ID: 1152422007

View in Genome Browser
Species Human (GRCh38)
Location 17:80198584-80198606
Sequence TTGTGATGGTGAGCCGTGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152421996_1152422007 23 Left 1152421996 17:80198538-80198560 CCGGGCTCGGCGGCGGACCAGAT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1152421994_1152422007 25 Left 1152421994 17:80198536-80198558 CCCCGGGCTCGGCGGCGGACCAG 0: 1
1: 0
2: 0
3: 17
4: 119
Right 1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1152422000_1152422007 6 Left 1152422000 17:80198555-80198577 CCAGATGGCCTTGCGCCCGGGCA 0: 1
1: 0
2: 0
3: 14
4: 345
Right 1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1152422002_1152422007 -9 Left 1152422002 17:80198570-80198592 CCCGGGCACCCAGATTGTGATGG 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1152422001_1152422007 -2 Left 1152422001 17:80198563-80198585 CCTTGCGCCCGGGCACCCAGATT 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1152422004_1152422007 -10 Left 1152422004 17:80198571-80198593 CCGGGCACCCAGATTGTGATGGT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1152421995_1152422007 24 Left 1152421995 17:80198537-80198559 CCCGGGCTCGGCGGCGGACCAGA 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152422007 Original CRISPR TTGTGATGGTGAGCCGTGCG AGG Exonic
908252846 1:62278683-62278705 TTGTGTGGGTCAGCCGGGCGTGG - Intronic
912448955 1:109758126-109758148 TTGTGGTGGGGAGGGGTGCGGGG - Intronic
915094518 1:153451701-153451723 TTGTGATGGTAAGGAGTGGGAGG + Intergenic
920809119 1:209265446-209265468 TTGAGATGGTAAGCGGTGTGGGG - Intergenic
923165384 1:231356443-231356465 TTGTGCTGGGCAGCCGGGCGTGG + Intergenic
923540557 1:234885429-234885451 TTGAGATGGTGAGATGTCCGAGG + Intergenic
1079239703 11:18713942-18713964 TGGAGATGGTGAGCAGTGCCTGG + Exonic
1084772219 11:71350709-71350731 GTGTGATGGGGAGCCCGGCGTGG - Intergenic
1086167111 11:83791641-83791663 ATGAGATGGTCAGCCGGGCGCGG + Intronic
1088719278 11:112577530-112577552 TTGTGAAGGTGAGTAGTGGGAGG + Intergenic
1096529886 12:52235903-52235925 TGGTCATTGTGAGCCATGCGAGG + Intronic
1104786057 12:131448557-131448579 GTGTGTGGGTGAGCAGTGCGGGG - Intergenic
1119214954 14:72862316-72862338 TTGTGATGGTGAGGACTGTGAGG - Intronic
1202904442 14_GL000194v1_random:60168-60190 TTGTGCTGGTGAGACTTGGGCGG - Intergenic
1124930217 15:34112394-34112416 TTGAGATGGTAGGCCGGGCGCGG - Intergenic
1127631423 15:60831320-60831342 TCGTGAGGGTGACCCCTGCGAGG - Intronic
1133057230 16:3151531-3151553 TAGTGGTGATGAGCCGGGCGCGG + Intergenic
1139788304 16:69411844-69411866 TTGGGATGGTGAGCCACGCTGGG - Intergenic
1152422007 17:80198584-80198606 TTGTGATGGTGAGCCGTGCGAGG + Exonic
1161797152 19:6393715-6393737 TTGTGACGTTGAGCCGAGCCAGG + Intronic
1163105878 19:15122857-15122879 TGGTGATGCTGAGCAGTGCTGGG - Intronic
1166542003 19:43611746-43611768 GTGTGATGGAGAGCAGTGCAGGG - Intronic
1168515052 19:57003918-57003940 TTCTGCTGGTGAGCCCTGCCCGG - Intergenic
925160240 2:1678308-1678330 TGGTGATGGGGAGCCATGGGAGG - Intronic
925724973 2:6863844-6863866 TTGTGATGATGTGCCTTGCCTGG - Intronic
936460381 2:112710000-112710022 TTGTGAGGGTGTGCAGTGTGCGG + Intergenic
937247970 2:120505759-120505781 TAGTGATGGGGAGCCATGAGGGG + Intergenic
944144844 2:196495876-196495898 TCATGATGGTGAGCAGTGGGCGG + Intronic
1175790496 20:61737437-61737459 GTGGGATGGGGAGCCGTGCAGGG - Intronic
1176089134 20:63311319-63311341 GTGTGAGGGTGCCCCGTGCGTGG + Intronic
1181286093 22:21753620-21753642 TTGTGGTGGGGTGCCGTGCAGGG + Intergenic
1184804394 22:46783352-46783374 CTGTGAAGGTGAGGTGTGCGTGG - Intronic
1185153606 22:49180225-49180247 TTAGGGTGGTGAGCCGTGGGGGG - Intergenic
952341397 3:32450614-32450636 GTGTGATGGTGGGCTGTGGGAGG - Intronic
972322091 4:37981532-37981554 TTCAGATGGTGATCAGTGCGAGG + Intronic
982989907 4:162259903-162259925 TGGTGATGGTGTGCGGTGGGGGG - Intergenic
985886057 5:2679818-2679840 TTGTGATGTTGAGTCGGCCGAGG - Intergenic
999778015 5:154826235-154826257 ATGTGATGGGGAGCCGGGCGCGG + Intronic
1015053395 6:128869684-128869706 TTGTGGGGGTGAGCAGTGCCTGG - Intergenic
1015571446 6:134625364-134625386 TTGTGATGGGCAGCCATGCAGGG + Intergenic
1016383846 6:143512266-143512288 TTCTGATGTTGGGCCGGGCGCGG + Intergenic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1038337569 8:26657973-26657995 TTGTGATTGTGACCCATGAGTGG + Exonic
1056063913 9:82913829-82913851 TGGTGCTGGTGAGCTGTGGGTGG - Intergenic
1058231219 9:102428321-102428343 TTGTGATGGTTTGCCGGGTGCGG - Intergenic
1185530837 X:817090-817112 TTGTGATGTTGAACCGTGCACGG + Intergenic
1195302341 X:103542976-103542998 CTGTGATGCTGAGCCCTGGGTGG - Intergenic
1197916593 X:131542335-131542357 TTGAGAAGGTGAGCTGTGCAAGG + Intergenic
1199698914 X:150362662-150362684 ACGAGCTGGTGAGCCGTGCGTGG - Intronic