ID: 1152420585

View in Genome Browser
Species Human (GRCh38)
Location 17:80190865-80190887
Sequence CTTCTGCAGCTCGCACACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152420585_1152420591 6 Left 1152420585 17:80190865-80190887 CCCAGGTGTGCGAGCTGCAGAAG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1152420591 17:80190894-80190916 GACCAGGTACCTGAGAGGCCGGG 0: 1
1: 0
2: 1
3: 18
4: 173
1152420585_1152420588 -10 Left 1152420585 17:80190865-80190887 CCCAGGTGTGCGAGCTGCAGAAG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1152420588 17:80190878-80190900 GCTGCAGAAGGAGCGAGACCAGG 0: 1
1: 0
2: 0
3: 29
4: 234
1152420585_1152420590 5 Left 1152420585 17:80190865-80190887 CCCAGGTGTGCGAGCTGCAGAAG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1152420590 17:80190893-80190915 AGACCAGGTACCTGAGAGGCCGG 0: 1
1: 0
2: 1
3: 21
4: 375
1152420585_1152420589 1 Left 1152420585 17:80190865-80190887 CCCAGGTGTGCGAGCTGCAGAAG 0: 1
1: 0
2: 0
3: 21
4: 144
Right 1152420589 17:80190889-80190911 AGCGAGACCAGGTACCTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152420585 Original CRISPR CTTCTGCAGCTCGCACACCT GGG (reversed) Exonic
900657573 1:3767294-3767316 CTCCTGCAGCTGGCTGACCTTGG - Exonic
900669131 1:3838991-3839013 CTCCAGCTGCTCGTACACCTCGG + Exonic
900878467 1:5363412-5363434 CTCCTCCAGCTCACACTCCTTGG + Intergenic
901145603 1:7062613-7062635 CTTCTGCAGCCCCCACACCCGGG - Intronic
903449200 1:23441441-23441463 CTTCTGTAGCTCGTCCTCCTGGG + Exonic
904166698 1:28561128-28561150 CTGCACCAGCTGGCACACCTGGG + Intronic
904702426 1:32365900-32365922 CTCCTGCAGGTGGCACAGCTGGG + Intronic
906701793 1:47864994-47865016 CTTCTGCAGCTCTCAGATCATGG + Intronic
909551843 1:76906865-76906887 CTTCTCCTGCTCACCCACCTTGG + Intronic
911571996 1:99528550-99528572 CCTTTGCAGTTCCCACACCTTGG + Intergenic
913324758 1:117617096-117617118 CCTCTCCCGCTCGCCCACCTTGG + Intronic
914877642 1:151524285-151524307 GTTCTGCAGCTCCATCACCTGGG - Exonic
917532889 1:175852944-175852966 TTACTGCAGCTCACCCACCTGGG + Intergenic
917612837 1:176706412-176706434 TTCCTCCAGCTCACACACCTTGG - Exonic
918912347 1:190590920-190590942 CTTCTGAAGCTACCACATCTAGG + Intergenic
919578205 1:199337586-199337608 CTGCTGCAGCTGCCAGACCTTGG + Intergenic
1063255881 10:4326757-4326779 CTTCTGCAGATCACAGCCCTGGG - Intergenic
1066462185 10:35621766-35621788 CTTCTGCTCTTCTCACACCTTGG + Intergenic
1067337152 10:45374824-45374846 CTTCTGCAGGTCGCACAGGGAGG + Intronic
1067462274 10:46466546-46466568 CTTCTGGAGCTCTCAGCCCTGGG + Intergenic
1067624923 10:47918091-47918113 CTTCTGGAGCTCTCAGCCCTGGG - Intergenic
1068759321 10:60690250-60690272 CTGCTTCAGCTCGCCCTCCTTGG - Intronic
1069545175 10:69322557-69322579 CTTTTGCAGCTGGAACACATAGG - Intronic
1075509051 10:123054251-123054273 CTTCTGGATATCGCCCACCTTGG + Exonic
1076344387 10:129770487-129770509 CATCTGCCGCTTGCTCACCTTGG + Intergenic
1077538120 11:3134139-3134161 CTTCTGCAGCTTCCATTCCTGGG + Intronic
1078335727 11:10461680-10461702 CTTCTGCAGCTCCCTCTCCTTGG - Exonic
1079668154 11:23134205-23134227 CTGCTGCAGCTACCACAACTTGG - Intergenic
1082058794 11:47842910-47842932 CTACTGCAGCCCGAACTCCTAGG - Intronic
1088782794 11:113152259-113152281 CTTCTGCAGCCTTTACACCTGGG - Intronic
1089580188 11:119476822-119476844 CTTCTGCAGCTTGAACCCCAAGG + Intergenic
1090843897 11:130515250-130515272 CTTCTCCAGCTGCCACCCCTTGG + Intergenic
1094020317 12:25907080-25907102 CTTCTCCACGTCACACACCTTGG + Intergenic
1094493056 12:30973141-30973163 GTTCTGCAGCTGGAACTCCTGGG + Intronic
1096606846 12:52772754-52772776 GTTCTGCAGCTTGCAAACCAAGG + Intronic
1098096558 12:66963075-66963097 CTCAAGCAGCTCGCCCACCTTGG - Intergenic
1103210850 12:119165311-119165333 CCTCTGCAGCCCAGACACCTGGG - Intergenic
1103793132 12:123485653-123485675 CTCCTGCAGCAAGAACACCTTGG + Exonic
1104624053 12:130338307-130338329 CTCCTGCATCTCCCGCACCTGGG - Intronic
1104624067 12:130338349-130338371 CTCCTGCATCTCCCACACCTGGG - Intronic
1104624095 12:130338433-130338455 CTCCTGCATCTCCCGCACCTGGG - Intronic
1104624109 12:130338475-130338497 CTCCTGCATCTCCCACACCTGGG - Intronic
1104624122 12:130338517-130338539 CTTCTGCATCTCCCGCACCTGGG - Intronic
1104624136 12:130338559-130338581 CTCCTGCATCTCCCACACCTGGG - Intronic
1104624166 12:130338643-130338665 CTCCTGCATCTCCCACACCTGGG - Intronic
1104624196 12:130338727-130338749 CTCCTGCATCTCCCAAACCTGGG - Intronic
1107978561 13:45713513-45713535 CTCCTGCAGCATGCACTCCTTGG - Exonic
1113828140 13:113272939-113272961 CATCAGCAACTCCCACACCTCGG + Intergenic
1115046507 14:29001257-29001279 CCTATGCAGCTGGCACAACTAGG - Intergenic
1120720547 14:87885634-87885656 CTTCTGGAGCCTGCACTCCTTGG - Intronic
1123023081 14:105411363-105411385 TTCCGGCGGCTCGCACACCTGGG - Exonic
1202898048 14_GL000194v1_random:21341-21363 CTTCTGCTTGTTGCACACCTGGG - Intergenic
1125005407 15:34811213-34811235 CTTCTGAATCTCGCACACATTGG + Intergenic
1126225024 15:46261030-46261052 CAGCTGCAGCTGCCACACCTCGG - Intergenic
1126862668 15:52902403-52902425 CTGCTCCAGCTCGCACTCCGTGG - Intergenic
1127188800 15:56507547-56507569 CTGCTGCAGCTGCCACACCTTGG + Intergenic
1127316402 15:57798271-57798293 CTTCTGAACATGGCACACCTTGG - Intergenic
1133532103 16:6664864-6664886 CTTCACCAGCTGGCAGACCTTGG + Intronic
1139000811 16:62507458-62507480 CTTCTGAAGTTCTCTCACCTAGG - Intergenic
1140217988 16:73023583-73023605 CTTACGCAGGTCACACACCTAGG + Intronic
1141003523 16:80330794-80330816 GTTCTACAGCTCAAACACCTGGG + Intergenic
1141811178 16:86377494-86377516 CTCCTGCTTCTCCCACACCTCGG - Intergenic
1141923510 16:87152382-87152404 TTTCTCCAGCTCCCACTCCTTGG + Intronic
1142410255 16:89912424-89912446 CTGCTGCAGCCCTAACACCTTGG - Intronic
1142712849 17:1732754-1732776 CTTCTGCAGCTCGTCCAGCAGGG - Exonic
1143023665 17:3929151-3929173 CTTCAGGAGCTCCCAGACCTGGG - Intronic
1145260101 17:21349555-21349577 CTTCTGCAGCAGGCACAGCCAGG + Intergenic
1145316517 17:21738383-21738405 CTTCTGCAGCAGGCACAGCCAGG - Intergenic
1145714942 17:27010290-27010312 CTTCTGCAGCAGGCACAGCCAGG - Intergenic
1148622709 17:49046255-49046277 ATTCTGCAACTCGTTCACCTGGG - Exonic
1148848735 17:50543956-50543978 CTTCTGCTGCACCCAAACCTGGG + Intronic
1150067581 17:62124507-62124529 GGTCTGCAGCTTCCACACCTAGG + Intergenic
1151051958 17:70988211-70988233 CATCTGCAGCTGGCTCACTTAGG + Intergenic
1151615980 17:75211839-75211861 CTTCTGAAGCTGGAACAACTTGG - Intronic
1152420585 17:80190865-80190887 CTTCTGCAGCTCGCACACCTGGG - Exonic
1157274206 18:46298711-46298733 CTGCGGCAGCTGGCAGACCTTGG + Intergenic
1160318023 18:77866146-77866168 CTTCTGCCGCTCACACACGCTGG + Intergenic
1160688971 19:451971-451993 ATTCTGCAGCTCCGACACCACGG - Intronic
1161146839 19:2683939-2683961 CTTTTGCAGCTCGGCCCCCTGGG - Intronic
1164156608 19:22601273-22601295 CCTCAGCAACTCCCACACCTGGG - Intergenic
1165966012 19:39581578-39581600 CATCTGCATCTCACACACCTGGG - Intergenic
1165977663 19:39691526-39691548 CATCTGCCTCTCACACACCTGGG - Intergenic
1167379528 19:49130460-49130482 CTCCCGCAGCTGGCACACCTCGG - Exonic
925044748 2:764381-764403 AGCCTGCAGCTCCCACACCTCGG + Intergenic
928532079 2:32202774-32202796 TTTCTGCAGCTCGCCCACAGTGG + Intronic
928820422 2:35355284-35355306 CCACTGCAGCCGGCACACCTGGG - Intergenic
933659310 2:84914650-84914672 CTTCTGCCGCTTCTACACCTGGG - Intergenic
936847285 2:116852612-116852634 CTGCTGCAGCTGTCACACATTGG + Intergenic
936847533 2:116854583-116854605 CTGCTGCAGCTGCCACACATTGG + Intergenic
937217731 2:120323412-120323434 CATCTGCAGTTCCCACGCCTCGG + Intergenic
937439424 2:121903760-121903782 CTTCTCCAGCTCCCAGAACTGGG - Intergenic
940637164 2:156312123-156312145 CTTCTGCAGCATGCACACCCTGG + Intergenic
942450705 2:176106717-176106739 CCTCTGCAGCTCACCCGCCTGGG - Intronic
943660396 2:190554004-190554026 CTGCTTCAGCTCGCCCTCCTTGG - Intergenic
944854183 2:203750560-203750582 CTTCTGCACCTGGCAGATCTAGG - Intergenic
945490880 2:210453414-210453436 CTTCTGTAGCTTGTATACCTGGG - Intronic
947588895 2:231373401-231373423 CTTCTGCTGCTCCCACACCAAGG - Intronic
1168898499 20:1340328-1340350 CTTCTGTAGCTGGCAGACCCAGG + Intronic
1171343749 20:24450377-24450399 TTTCTGCAGCACACACACTTGGG + Intergenic
1176707419 21:10126357-10126379 CTTCTGCTTGTTGCACACCTGGG + Intergenic
1179563036 21:42228782-42228804 CTTCTGCAGCTAGCACCCTTTGG - Intronic
1180705208 22:17805291-17805313 CAGCAGCAGCACGCACACCTGGG + Intronic
950524827 3:13517558-13517580 CTTCTGCAGCTCCCAGGCCTGGG + Intergenic
950908624 3:16563582-16563604 CTTCTGCTTGTGGCACACCTGGG + Intergenic
954215371 3:49121508-49121530 CCTGTGCAGCCAGCACACCTTGG + Exonic
954579592 3:51696072-51696094 CATCTGCAACTCTCCCACCTTGG + Intronic
955725788 3:61931165-61931187 CTTCTGCAGCACTCACTGCTGGG + Intronic
956845976 3:73183336-73183358 CTTGTGCAGCACGCACTCCCCGG - Intergenic
960589888 3:119355144-119355166 CTTTGGCAGCACACACACCTGGG + Intronic
961823176 3:129585639-129585661 TTGCTGCAGGTCGCACAGCTAGG - Intronic
969477199 4:7428434-7428456 CTCCTGCAGCTCGCATTCCAAGG + Intronic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
970377211 4:15471188-15471210 CTCCTGGAGCTTGGACACCTGGG - Intronic
971236039 4:24843312-24843334 CTGCTGCAGATAGCACACCTGGG + Intronic
974867340 4:67597158-67597180 CTGCTGGAGCTGGCACAGCTGGG - Intronic
975847145 4:78536678-78536700 CAACTGCATCTCACACACCTTGG + Intronic
976072820 4:81260904-81260926 CCTCTGCAGCTCCCACCTCTGGG - Intergenic
978928901 4:114287177-114287199 CTGCTTCAGCTCGCCCTCCTTGG - Intergenic
979310481 4:119197823-119197845 CTCCTGCAGCTCGCCCTCCTTGG - Intronic
982049747 4:151489106-151489128 CTTCTCCTCCTCTCACACCTTGG - Intronic
983602837 4:169549258-169549280 CTGCTTCAGCTCGCCCTCCTTGG + Intronic
984952265 4:185016651-185016673 GGTCTGCACCTCGCACCCCTAGG - Intergenic
989418195 5:41205392-41205414 CTTCTTCAGCTCACACTCCATGG - Intronic
990429858 5:55724098-55724120 CTTGTGCAACTCCCAAACCTGGG - Intronic
995489880 5:112679476-112679498 CTTCTTCAGCTCGCCCTCCATGG + Intergenic
997918321 5:137951422-137951444 CTTCAGCAGTTCTCCCACCTCGG - Intronic
1000044023 5:157507022-157507044 CTTCTGCAGCGCACACACACGGG + Intronic
1000774587 5:165403443-165403465 CACCTGCAGTTCGAACACCTTGG + Intergenic
1002945495 6:1757376-1757398 CTTCTGTCGCTCGGATACCTGGG + Intronic
1003041358 6:2690427-2690449 CTTATGCTGCTGACACACCTGGG + Intronic
1003088738 6:3083076-3083098 CTTTCGCAGATCGCAGACCTCGG + Exonic
1004560891 6:16749565-16749587 CTTCTGCAGCTCAGGCACCTTGG - Intronic
1005804142 6:29458190-29458212 CTTCTTCAGCCAGCCCACCTGGG + Intronic
1007415822 6:41690743-41690765 CGTGTCCAGCTCGCACCCCTGGG + Exonic
1007914074 6:45544571-45544593 CTTCTGCAGGGGGCACACGTTGG + Intronic
1013016304 6:106163648-106163670 CTGCTGCAGCAAGCACCCCTGGG + Intergenic
1013366657 6:109442365-109442387 CTTCTCTAGCTCTCATACCTGGG + Intronic
1018007303 6:159634317-159634339 CTTCAGGAGCTTGCACTCCTTGG - Intergenic
1019884598 7:3892972-3892994 CTACTGCAGCTCGGCCTCCTGGG - Intronic
1021044480 7:15905921-15905943 CTTCTGGAGCTCCACCACCTCGG - Intergenic
1023131662 7:37009535-37009557 CTTCTGCAGCCCGCCTTCCTTGG - Intronic
1029536140 7:101159054-101159076 GATGTCCAGCTCGCACACCTGGG - Exonic
1030533949 7:110743628-110743650 CTGCTTCAGCTCGCCCTCCTTGG - Intronic
1030809211 7:113955193-113955215 CTGCTGCAGCTGCCACACTTTGG - Intronic
1031612573 7:123845001-123845023 CTGCTTCAGCTCGCCCTCCTTGG + Intronic
1034468577 7:151243994-151244016 CTTCTGCAGCTCGCATCTTTTGG - Intronic
1034883998 7:154783721-154783743 CATCTGCAGGTCCCACGCCTTGG + Intronic
1035382478 7:158448608-158448630 CTCCTGCAGCTCCCACTCCTGGG + Intronic
1035558879 8:590036-590058 CTTCTTCAGCTCACACTCCATGG + Intergenic
1040772359 8:50992452-50992474 CTGCTTCGGCTCACACACCTGGG + Intergenic
1041687080 8:60653504-60653526 CTGCTGCAGCTCTCATACCTCGG + Intergenic
1044329447 8:90899228-90899250 CATCTCCAGCTGCCACACCTTGG - Intronic
1049709391 8:144056835-144056857 GTTCTGCTTCTCGCACACCCCGG + Intronic
1050087122 9:1977757-1977779 TGTCTGCAGCTCCCACACCATGG - Intergenic
1052146996 9:25061632-25061654 CTGCTTCAGCTCGCCCTCCTGGG + Intergenic
1056907329 9:90665173-90665195 CGGCTGCAGCTGCCACACCTTGG - Intergenic
1057313372 9:93954973-93954995 CTTCAGCAGCTCGCCCGCCGCGG + Exonic
1057885571 9:98827133-98827155 CTTCTCCAGCTGGCACTCCCAGG - Intronic
1060814787 9:126629231-126629253 CTTCTGCGGCTCACAAACTTGGG - Intronic
1202792166 9_KI270719v1_random:95237-95259 CTTCTGCTTGTTGCACACCTGGG + Intergenic
1189940574 X:46117109-46117131 CTGCTGCAGCTGCCACACCTTGG - Intergenic
1196616534 X:117772449-117772471 ATCCTGCAGCTAGCACACCCTGG - Intergenic
1198767292 X:140092197-140092219 CTCCTCCACCTCGCACTCCTAGG + Intergenic
1201151116 Y:11096168-11096190 CTTCTGCTTGTTGCACACCTGGG - Intergenic
1201776197 Y:17668557-17668579 CTTCTTCAGCTCACACTCCATGG + Intergenic
1201825359 Y:18237435-18237457 CTTCTTCAGCTCACACTCCATGG - Intergenic