ID: 1152423180

View in Genome Browser
Species Human (GRCh38)
Location 17:80204966-80204988
Sequence CAGCCAGCCTACCCTGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152423180_1152423193 24 Left 1152423180 17:80204966-80204988 CCCGGGGCAGGGTAGGCTGGCTG 0: 1
1: 0
2: 6
3: 45
4: 456
Right 1152423193 17:80205013-80205035 CTCAGGATCCTCTCCTCCACAGG 0: 1
1: 0
2: 1
3: 30
4: 206
1152423180_1152423187 7 Left 1152423180 17:80204966-80204988 CCCGGGGCAGGGTAGGCTGGCTG 0: 1
1: 0
2: 6
3: 45
4: 456
Right 1152423187 17:80204996-80205018 CCGCAGCCTCACCCACCCTCAGG 0: 1
1: 0
2: 5
3: 31
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152423180 Original CRISPR CAGCCAGCCTACCCTGCCCC GGG (reversed) Intronic
900142468 1:1144466-1144488 CAGCCGCCCTGCCCTGCCCGTGG - Intergenic
900373739 1:2343984-2344006 CCCCCACCCCACCCTGCCCCTGG - Intronic
900844634 1:5087037-5087059 CAGCCAAACTGCCCTGCTCCAGG - Intergenic
900888522 1:5432376-5432398 CAGCCAGCCTGCCCACCCCAGGG + Intergenic
901052319 1:6431322-6431344 GAGCCACCGTACCCAGCCCCAGG - Intronic
901084376 1:6601765-6601787 CAGAGAGCCTGCCCAGCCCCTGG + Intronic
901160419 1:7172983-7173005 CAGCCAGCCCATCCTCCCCGAGG - Intronic
901658468 1:10784135-10784157 CAGCCATCTCACCCTGCCCTGGG + Intronic
901677186 1:10892391-10892413 CAGTCAGGCCACTCTGCCCCAGG + Intergenic
901685286 1:10940388-10940410 CCGCCAGCCTCCACTGGCCCTGG - Intergenic
901868288 1:12122313-12122335 GAGCCACCCTACCCTGCCAGGGG + Intronic
902337590 1:15762776-15762798 GAGCCAGCCTGTCCTGCCCTGGG + Intronic
902481915 1:16716689-16716711 GAGCCACCATACCCAGCCCCAGG + Intergenic
903265493 1:22155645-22155667 CAGCCAGCCTGACCAGCCCTGGG - Intergenic
903447980 1:23434555-23434577 CAACCAGGCTTCCCTGCCTCTGG - Exonic
903778225 1:25806549-25806571 CAAGCAGCCCACCATGCCCCTGG - Intronic
904234945 1:29109470-29109492 CAGCAAGCTTAGCCTGCCCCTGG - Intronic
904852444 1:33468961-33468983 CACCCATTCTACCCTACCCCAGG - Intergenic
905796313 1:40818456-40818478 CAGCCAGCCTACCCCGCGCACGG - Intronic
905856923 1:41320431-41320453 CAGCCACCCTCCCCTGCACAGGG - Intergenic
905864436 1:41369030-41369052 CAGCCAGCCTTCCTGCCCCCAGG + Intronic
905869600 1:41395491-41395513 CAGCCACCCCTCCCAGCCCCAGG + Intergenic
908350997 1:63286342-63286364 ATGCCAGCCTACACGGCCCCAGG + Intergenic
908475445 1:64483548-64483570 CACCCAGCCCAGCCTGCCCTTGG - Intronic
912556884 1:110522950-110522972 GAGCCAGCCTGCCATGGCCCGGG - Intergenic
912624458 1:111195962-111195984 GAGGCAGCCTTCCCTGCTCCTGG - Exonic
913212425 1:116592622-116592644 CAGCCAGCCTACCCTCCCTTCGG + Intronic
913243675 1:116852567-116852589 CAGACAGCATTCCCAGCCCCTGG + Intergenic
915535114 1:156530768-156530790 CAGCGGGCCCAACCTGCCCCTGG + Intronic
915631390 1:157155906-157155928 CACCCCGCCCACCCTGCCCCCGG + Intergenic
916127169 1:161581648-161581670 CAGCCTGCCTTCCCTCCCCTGGG - Intronic
916137089 1:161663452-161663474 CAGCCTGCCTTCCCTCCCCTGGG - Intronic
916579998 1:166098082-166098104 CAGCGAGTCTACCCGGCTCCAGG - Intronic
918317960 1:183339005-183339027 CTGCCAGGCGACCCTGCCCAAGG + Intronic
919525027 1:198636518-198636540 CAACCAGCCCACCCTCCCTCTGG + Intergenic
920126348 1:203696489-203696511 AAGTCACCCTACCCTGCCTCTGG + Intronic
920399839 1:205669870-205669892 CACCAAGGCTGCCCTGCCCCAGG + Intronic
920646319 1:207806753-207806775 CACCAAGGTTACCCTGCCCCTGG + Intergenic
920655131 1:207868935-207868957 CAGGGAGCCCACCCTACCCCGGG + Intergenic
920883162 1:209899062-209899084 CAGCCAGCCTTGCTGGCCCCGGG - Intergenic
921193678 1:212731878-212731900 GGGACACCCTACCCTGCCCCAGG + Intronic
923495501 1:234521017-234521039 CAGCCAGCCCACCCTTGCCAGGG - Intergenic
923658696 1:235940306-235940328 CAGCCACACTAACCTTCCCCAGG - Intergenic
1062858004 10:789162-789184 CAGCCAGCGCCCCCTGGCCCCGG - Intergenic
1063902429 10:10748056-10748078 CAGCCAGCCTTCCCAGCCTCTGG - Intergenic
1064985383 10:21204711-21204733 CACCCAGCCTGCCCTGCCTGGGG + Intergenic
1066357164 10:34695831-34695853 CAGGCAGCCTACCCTGTGCAGGG - Intronic
1067344473 10:45427734-45427756 CAGCAGGCCTACCCTGCACCTGG + Intronic
1068702326 10:60033269-60033291 CCGCCCCCCTCCCCTGCCCCCGG - Intronic
1069325348 10:67225576-67225598 CAGCAAGTCTACCCTGCTCTGGG - Intronic
1069903117 10:71717201-71717223 CAGCCAGCCAAGCCTTCCCAAGG - Intronic
1070334399 10:75441290-75441312 CAGTCAGGCTGCCCTGCACCCGG + Intronic
1071278421 10:84077331-84077353 CAGCCACCACACCCAGCCCCTGG - Intergenic
1071574685 10:86716622-86716644 CAGCAAGCAGACCCTGCCCCGGG + Exonic
1071614996 10:87067125-87067147 CTGCCAGCCTATTCTTCCCCAGG + Intronic
1072898513 10:99387743-99387765 CAGCCAGCCTTCCCAGGCTCGGG - Intronic
1072923804 10:99598645-99598667 CACTCACCCCACCCTGCCCCTGG + Intergenic
1072928047 10:99634001-99634023 CAGCAAGTCTACCCAGCCCCAGG - Intergenic
1073176284 10:101559565-101559587 CAGCCAGCCCAACCCTCCCCTGG + Intergenic
1074153365 10:110778213-110778235 CAGCCAGCCTGTTCTGCCCTTGG + Intronic
1075675900 10:124295635-124295657 CAGGCAGCCTGCTCTGCCCGCGG - Intergenic
1076445697 10:130512390-130512412 CAGACAGGCTGCCCAGCCCCGGG - Intergenic
1076888445 10:133273042-133273064 CAGTCAGCCTTCCCAGCGCCGGG + Intronic
1077497884 11:2895326-2895348 CAGCCTCCCTTCCCTGCTCCAGG - Intronic
1078709649 11:13778674-13778696 CAGACAGCCTTCTCTGTCCCAGG - Intergenic
1080588038 11:33699083-33699105 CAGCCACCACACCCGGCCCCTGG + Intronic
1081276677 11:41158062-41158084 CAGCCACCCTTCCCAGCCTCTGG + Intronic
1082912340 11:58390833-58390855 CAGCCAGCCCTGCCAGCCCCGGG - Intergenic
1083238746 11:61370152-61370174 CAGCCTGCCTACCCTACCCGAGG - Intergenic
1083264117 11:61538254-61538276 CATCCGGCCTTCCCTGCCCGGGG + Intronic
1083329713 11:61891749-61891771 CCGCCACCCAGCCCTGCCCCGGG + Intronic
1083797320 11:65024687-65024709 CAGGAAGCCTCCCCGGCCCCTGG - Intronic
1083859323 11:65411573-65411595 CAGCCTGCCCTCCCTTCCCCCGG + Exonic
1083954619 11:65976599-65976621 CAGCCAGCCCACCCAGCCGAGGG - Intronic
1084275451 11:68049014-68049036 CTGCCAGCCTCCCGTCCCCCGGG - Intronic
1084462048 11:69301682-69301704 CAGCCTGCCCACCCTGCAGCAGG - Intronic
1084650134 11:70484739-70484761 CTGCCAGCCCATCCTGTCCCAGG - Intronic
1084680715 11:70664689-70664711 CTGCCAGCATACCCTGCGACGGG + Intronic
1085533421 11:77204568-77204590 CAGCCGGCCCAGCCTGCACCAGG - Intronic
1085747889 11:79130089-79130111 CAGCAAGTCTACCCAGCTCCAGG - Intronic
1089296461 11:117471836-117471858 CACCCAGCCTGCCCTGCCCATGG - Intronic
1089513349 11:119015370-119015392 CAGCCAGCCTGCACTGGTCCTGG - Exonic
1089572459 11:119419540-119419562 CTTCCTTCCTACCCTGCCCCCGG - Intronic
1089773129 11:120817338-120817360 CAGCCAGACTGCACTGCCCTGGG + Intronic
1090225874 11:125072010-125072032 CAGCCAGCCTAGCCTGGGACTGG + Intronic
1090404843 11:126470393-126470415 CAGCCATCCCTCCCTCCCCCTGG + Intronic
1090768315 11:129895873-129895895 CAGAGAGCATACCCTGCCCCAGG + Intergenic
1091418649 12:314700-314722 TACCAACCCTACCCTGCCCCTGG - Intronic
1091453423 12:587655-587677 GAGCCATTCTTCCCTGCCCCGGG + Intronic
1091751252 12:3022496-3022518 CACCCAGCTGACTCTGCCCCAGG + Intronic
1091807345 12:3365985-3366007 CAGCCTCCCTCCCCCGCCCCCGG + Intergenic
1093928318 12:24930473-24930495 CAGCCAGCCTTGACTGTCCCAGG + Intronic
1096520246 12:52180879-52180901 TAGCCTGCCCAGCCTGCCCCAGG - Intronic
1096520972 12:52184320-52184342 CAGCCACTCTCCTCTGCCCCAGG + Intronic
1097156587 12:57016405-57016427 CTGCCAGACCACCCAGCCCCCGG - Exonic
1099777352 12:87150961-87150983 CAGCGAGTCTACCCAGCTCCAGG + Intergenic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1101734505 12:107453138-107453160 CAGCCAGCCTGGCCTCCCCTTGG - Intronic
1103557502 12:121775294-121775316 CTGCCAGCCCAGCCCGCCCCAGG - Intronic
1103763351 12:123266396-123266418 CCACCAGGCTGCCCTGCCCCAGG - Intronic
1103912432 12:124359829-124359851 AAGCCAGCCTATTCTGCCCCTGG - Intronic
1104293928 12:127494816-127494838 CAGTCACCCCTCCCTGCCCCAGG - Intergenic
1104768513 12:131345889-131345911 AAGCCCTCCTGCCCTGCCCCAGG + Intergenic
1104811531 12:131622699-131622721 CGGCCCTCCTGCCCTGCCCCGGG - Intergenic
1104941680 12:132398197-132398219 CAGCCAGTCACACCTGCCCCAGG - Intergenic
1104966040 12:132509249-132509271 CAGCCAGTCCAGCCAGCCCCAGG + Intronic
1106597836 13:31161766-31161788 CAGCCAGCCGCCGCTGTCCCCGG - Exonic
1106719986 13:32427492-32427514 CCCCCAGCCTCCCCAGCCCCAGG - Intronic
1107966078 13:45599260-45599282 CGGCCAACTTTCCCTGCCCCAGG - Intronic
1108039784 13:46329425-46329447 CAACCCCCCTACCCTCCCCCTGG - Intergenic
1108555864 13:51591836-51591858 CTGCCAGCCTACCCCACCCCTGG + Intronic
1109213510 13:59562665-59562687 CAGCAAGTCTACCCAGCTCCAGG + Intergenic
1112240358 13:97675346-97675368 CATCCAGCCAACCCTGCAACTGG + Intergenic
1113330283 13:109319803-109319825 CAGCAAGTCTACCCTGCTCCGGG - Intergenic
1113988418 13:114338542-114338564 CAGCCAGCCTTCTCTCCCTCTGG + Intergenic
1114620896 14:24095386-24095408 TAGCCCTCCTCCCCTGCCCCTGG + Intronic
1115535846 14:34372661-34372683 GTGCCAGCATAGCCTGCCCCTGG - Intronic
1115835418 14:37397262-37397284 CAGCAAGCCTACCCGGCTCTGGG + Intronic
1116459180 14:45151810-45151832 AAGCAATCCTACCCTGCCTCAGG - Intronic
1116781278 14:49240596-49240618 CCACCAACCTACCCTGCTCCAGG - Intergenic
1117825380 14:59696577-59696599 CAGCCTGCCAGCCCTGCCCTTGG - Intronic
1118615022 14:67569302-67569324 AGGCCAGCCAACCCTGGCCCTGG - Intronic
1118720455 14:68590291-68590313 CAGCCAGTCTACCCAGGCTCAGG + Intronic
1119367977 14:74111584-74111606 GAGCCACCATGCCCTGCCCCTGG + Intronic
1121261359 14:92568723-92568745 CCTCCAGCCTCCTCTGCCCCAGG + Intronic
1121801942 14:96781754-96781776 CAGTCAACTTCCCCTGCCCCCGG - Intergenic
1122544969 14:102517117-102517139 CAGCCCGCGAACCCCGCCCCCGG - Intergenic
1122645380 14:103189983-103190005 AAGCCCGCCTCCCCTTCCCCTGG + Intergenic
1122787079 14:104168773-104168795 CACACAGCTTCCCCTGCCCCCGG - Intronic
1122971131 14:105152657-105152679 CCGCTGGCCTACCCAGCCCCTGG - Intronic
1123939138 15:25208347-25208369 CCGCCAACCTGCCCCGCCCCTGG - Intergenic
1124702170 15:31925517-31925539 CTGCCATCCTACCCTGTCCCAGG + Intergenic
1125168105 15:36734578-36734600 CAGCCTGCCTAGCCTGTCTCAGG + Intronic
1125672057 15:41480872-41480894 CCACCAGCCTCCCCTCCCCCAGG + Exonic
1125836844 15:42759406-42759428 CAGCCTGCTGAGCCTGCCCCTGG + Intronic
1126147397 15:45488924-45488946 CTGCCAGGCTATCCTGCCCATGG + Exonic
1126615759 15:50577556-50577578 CTGCCACCCTTCCCTGCCCCCGG - Intronic
1127772486 15:62242999-62243021 CTGCCAGCCCACCCTGCCCAAGG + Intergenic
1128112679 15:65086562-65086584 CAGGCAGCCTCCCCAGCCCTGGG + Intergenic
1128317780 15:66671879-66671901 CAGCCTGCCTCCGCGGCCCCAGG + Intronic
1128460277 15:67861667-67861689 CAGCCAGCCTATTCTCTCCCTGG - Intergenic
1128745503 15:70111479-70111501 CAGCCAGCCTTCCCTGGGCAGGG + Intergenic
1129161625 15:73751240-73751262 CCCCCAGCCCACCCTGGCCCTGG + Exonic
1129161648 15:73751292-73751314 CACCCAGCCTCCTCTGCCTCTGG + Exonic
1129189200 15:73927642-73927664 GAGCAGGCCTACCCTGACCCCGG + Exonic
1129236318 15:74225821-74225843 CAGTGAGCCCACCCTGGCCCTGG + Intergenic
1129523659 15:76200943-76200965 AAGCCAGTCTGCCCTGACCCTGG - Intronic
1129759425 15:78120900-78120922 GAGCCAGGCTATCCAGCCCCAGG - Intronic
1130531241 15:84748853-84748875 CCGCCACCCCACCCCGCCCCCGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131528369 15:93171049-93171071 CAGCCAGACTACCCTGCTGCTGG + Intergenic
1131547683 15:93329541-93329563 CATCCAGCGTCCCCTGCACCAGG - Intergenic
1132210220 15:100016652-100016674 CAGCAAGTCTACCCGGCTCCAGG + Intronic
1132508017 16:322190-322212 CAGCCACCCTGCCCTGAGCCAGG - Intronic
1132815197 16:1822494-1822516 CTGCCAGCTTGCCCTGCTCCAGG + Intronic
1132862792 16:2079755-2079777 AAGCCAGCCACCCCGGCCCCTGG - Intronic
1132989326 16:2784974-2784996 CACCCAGCCTCCCCAGCCTCCGG - Intronic
1133144985 16:3778058-3778080 CAGCCAGCCTTACCAGCCCCGGG - Exonic
1133965807 16:10530942-10530964 CAGCCTCCCTACCATGCCACAGG + Exonic
1135277967 16:21129443-21129465 GAGCCACCATACCCAGCCCCAGG - Intronic
1135548196 16:23379598-23379620 CAGCCACCCTTCTCTGTCCCAGG + Intronic
1135892820 16:26372616-26372638 CACCCAACCTCCCCTGCCCCTGG - Intergenic
1136233617 16:28902115-28902137 CAGCCACCCCACCCTAACCCCGG - Intronic
1136278316 16:29192314-29192336 CAGACACCCTTGCCTGCCCCGGG - Intergenic
1137084120 16:36100908-36100930 CACGCAGCCCACCCTGCCCACGG + Intergenic
1137518728 16:49173447-49173469 CAGCCAGACTTCTCTGCCTCTGG + Intergenic
1138205330 16:55120325-55120347 CATCTGTCCTACCCTGCCCCAGG + Intergenic
1141338899 16:83184468-83184490 GAGCCACCGCACCCTGCCCCTGG - Intronic
1141433074 16:83980927-83980949 CCTCCAGCCTCCCCTGCCTCAGG - Intronic
1141617731 16:85219862-85219884 GAGCCTGCCTTCCCTGGCCCAGG - Intergenic
1141627154 16:85267270-85267292 TAGCTAACCTCCCCTGCCCCTGG + Intergenic
1141828397 16:86496471-86496493 CAGCCTGGCTGCCCTGACCCAGG + Intergenic
1141842527 16:86583234-86583256 GAGCCAGCCTGCCCAGACCCTGG + Intergenic
1141860375 16:86712318-86712340 CAGCTCACCTGCCCTGCCCCTGG + Intergenic
1142082694 16:88158348-88158370 CAGACACCCTTGCCTGCCCCGGG - Intergenic
1142145869 16:88492746-88492768 CAGCCAGGCTGCCCTGTCCCTGG + Intronic
1142379465 16:89723195-89723217 CACCCAGCCCACCCTCCACCGGG - Intronic
1142638079 17:1270240-1270262 CAGCCCGGCCACGCTGCCCCGGG - Intergenic
1142901075 17:3011988-3012010 CAGCCATCCATCCTTGCCCCTGG + Intronic
1143095843 17:4477827-4477849 CAGCCAGCGTGCCCAGCCCCAGG - Intronic
1143162614 17:4881374-4881396 TACCCAGCCTCCCCTGTCCCTGG + Intronic
1144953386 17:19005509-19005531 CAGCCAGTCTGCCCGGCACCAGG + Intronic
1145013370 17:19382191-19382213 CAGCCTGCCTGCCCACCCCCTGG + Exonic
1145249427 17:21289276-21289298 CTGCAGGCCTGCCCTGCCCCTGG + Intronic
1145286046 17:21506598-21506620 ATGCCTGCCTACCCGGCCCCCGG - Intergenic
1145391560 17:22459693-22459715 ATGCCTGCCTACCCGGCCCCCGG + Intergenic
1146048350 17:29529445-29529467 CAGCCACCATACCCAGCTCCTGG - Intronic
1146259847 17:31414202-31414224 GAGCCACGCTACCCTGCCTCTGG + Intronic
1146936975 17:36818175-36818197 AAGCCAGCCTACCTTGCACTTGG - Intergenic
1147371821 17:39997721-39997743 CAGCCACCCTGACCTCCCCCAGG + Exonic
1147400733 17:40178626-40178648 CAGCCACCCTTCCTTTCCCCTGG + Intronic
1147594133 17:41705866-41705888 CAGCCCGCCTACCCCTCCCAGGG - Intergenic
1148075120 17:44931322-44931344 CAGCCGCCCTGCCCTGACCCAGG + Intronic
1148131221 17:45263648-45263670 CACTCACCCTGCCCTGCCCCTGG - Exonic
1148821259 17:50360938-50360960 TTTCCAGCATACCCTGCCCCTGG + Exonic
1151815551 17:76469790-76469812 CAGCCAGCCGGCCGTGCGCCGGG + Exonic
1152341725 17:79729372-79729394 CAGCCAGCCTTTCCTAACCCAGG - Intergenic
1152391610 17:80007125-80007147 CAGCGAGCCTCCCCTGGACCGGG + Intronic
1152423180 17:80204966-80204988 CAGCCAGCCTACCCTGCCCCGGG - Intronic
1152573578 17:81130773-81130795 CCTCCAGCCTCCCCTGCCCAAGG - Intronic
1152613576 17:81327975-81327997 CAGCCCCCCTACCCCGGCCCAGG - Intronic
1152826022 17:82465390-82465412 CCGGCATCCTACCCTGCCCAGGG + Intronic
1155182135 18:23357084-23357106 CAGGCAGCCAACCCTGCACAAGG + Intronic
1156716839 18:40022425-40022447 CATGCAGCCTGCCCTGCCTCAGG - Intergenic
1157557042 18:48619670-48619692 CAGCCAGCAGCCCCTGCACCTGG - Exonic
1158429177 18:57368629-57368651 CAGGCAGCCTCGCCTGCCCTTGG + Exonic
1158446167 18:57523593-57523615 GAGCCAGACAGCCCTGCCCCAGG + Intergenic
1159492330 18:69153328-69153350 GAACCACCCTACCCAGCCCCTGG - Intergenic
1159863440 18:73675983-73676005 CAGAAAGCCTTCCCTACCCCTGG + Intergenic
1160003313 18:75048534-75048556 AACCCAGCCTAGCCTTCCCCTGG + Intronic
1160404822 18:78638145-78638167 CAGCCGCCCTCCCCAGCCCCAGG - Intergenic
1160805223 19:989632-989654 CCCCCTGCCTGCCCTGCCCCAGG - Intronic
1160892979 19:1388833-1388855 CACCCAGCCTGCCCTGCCAAAGG + Exonic
1160966954 19:1750840-1750862 CAGCCAGCCTACCCGGTGGCCGG + Intergenic
1161262614 19:3346140-3346162 CAGCCACCCTCCCCAGCCCTGGG + Intergenic
1161318873 19:3631958-3631980 CACCCACCCTGCCCTTCCCCAGG - Exonic
1161709222 19:5838516-5838538 CAGCCTGCAGACCCTCCCCCAGG + Intronic
1162001380 19:7746857-7746879 GACCCAGCCTCCCCTTCCCCAGG + Intronic
1162141307 19:8586944-8586966 CTGCCTGCCTCCCCTGTCCCCGG + Intronic
1162237630 19:9321492-9321514 CAGCCAGCCGTCCCTGCCCCGGG + Intergenic
1162345319 19:10115129-10115151 CTGCCACCCTCCCCTACCCCAGG - Exonic
1162398346 19:10430756-10430778 CAGGCCGCCTGCCCAGCCCCGGG - Intronic
1163714871 19:18867810-18867832 CCTCCAGCTTCCCCTGCCCCGGG + Exonic
1163819206 19:19486610-19486632 CAGCCTGCGTCCCCTGCACCAGG - Intronic
1163862614 19:19750123-19750145 CATCCACCCTACACAGCCCCAGG + Intergenic
1165424742 19:35739670-35739692 CAGTCCACCTTCCCTGCCCCGGG + Intronic
1167295449 19:48646573-48646595 CAGCCCCCCTTCCCCGCCCCAGG + Intergenic
1167338076 19:48898762-48898784 CAGCCAGGCAACCCTGCTCCGGG + Intergenic
1167368633 19:49067660-49067682 CAGACAGCCTGCCTGGCCCCTGG + Exonic
924959443 2:20533-20555 CAGCCAGCCTTCTCTCCCTCTGG - Intergenic
925376837 2:3392266-3392288 CAGCAAGCCTGCCATGTCCCAGG + Intronic
925639002 2:5969461-5969483 CTGGCAGCCTGCCCTGGCCCCGG - Intergenic
925868261 2:8247548-8247570 CCCCCAGCCCACCCTGCCCTGGG + Intergenic
925875697 2:8309446-8309468 CAGACATCCTGCCCTGGCCCTGG - Intergenic
925976836 2:9147804-9147826 CTGCTGGCCTACCCTGTCCCTGG + Intergenic
926320153 2:11743816-11743838 CTTCCCGCCTACCTTGCCCCAGG + Intronic
928271947 2:29864268-29864290 CAGCCAGTTTATCCTGCCTCGGG + Intronic
930700806 2:54456635-54456657 CTGCCCGCCTGCCCTGCGCCCGG + Intronic
931197680 2:60068224-60068246 CAGCATGCCTTCCCTACCCCAGG - Intergenic
931869651 2:66444690-66444712 CAGCCCGCCAGCCCTGGCCCGGG + Intronic
932088441 2:68783154-68783176 GAGCTAGCCTGCCCTGACCCTGG + Intronic
932141734 2:69284724-69284746 CAGGCAACCTTCCCTGCCTCAGG + Intergenic
932396527 2:71452711-71452733 CGGCCAGCCCATCCTGCCCTGGG + Intergenic
932873676 2:75428981-75429003 CAGCCAGCCTCCTCTTCCACAGG - Intergenic
932983484 2:76698385-76698407 CAGCCAGCGGAGCCGGCCCCGGG - Intergenic
933354496 2:81195945-81195967 CAGCCTGTCTACCCTCCGCCAGG - Intergenic
933555230 2:83823397-83823419 GAGCCAGCCAACCCTGCCCCTGG - Intergenic
935706143 2:105859410-105859432 CATCCAGCGTCACCTGCCCCAGG + Intronic
936152201 2:110027977-110027999 CATTGAGCCTCCCCTGCCCCAGG - Intergenic
936192477 2:110343436-110343458 CATTGAGCCTCCCCTGCCCCAGG + Intergenic
936462296 2:112722476-112722498 CACCCAGCCTACCCCTCCTCAGG + Exonic
937379401 2:121362921-121362943 CAGCAGGCCTGCCCTGCCCCTGG - Intronic
937477605 2:122229169-122229191 CAGGCACCCAAACCTGCCCCAGG - Intergenic
937781914 2:125848465-125848487 CAGCAAGTCTACCTGGCCCCAGG + Intergenic
938371098 2:130768713-130768735 CAGCCAGCCTCTTCTGCTCCCGG - Intergenic
941908584 2:170740785-170740807 CACTCAGCCTGCCCTGCCCAGGG + Intergenic
944528805 2:200648377-200648399 CAGCAAGTCTACCCAGCTCCCGG + Intronic
944582103 2:201140105-201140127 CACCCAGCCCACCCGGCGCCTGG - Intronic
944872792 2:203931234-203931256 CATACAGCCAAACCTGCCCCTGG - Intergenic
944904219 2:204246253-204246275 CAGCCCGCCTCCCCAGCCTCTGG + Intergenic
945186374 2:207144009-207144031 GAGCCAGCCTGCCCCTCCCCTGG - Intronic
945482516 2:210360480-210360502 CAGCAAGTCTACCCAGCTCCAGG + Intergenic
946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG + Intronic
946371368 2:219283498-219283520 CAGCTCCCCTACCCAGCCCCTGG + Intronic
947727856 2:232410877-232410899 CAGCCTGCTGACACTGCCCCAGG - Intergenic
947948294 2:234125294-234125316 CCCCCACCCCACCCTGCCCCTGG - Intergenic
948885243 2:240878959-240878981 CAGGCAGCCTCCCTGGCCCCAGG + Exonic
1168811996 20:710361-710383 CAGCCAGCACCCCCTCCCCCCGG + Intergenic
1170135928 20:13073773-13073795 CAGCCAGCCTGCACTGGTCCTGG + Intronic
1171366533 20:24628682-24628704 CAGCCAGACTCCCCTCCCCAAGG - Intronic
1171521185 20:25775015-25775037 CAGCCAGCCAGCCCTGGCCCGGG + Exonic
1172390078 20:34560035-34560057 CAACCCACCTACTCTGCCCCTGG + Exonic
1173224510 20:41154394-41154416 GAGCCAGCCAATCCTGCCCTAGG - Intronic
1173229221 20:41181056-41181078 CAGCCAGCCTGCCCAGACCACGG - Exonic
1173768498 20:45636278-45636300 TGGACAGCCTACCCTGCCCCAGG + Intergenic
1173860859 20:46282748-46282770 CACCCACCCTTCCCTCCCCCGGG - Intronic
1173998335 20:47357011-47357033 CAGCCAGCCTGACCTGCTCCAGG + Intergenic
1174483862 20:50849325-50849347 CAGCCAAGCTTCCCTCCCCCAGG - Intronic
1175423671 20:58851407-58851429 CATCCAGCCTCCCCTCCCCCAGG + Intronic
1175866351 20:62179252-62179274 CCGCCAGCCCATCCGGCCCCTGG - Exonic
1175873282 20:62218288-62218310 CAGCCAGACTGACCTGGCCCAGG - Intronic
1175939405 20:62531163-62531185 CAGCCAGGATGCCCGGCCCCAGG - Intergenic
1176042593 20:63073264-63073286 AGCCCAGCCTACCCTCCCCCGGG + Intergenic
1176045526 20:63090842-63090864 GGGCCAGCCTTCCCTTCCCCAGG + Intergenic
1176215197 20:63944566-63944588 CATCCAGCCCACCATGCGCCTGG - Exonic
1176267836 20:64220020-64220042 CAGCCAGCTTGCCCTGCCTGAGG + Intronic
1176378824 21:6101627-6101649 CAGCCATCCTGCCCTGTCCCTGG + Intergenic
1176422586 21:6527961-6527983 CTGCCAGCCTCACCTGGCCCTGG - Intergenic
1178959111 21:37047715-37047737 CAGCAAGTCTACCCGGCTCCAGG - Intergenic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1179501728 21:41813403-41813425 GTGCCAGCCTCCTCTGCCCCTGG - Intronic
1179502585 21:41819526-41819548 CAGCCAGGCCACCCTGCTGCAGG - Intronic
1179580484 21:42340318-42340340 CAGTGAGGCTGCCCTGCCCCTGG - Intergenic
1179624444 21:42640695-42640717 CAGCCAGCCAACCCTGATACTGG + Intergenic
1179698079 21:43136277-43136299 CTGCCAGCCTCACCTGGCCCTGG - Intergenic
1179744650 21:43436610-43436632 CAGCCATCCTGCCCTGTCCCTGG - Intergenic
1180147713 21:45930518-45930540 TGGCAAGCCCACCCTGCCCCTGG + Intronic
1180796124 22:18606646-18606668 GCGCCAGCCTGCCCTTCCCCTGG + Exonic
1180841295 22:18960105-18960127 CAGCAGGCCTGCCCCGCCCCAGG + Intergenic
1181050742 22:20237228-20237250 CAGCAAGGGTCCCCTGCCCCTGG + Intergenic
1181060203 22:20278689-20278711 CAGCAGGCCTGCCCCGCCCCAGG - Intronic
1181225598 22:21388625-21388647 GCGCCAGCCTGCCCTTCCCCTGG - Exonic
1181253036 22:21546188-21546210 GCGCCAGCCTGCCCTTCCCCTGG + Exonic
1181580070 22:23823239-23823261 CAGCAAGCCCTCCCTGCCCTGGG - Intronic
1182557800 22:31138436-31138458 CAGACAGCCCTCCATGCCCCAGG - Intronic
1182703672 22:32261090-32261112 AAGGCAGCCTCCCCTGACCCAGG + Intergenic
1183935919 22:41262195-41262217 CACCCAGCTTGCCCTGTCCCTGG + Intronic
1184119543 22:42441104-42441126 CACCCAGCCTCCCCTTCTCCAGG + Intergenic
1184254494 22:43279288-43279310 GAGCAAGCCCACCCTGCCTCTGG - Intronic
1184501695 22:44878622-44878644 CAGCCAGCCCACCCTGAGCTGGG + Intergenic
1185069954 22:48650794-48650816 CACCGAGCCTCCCCTCCCCCAGG + Intronic
1185079201 22:48700412-48700434 CTGCCGGCCTGCTCTGCCCCGGG - Intronic
1185292229 22:50032871-50032893 CAGGCCGCCTCCCCTGCGCCAGG + Intronic
1185342361 22:50297301-50297323 AAGCCAGCCTCCCCTGACCTTGG - Intronic
950547662 3:13648206-13648228 CAGCCAGGCTGCCCAGCCCTTGG - Intergenic
951016900 3:17742115-17742137 CTGCCTGCTTTCCCTGCCCCAGG - Intronic
951851970 3:27151358-27151380 CAGCAAGTCTACCCAGCTCCAGG - Intronic
951910829 3:27748748-27748770 CAGCCAGTCTTCCCTGGCTCTGG - Intergenic
952865780 3:37854297-37854319 CAGCCAGGCTCCCCAGGCCCTGG - Intergenic
953422149 3:42762456-42762478 CCTCCAGCCTACCCTGCACCTGG - Intronic
953902507 3:46851336-46851358 CTGCCATCATACCCTGCTCCTGG - Intergenic
954314253 3:49792664-49792686 CAGCCTTCCAACCCTTCCCCGGG + Intronic
954611504 3:51946880-51946902 CCCCTAGCCCACCCTGCCCCCGG - Intronic
954693737 3:52409798-52409820 CATCCGGCCTCCCCAGCCCCTGG + Intronic
954697346 3:52434867-52434889 CAGCCTGACTTCCCTTCCCCAGG - Exonic
955225055 3:57053400-57053422 CCTCCAGCCTGCCCTGCCTCTGG + Intronic
955591197 3:60537665-60537687 CAGCCTCCCTTTCCTGCCCCCGG - Intronic
956528231 3:70187999-70188021 CAGCCACCCCACCTTTCCCCTGG + Intergenic
958969868 3:100600257-100600279 CAGCAAGTCTACCCAGCTCCAGG + Intergenic
959041175 3:101424486-101424508 AAGCCAGCCAGCCTTGCCCCTGG + Intronic
961035312 3:123637893-123637915 CTGGCAGCCCACCCTGCTCCTGG - Intronic
961119361 3:124360269-124360291 CAGCCAACCCAGCCTTCCCCTGG - Intronic
961305856 3:125958901-125958923 CAGCCAGCCCGGCCAGCCCCAGG + Intergenic
961380890 3:126496002-126496024 CAGCCACCCCAGCCTCCCCCAGG + Intronic
962259083 3:133891822-133891844 CCACCTGCCTGCCCTGCCCCTGG - Intronic
962335749 3:134528325-134528347 CAGCCATCTTGCCCTCCCCCTGG + Intronic
962801603 3:138895512-138895534 GAGCCACCATACCCAGCCCCTGG + Intergenic
964160713 3:153641437-153641459 CAGCGAGACTACCCAGCTCCAGG - Intergenic
964601179 3:158503174-158503196 CAGCAAGTCTACCCAGCTCCGGG + Intronic
964627910 3:158776750-158776772 CAGCCTTCCCACCCTTCCCCAGG - Intronic
964663118 3:159142700-159142722 CAGCCACCGTACCCAGCCCGGGG + Intronic
964747187 3:160023350-160023372 CCTCCAGCCCACCTTGCCCCTGG - Intronic
964808823 3:160640492-160640514 CAGCCTTCCTACCCAGTCCCAGG - Intergenic
965216815 3:165874513-165874535 CCGCAAGCCTACCCAGCTCCTGG + Intergenic
965511528 3:169573087-169573109 CAGCCTGGCTAGGCTGCCCCTGG - Intronic
967204071 3:187103503-187103525 CCTCCAGCCTTCCATGCCCCAGG + Intergenic
968135392 3:196216620-196216642 CAGGCAAGCCACCCTGCCCCCGG + Exonic
969305895 4:6326164-6326186 CAGCCAGCCAACCCCTCCCAGGG - Intronic
969333817 4:6495100-6495122 CATCCAGCCTGCCCTGCCAAGGG + Intronic
969439527 4:7208949-7208971 CAGACAGCCTGGCCTGCCTCAGG + Intronic
969525782 4:7703390-7703412 CAGCCTGCCCTCCCTGCCCCGGG - Intronic
970191374 4:13522600-13522622 CAGCCAGGCTACTGTGCTCCGGG + Intergenic
970476864 4:16432579-16432601 CAGCCATCCTAACTTGCTCCTGG - Intergenic
970942981 4:21657043-21657065 CAGGAAGCCTTCCCTGACCCAGG + Intronic
971101560 4:23471984-23472006 CAGCCATCCTACCTTGCTCAAGG - Intergenic
972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG + Intergenic
972817015 4:42656471-42656493 CAGCCCGCCGCCCCTGCCTCCGG - Intronic
973763740 4:54144740-54144762 CAGCCGGCCTAGCCTAGCCCTGG + Intronic
975515552 4:75243832-75243854 CAGCCAGCCTATCGTCCCTCTGG + Intergenic
975517320 4:75260691-75260713 CAGCAAGTCTACCCGGCTCCAGG - Intergenic
976695578 4:87916767-87916789 CCCCCAGCCTGACCTGCCCCCGG - Intergenic
977188227 4:93967354-93967376 TAGCCATCTTGCCCTGCCCCAGG + Intergenic
979498368 4:121410958-121410980 CAGCAAGTCTACCCAGCTCCAGG + Intergenic
981606738 4:146547542-146547564 CAGGGAGCCTCCCCTGCCCAGGG - Intergenic
981937815 4:150253698-150253720 CAGCCAGCCAAGCAGGCCCCTGG + Intronic
984916880 4:184733307-184733329 CAGGCAGCCTTCCCAGGCCCGGG + Intronic
985008544 4:185559522-185559544 CAGCGAGTCTACCCGGCTCCTGG + Intergenic
985468957 5:25243-25265 CAGCCAGCCTTCTCTCCCTCTGG - Intergenic
985549310 5:524990-525012 CAGCCAGCATCCCCCACCCCAGG + Intergenic
985621921 5:960327-960349 CAGGCAGCCGCCCCAGCCCCTGG + Intergenic
986029867 5:3883847-3883869 CAGGCTGCCTGCTCTGCCCCTGG - Intergenic
988723192 5:33899534-33899556 AGGCCTCCCTACCCTGCCCCTGG - Intergenic
988902299 5:35746025-35746047 CAGTAAGTCTACCCTGCTCCGGG - Intronic
989676728 5:43981747-43981769 CCCCCACCTTACCCTGCCCCAGG + Intergenic
990400283 5:55430312-55430334 GTGCCAGCATACACTGCCCCAGG + Intronic
990577314 5:57135842-57135864 GAGCCACCGTACCCGGCCCCAGG - Intergenic
993678609 5:90847735-90847757 CAGCCAGCCCTGCCAGCCCCGGG - Intronic
995039017 5:107567555-107567577 CATCCACCCACCCCTGCCCCAGG + Intronic
995727445 5:115196307-115196329 CAGCAAGTCTACCCGGCTCCAGG - Intergenic
996121741 5:119680881-119680903 CAGCCTTCCCAGCCTGCCCCTGG + Intergenic
996325477 5:122267871-122267893 CAGCAAGCCTACCCAGCTCTGGG - Intergenic
997128352 5:131251727-131251749 AAGCCACCATACCCAGCCCCTGG - Intronic
997197322 5:131988773-131988795 CTGCCACCCCACCCTGCCACTGG - Intronic
997438526 5:133892375-133892397 CATCCACCCACCCCTGCCCCTGG + Intergenic
998940932 5:147280988-147281010 CAGCTAGCCTACCCAGCTCCAGG - Intronic
999083137 5:148863278-148863300 CAGCAAGCCTCTCCTGACCCAGG - Intergenic
1000111157 5:158109288-158109310 CAGCCAGCCCCTCCAGCCCCAGG - Intergenic
1000264220 5:159619457-159619479 CAGCCTACCTGCCCTGCCCCCGG + Intergenic
1000302912 5:159972177-159972199 CAGCCAGCGGACCCTGCCCTCGG + Exonic
1000337669 5:160253676-160253698 CCACCAGCCTACCCGGCCCTCGG - Exonic
1000757841 5:165183769-165183791 CAGCAAGTCTACCTGGCCCCAGG + Intergenic
1002046007 5:176542246-176542268 AGGCCAGCCTGCCCTGCCTCTGG + Intergenic
1002298976 5:178247037-178247059 CTGCCTGCATGCCCTGCCCCAGG - Intronic
1002459350 5:179365289-179365311 CAGCCAGCCCACCCTGCTCCAGG + Intergenic
1002806962 6:586607-586629 CAGCCAGCCTTCCCTTACCAGGG + Intronic
1002845284 6:939852-939874 CAGCCTTCCTCCCCAGCCCCAGG + Intergenic
1004321406 6:14634240-14634262 CAGCCTGTCTGCCCCGCCCCTGG - Intergenic
1004689104 6:17976448-17976470 CAGCCGGCCTTGCCGGCCCCGGG - Intronic
1006361183 6:33588263-33588285 CAGCCAGCCTGCCCTGTCCCAGG + Intergenic
1006503033 6:34470020-34470042 CCTCCAGGCCACCCTGCCCCTGG - Intronic
1006630711 6:35427850-35427872 CAGCCTCCCTTCCATGCCCCAGG + Exonic
1007113759 6:39328903-39328925 CTGCCAGCCTGCCCTGCCTGTGG + Intergenic
1007569892 6:42882043-42882065 CAGCCACCCCACCCGGCCACCGG + Intronic
1009493750 6:64325267-64325289 CAGCAAGCCTACCCGGCTCCAGG - Intronic
1011377667 6:86706965-86706987 CAGCCATTGTCCCCTGCCCCCGG - Intergenic
1012683542 6:102213139-102213161 CTTCCATCCTACCCAGCCCCTGG + Intergenic
1012793812 6:103734764-103734786 CAGCGAGTCTACCCAGCTCCAGG - Intergenic
1014974527 6:127862702-127862724 CAGCCACCCCACCCAGCCCCAGG + Intronic
1015604034 6:134937554-134937576 CAGCCAGTCTGCCCTGAACCTGG - Intronic
1015877904 6:137842660-137842682 CAGCAAGTCTACCCAGCTCCAGG + Intergenic
1016908447 6:149173872-149173894 CCTCCTGCCTCCCCTGCCCCAGG - Intergenic
1017328493 6:153168607-153168629 CAGCCAACCTGCCCAGCACCAGG - Intergenic
1017530580 6:155287916-155287938 CTGCCTGCCTACCTAGCCCCAGG - Intronic
1018003178 6:159597493-159597515 CAGGCTGCCCTCCCTGCCCCAGG + Intergenic
1018907272 6:168082875-168082897 CACCCTGCCCACCTTGCCCCAGG - Intergenic
1019569889 7:1706050-1706072 CTGCCAGCCTAGCCTCCCTCTGG + Intronic
1020769676 7:12373439-12373461 GAGCCAGCCTGCCCTGCTCAAGG - Intronic
1020860857 7:13489944-13489966 CAGCAAGTCTACCCAGCCCTGGG - Intergenic
1021274731 7:18636285-18636307 CTGCCAGCCCCCCCTGCCCTGGG + Intronic
1022385367 7:29893777-29893799 CAGTCAGCAAACCCTGCCTCAGG - Intronic
1022438696 7:30414099-30414121 CAGCCATGCTACCCTGCTGCAGG - Intergenic
1022981779 7:35611147-35611169 CAGCCACCCTACCCTCCTGCTGG - Intergenic
1023867075 7:44243395-44243417 CAGCCAACACACCCTGCCCCTGG + Intronic
1024475039 7:49800557-49800579 GAGCCAGAACACCCTGCCCCAGG - Intronic
1024688733 7:51776382-51776404 GACCCAGCCTACACTGTCCCAGG - Intergenic
1024765785 7:52657567-52657589 CAGCCAGCCATCCCTGCCCATGG + Intergenic
1024794331 7:53004032-53004054 CAGCCAGCCCTGCCGGCCCCGGG + Intergenic
1026314951 7:69220165-69220187 GAGCCACCATACCCAGCCCCAGG + Intergenic
1027559127 7:79705114-79705136 CTGTCTGCCTACCATGCCCCAGG + Intergenic
1028442497 7:90880195-90880217 CAGCCACCCTTCCCTTGCCCAGG - Intronic
1029562252 7:101310301-101310323 GAGCCAGCCTACACCGCTCCTGG + Intergenic
1030464802 7:109887424-109887446 CAGCCATGCTACCCTGACACAGG + Intergenic
1031138933 7:117919613-117919635 CAGCAAGTCTACCATGCTCCAGG - Intergenic
1033099899 7:138460852-138460874 CCGCCACCCGTCCCTGCCCCCGG + Exonic
1033229312 7:139584137-139584159 CTGCCTCCCTCCCCTGCCCCAGG - Intronic
1034204264 7:149302165-149302187 CGGCCAGTCTACCCTTCTCCCGG - Intergenic
1034459744 7:151191823-151191845 CATCCAGCCGACCCAGCACCTGG - Exonic
1034684631 7:152959130-152959152 CAGTGACCCTACCCTGCTCCTGG - Intergenic
1035582757 8:750142-750164 CAGCCGGCCTAACCGGCCCTAGG - Intergenic
1037395332 8:18435614-18435636 CAGCCTGCTTACCTTACCCCTGG + Intergenic
1037713531 8:21376131-21376153 CAGCAAGTCTACCCAGCTCCAGG + Intergenic
1037754349 8:21701596-21701618 CAGGCAGCCTCCCCAGCCCCCGG + Intronic
1037769407 8:21789771-21789793 CAGCCGGTCTCCCCTCCCCCCGG + Intronic
1039415855 8:37393660-37393682 CACCCCGCCCACCCCGCCCCTGG + Intergenic
1039571904 8:38593409-38593431 CAGCAAGTCTACCCGGCTCCAGG - Intergenic
1039641538 8:39228032-39228054 CAGCGAGTCTACCCAGCTCCAGG - Intronic
1039720525 8:40159486-40159508 CAGCCAGCCAGCCCTGGCACAGG - Intergenic
1040324943 8:46336961-46336983 CAGCCAGCCCAACCTAGCCCTGG - Intergenic
1040763079 8:50874259-50874281 CTGCCAGCCTTCCCTTGCCCTGG - Intergenic
1040915940 8:52565943-52565965 ACGCCAGCCGCCCCTGCCCCAGG + Intergenic
1041868043 8:62599200-62599222 CTGCCAGCCTGCCCTGCAGCAGG + Intronic
1042146249 8:65733245-65733267 CACCCAGATTTCCCTGCCCCTGG + Intronic
1042304079 8:67313571-67313593 CAGCGAGTCTACCCAGCTCCAGG + Intronic
1042334659 8:67617592-67617614 CAGCCAGCATACCAAGCCACTGG + Intronic
1043337882 8:79199610-79199632 CAGCCACCCTACGCTGCCCAGGG + Intergenic
1044401789 8:91781388-91781410 CAGCCTGCCTTCCCTCCCCAGGG + Intergenic
1045506066 8:102779589-102779611 CAGCCAGCCCACCCCGAGCCAGG - Intergenic
1047212145 8:122848782-122848804 CCGGCAGCGTGCCCTGCCCCTGG + Intronic
1048875392 8:138833236-138833258 CAGCCTGCCCATCCTGCCCCAGG + Intronic
1048926522 8:139276947-139276969 CATCTACCCTCCCCTGCCCCAGG - Intergenic
1049213408 8:141396957-141396979 CAGCCCGGCTACCCTCCCACAGG - Intronic
1049319408 8:141988024-141988046 CACCCAGCCTGCCCCGCACCTGG + Intergenic
1049542917 8:143216501-143216523 CAGACAGGCTACCCTGTGCCAGG + Intergenic
1049620360 8:143595641-143595663 TACCCAACCCACCCTGCCCCAGG + Intronic
1049786440 8:144453125-144453147 CAGCCAGACCACCCTGCACAGGG + Intronic
1049998686 9:1053255-1053277 CACCCTGCCTGCCCTGCCACAGG + Intronic
1052764836 9:32630443-32630465 CACCCAGCCTACCTTGGCCCTGG + Exonic
1052915605 9:33922645-33922667 CAGCCACCCTACTCTGGGCCAGG - Intronic
1053353650 9:37429532-37429554 CAGCCAGCCCACACTGCCCCAGG - Intronic
1054762335 9:69014165-69014187 CAGCCAGCGCAGCCAGCCCCAGG - Intergenic
1055346913 9:75349655-75349677 CAGCAAGACTACCCAGCTCCAGG + Intergenic
1055905745 9:81292068-81292090 CAGCGAGTCTACCCAGCTCCAGG + Intergenic
1056822191 9:89851085-89851107 CAGTCACTCTGCCCTGCCCCTGG - Intergenic
1057047962 9:91900379-91900401 CAGGCAGCCGACCCTGGCGCAGG + Intronic
1057841150 9:98486459-98486481 CAGCCAGCCTTCCTTGCCTGTGG + Intronic
1058156659 9:101524023-101524045 CAGCGAGTCTACCCAGCTCCGGG + Intronic
1058308338 9:103470963-103470985 CAGCGAGGCTACCCAGCTCCTGG + Intergenic
1058885879 9:109320797-109320819 CAGCCCGCCTCCCGCGCCCCCGG - Exonic
1059397819 9:114049558-114049580 GAGCCAGCCCACCCTGCAGCTGG + Exonic
1061318395 9:129812398-129812420 CAGCCAGCCTGCTATGTCCCTGG - Intergenic
1061351516 9:130069022-130069044 GAGCCAGCGTGCCCTGCCCTAGG + Intronic
1061483003 9:130906385-130906407 CAGCCAGCACACACTGACCCCGG - Intronic
1061836598 9:133333706-133333728 CTGCCCGCCTACCTGGCCCCGGG + Exonic
1062178154 9:135175784-135175806 CAGCCAGCTGACCCTGGCTCTGG - Intergenic
1062188058 9:135229149-135229171 CAGCCCGCCTCCTCTGCCACAGG + Intergenic
1062256685 9:135626462-135626484 CATCCAGCCTACCTGGCTCCTGG + Intronic
1062502872 9:136858755-136858777 CAGCCAGGCGGCCCGGCCCCCGG - Exonic
1062552810 9:137097894-137097916 CACCAAGCCTCCCCTGCCACCGG + Exonic
1062617246 9:137403435-137403457 CAGCCAGCACACCCTGGCCCAGG + Intronic
1186464500 X:9774466-9774488 CAGCCAGTCCAGCCTGCCCCTGG + Intronic
1187098978 X:16172629-16172651 TTCCCAGCCTACCCTGTCCCAGG - Intergenic
1188114173 X:26223373-26223395 CAGCCTGCCAACCCTGCCTTAGG - Intergenic
1188860674 X:35251758-35251780 CAGCACGCCTGCCCTGCCACGGG + Intergenic
1189035293 X:37489164-37489186 GAGCCAACCTGCCCAGCCCCTGG + Intronic
1189592445 X:42529467-42529489 CAGCAAGCCTACCAGGCCCATGG + Intergenic
1190271014 X:48863636-48863658 GAGCCACCGCACCCTGCCCCTGG - Intergenic
1191717691 X:64204840-64204862 CAGCCAGCCTGCCCGACCGCGGG + Intronic
1192870582 X:75179779-75179801 CAGCCAGCCCTGCCAGCCCCGGG - Intergenic
1193253329 X:79319096-79319118 CAGCAAGTCTACCCAGCTCCGGG + Intergenic
1195759185 X:108227544-108227566 AAGCCCCCCCACCCTGCCCCAGG - Intronic
1197066165 X:122236886-122236908 CAGCGAGTCTACCCAGCTCCAGG + Intergenic
1197671571 X:129283985-129284007 CAGCCAGTCTACCCAGCTCTTGG + Intergenic
1198085319 X:133277013-133277035 CAGCCAGACCACCATGGCCCAGG - Intergenic
1198113388 X:133522447-133522469 GCACCATCCTACCCTGCCCCTGG + Intergenic
1199134182 X:144231471-144231493 CAGCCAGCCCCACCGGCCCCAGG - Intergenic
1200115392 X:153767695-153767717 CAGGCCGCCTTCCTTGCCCCGGG + Exonic
1200244597 X:154516253-154516275 CAGCCCGCCGGCCCCGCCCCCGG + Intergenic
1200248465 X:154539387-154539409 CAGCCAATCTGCCCTGCTCCAGG - Intronic