCCCAGCCCAAGGTGAGG + Intronic
954595357 3:51819677-51819699 CTTTGCCTCAGCAAAGGGTCAGG + Intronic
954628539 3:52035951-52035973 GACTCCCCCAGCCCAGGGTCAGG + Intergenic
954894492 3:53964111-53964133 CTTTCCCCAGGCCCAGGCACAGG + Intergenic
955406932 3:58631513-58631535 TTATCTCCCAGCCCAGGCTCAGG + Intergenic
955522538 3:59788670-59788692 CCTGCACCCAGCCCAGGGCCTGG + Intronic
955972097 3:64445743-64445765 CTTGTCCCCAGCCTAGGGGCAGG + Intergenic
959951502 3:112184978-112185000 TTCTCCCCCAGCCCAGGCTGGGG + Intronic
960583074 3:119296806-119296828 TTTTCCCCCTCCCCAGGGTGGGG - Intronic
960989596 3:123301899-123301921 CTTGCCACCAGCCCAGGGGTGGG + Intronic
961119104 3:124358089-124358111 ATTAGCCCCAGCCCAGGGTCTGG + Intronic
962257722 3:133883881-133883903 GTTTCCCCCAACCCTGGGGCAGG - Intronic
962809576 3:138949122-138949144 TTTTCCCCCTGCCCAGGCCCTGG - Intronic
962985337 3:140531098-140531120 CCTGCACCCAGCCCAGGGTTTGG + Intronic
968189103 3:196654581-196654603 TGTTCCTCCAGCCCACGGTCAGG - Exonic
968501146 4:950658-950680 CTTACCCCAAACCCAGGGCCTGG + Intronic
968614615 4:1571733-1571755 CCTTCCCCCTGTGCAGGGTCAGG - Intergenic
968807896 4:2787215-2787237 TATCACCCCAGCCCAGGGTCAGG - Intergenic
969226887 4:5804590-5804612 CCTTCCACCAGCACAGGGACAGG - Intronic
969365803 4:6693704-6693726 CTTTCCCCCAGCCAAGGCCCAGG - Exonic
969444972 4:7239501-7239523 CTTTCACCCAGGGAAGGGTCTGG - Intronic
970067589 4:12116528-12116550 CTTTCTCTCAGTCCTGGGTCTGG + Intergenic
970664969 4:18326398-18326420 CTTTCCCCTTGACCAGTGTCTGG + Intergenic
971352823 4:25868118-25868140 TTTTCCCCCAGCTCAGGGTGGGG - Intronic
975523755 4:75327424-75327446 CTTTCCCTGATCCCAGGGTATGG + Intergenic
976041028 4:80885463-80885485 CCTTCCTCCTGCCCAAGGTCAGG + Intronic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
981083257 4:140656475-140656497 TTTTCTGTCAGCCCAGGGTCTGG - Intronic
981614740 4:146634681-146634703 CTATCCCCCACCCCTGGGTGAGG - Intergenic
981841859 4:149122282-149122304 CTTTCCCTCAGCTCAGAGCCAGG + Intergenic
989218601 5:38930267-38930289 CTTTCCCCTTTTCCAGGGTCAGG + Intronic
989232540 5:39102452-39102474 CCTTCCCCCACCACATGGTCAGG + Intergenic
990992784 5:61701665-61701687 CTTTCCAGGAGCCCTGGGTCTGG + Intronic
991316144 5:65309092-65309114 CTTTTCCACAGACCAGGGTGGGG + Intronic
992269701 5:75052733-75052755 CTGTCCCGAAGCCCAGGGGCGGG + Intergenic
992344526 5:75863202-75863224 CTTTTCCCAAGCCCAAGTTCAGG - Intergenic
994636226 5:102346873-102346895 TTTTTCCCCAGCCCAGAGCCTGG - Intergenic
995476327 5:112552158-112552180 TCTTCCCCCAGCCCTTGGTCTGG - Intergenic
997582835 5:135028165-135028187 GGTGCCCCCAGCCCAGGATCGGG - Exonic
998404637 5:141867353-141867375 CTTTGCCGCAGCCAAGAGTCTGG - Intronic
999393118 5:151208674-151208696 TCTTCCTCCAGCCCAGGGTGGGG - Intronic
1001083112 5:168681309-168681331 CCTGCACCTAGCCCAGGGTCTGG + Intronic
1001399304 5:171437309-171437331 TTTTCCCTCAGCCCCGGGGCAGG + Intronic
1001879820 5:175233631-175233653 CTGACCTCCAGCACAGGGTCTGG + Intergenic
1002466428 5:179411093-179411115 CTTCCCCCCAGCCCTGCGCCTGG + Intergenic
1002575382 5:180171113-180171135 CCTTCCCCCAGCCCAGGAGTGGG + Intronic
1002736159 5:181387856-181387878 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1002748539 6:86968-86990 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1003144403 6:3497719-3497741 CTTTCACCCAGGCCAGAGTGCGG - Intergenic
1004900197 6:20186430-20186452 CTTTCCTGGAGCCCAGGGTGAGG + Intronic
1006042882 6:31270204-31270226 CCTTACCCCAGCTCAGGGTGAGG + Exonic
1006271602 6:32970304-32970326 CCTTCCCCCAGCCAGGGATCAGG - Intronic
1006514439 6:34538189-34538211 TTTTCCCCCATCTCAGGGCCTGG + Exonic
1006586519 6:35118292-35118314 CATTTCCCCAGCCCAGGCACTGG - Exonic
1006613943 6:35312198-35312220 GTTTCCCTCTGCCCAGGCTCTGG + Intronic
1007383387 6:41504432-41504454 CTGTCCCCAAGCCCAGGCTTAGG + Intergenic
1007789002 6:44298175-44298197 CTTTCCCCCAGCTGAAGGTCTGG + Intronic
1008909360 6:56716801-56716823 TTTTTCCACAGACCAGGGTCAGG + Intronic
1011216520 6:85011771-85011793 CATCTCCCTAGCCCAGGGTCTGG - Intergenic
1011516935 6:88165846-88165868 CTCTCGCCCAGCTCAGGGGCTGG + Exonic
1017164105 6:151391354-151391376 GCCACCCCCAGCCCAGGGTCCGG - Intronic
1019130111 6:169867183-169867205 CATTCACCCAGCCCAGGACCTGG - Intergenic
1019241255 6:170663384-170663406 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1019316643 7:390070-390092 CCTTCCCACAGCCGAGGGACAGG + Intergenic
1019433445 7:1010252-1010274 CTGTCCCCAAGCACTGGGTCTGG + Intronic
1019748304 7:2712850-2712872 CTCTTCCCCATCCCAGGGACGGG - Exonic
1022094671 7:27131036-27131058 CCCTCCCCCAGCCCAGGGGCCGG - Intronic
1022644242 7:32215926-32215948 CTTTGCCACAGCCCTGGGTCTGG + Intronic
1023624474 7:42102345-42102367 CCTTCCCCCAACTCAGGCTCAGG - Intronic
1023723955 7:43123156-43123178 ATGGCCCCCAGCCCAGCGTCTGG - Intronic
1024648132 7:51385589-51385611 CTTTCCCCCAGCACAGCAGCAGG - Intergenic
1025790234 7:64681549-64681571 CCTTCCTCAACCCCAGGGTCTGG + Intronic
1028391304 7:90320895-90320917 TGTGCCCCCAGCCCTGGGTCAGG + Intergenic
1029646420 7:101859227-101859249 CTCTCCCCCAGCTCAGGTGCAGG - Intronic
1029699462 7:102236844-102236866 CTTTCCCTCGGCACAGGCTCGGG + Intronic
1030323634 7:108196149-108196171 CTTATCCCCAGCACAGTGTCTGG + Intronic
1031415613 7:121492710-121492732 CTTTCCCCCACCCCAACCTCTGG - Intergenic
1031929224 7:127667534-127667556 CTGTCCCCCATCCCTGGATCAGG + Intronic
1032018155 7:128392688-128392710 CTGGCCCCCACCCCAGGGGCAGG - Exonic
1032784401 7:135188884-135188906 CCTTGCCCCAGCCCAGGCTCTGG + Intronic
1033097308 7:138442520-138442542 CTGGCCCCCACCCCAGGGGCAGG + Intergenic
1034088239 7:148339609-148339631 CTTCCCGCCAGCCCCGGTTCAGG - Intronic
1034237664 7:149585284-149585306 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034240745 7:149608943-149608965 CTTTTCCCCAGTCCTTGGTCTGG - Intergenic
1034729596 7:153374837-153374859 CCTTCCCCTATCCCAGGGTCTGG + Intergenic
1034815727 7:154170487-154170509 CTGAGCCCCAGCCCAGGGTTGGG - Intronic
1034943193 7:155245168-155245190 CTCTCACCCATCCCAGGGGCCGG + Intergenic
1035022268 7:155806718-155806740 CTCTTCCCCAGCCCAGGGCCCGG - Intronic
1035201617 7:157271199-157271221 CTTTTGCCCACTCCAGGGTCAGG - Intergenic
1035367179 7:158356936-158356958 CTGGGCCCCAGCACAGGGTCAGG + Intronic
1035506860 8:144711-144733 CTTTCCCCCATCGCAGCCTCAGG + Intergenic
1036692088 8:10950388-10950410 CTCTCCCCCAGCCCTGGCACAGG - Intronic
1037987906 8:23301101-23301123 CATTCAGCCAGCCCAGGGCCTGG - Intronic
1038062710 8:23930276-23930298 CCTGACCCCAGCCCAGGGCCAGG + Intergenic
1039417235 8:37406148-37406170 CTTTGCCCCTGCCCAAGGGCTGG - Intergenic
1039509371 8:38078598-38078620 CTGTCACCCAGGCCAGGGTGCGG - Intergenic
1042226106 8:66515625-66515647 CTGTCCCCCTGCTCTGGGTCTGG - Intronic
1043443376 8:80296720-80296742 CTTTCCCCCAACCCTGTGACAGG - Intergenic
1043990523 8:86747570-86747592 TTTTCCCCCATCTCAGGTTCAGG + Intergenic
1044478477 8:92656441-92656463 CTTTCCCTCAGCCCATTGCCAGG - Intergenic
1045673976 8:104588601-104588623 CTCTCCACCACCCGAGGGTCTGG + Intronic
1047275564 8:123402397-123402419 CTGGCCCCCACCCCAGGGGCAGG + Intronic
1048571900 8:135663514-135663536 CTCTCCCCCAACCCAGCGCCTGG + Intergenic
1048836534 8:138524251-138524273 CTTTCCCTGAGCCCTAGGTCAGG - Intergenic
1048862591 8:138735009-138735031 CTTTCCCCCAACCCACTGACAGG - Intronic
1049400971 8:142427068-142427090 CATTCCTCCAGGCCAGGGACAGG + Intergenic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1051192859 9:14533591-14533613 TTTGCCGCCAGCCCAGAGTCAGG - Intergenic
1052358549 9:27529563-27529585 TTTACCTCCAGCCCAGGGCCCGG + Exonic
1052996228 9:34552861-34552883 CTTACCCCCACCCCATGGTCTGG - Intronic
1053174095 9:35909913-35909935 CCTGCCCCCAGCACAGGGCCAGG + Intergenic
1057053223 9:91941631-91941653 TTTCCCTCCAGCACAGGGTCAGG + Intronic
1057182556 9:93037890-93037912 CCATCCCACAGCCCAGGGCCTGG + Intergenic
1059325940 9:113504042-113504064 CTTCCCACCAGCCCCGGGCCTGG - Intronic
1060508239 9:124214448-124214470 CCTGGCCCCAGCACAGGGTCCGG + Intergenic
1060658430 9:125388526-125388548 GTTGCGCCCAGCCCAGGGCCTGG - Intergenic
1060827948 9:126697009-126697031 CTTTGCGCCTGCCCAGGCTCAGG - Exonic
1061251219 9:129427650-129427672 CTTTCAGCCTGCCCAGTGTCCGG + Intergenic
1061798259 9:133100933-133100955 CTGTACCCCAGCCCTGGGTCAGG - Intronic
1061913906 9:133739063-133739085 ACTTGCCCCAGCCCAGAGTCAGG - Intronic
1061953291 9:133948461-133948483 CTTGCCCCCAGGTCAGGGGCAGG + Intronic
1062164801 9:135102249-135102271 CTTTCTCACATCTCAGGGTCAGG - Intronic
1062208248 9:135348999-135349021 CTGTGCTCCAGCCCAGGCTCAGG + Intergenic
1062247649 9:135577542-135577564 CTTTCCATCAGCCCAGGGCCTGG - Intergenic
1062317663 9:135976423-135976445 CCTTCCCCCTCCCCAGGGTCAGG - Intergenic
1062388828 9:136326120-136326142 CTTTGCCACAGCCCTGGGCCTGG - Intergenic
1062626963 9:137447775-137447797 CTGTCCCCCAGCCACGGGGCAGG + Exonic
1203601447 Un_KI270748v1:12618-12640 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1189276867 X:39792913-39792935 CATTCGCCCAGCTCAGGGCCAGG - Intergenic
1190243554 X:48676378-48676400 CTTTCCCGGAGCCCGGGCTCTGG + Intergenic
1190532369 X:51392620-51392642 CTCTCCCCCACCCCATCGTCTGG + Intergenic
1192198361 X:69047393-69047415 CTGAGCCCCAGACCAGGGTCAGG - Intergenic
1192234166 X:69285571-69285593 CTTTCCCTCTGCCCTGGCTCGGG - Intergenic
1193268919 X:79506757-79506779 CTTTCCTCCAGGCCAGGGCTGGG + Intergenic
1194349547 X:92808963-92808985 CTCTCTCCCAGCCAAGAGTCAGG + Intergenic
1195329190 X:103782904-103782926 TTTCTCCCCAGCACAGGGTCAGG - Intronic
1198301005 X:135334254-135334276 CATTCCCCCAGGCCAGGTTGGGG + Intronic
1198499441 X:137228361-137228383 TTTTCCACCAGCCCATGGACTGG - Intergenic
1198709030 X:139481369-139481391 CTTTCCCCCAACCCCGTGACAGG + Intergenic
1199824835 X:151488738-151488760 CTTTGCCCCAGGACAGGGTTAGG - Intergenic
1200172249 X:154085739-154085761 CTTTCCCCCACCCCACCCTCTGG - Intronic
1200399223 X:156009566-156009588 CACTCCCCCAGCACAGGGCCTGG - Intronic
1201257534 Y:12124023-12124045 CTGTCCCCTAGCCCAAGGGCAGG + Intergenic