ID: 1152424273

View in Genome Browser
Species Human (GRCh38)
Location 17:80210496-80210518
Sequence CGCCCCCGACGGCGTCCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152424273_1152424279 -5 Left 1152424273 17:80210496-80210518 CCTCCAGGACGCCGTCGGGGGCG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1152424279 17:80210514-80210536 GGGCGCACACCCAGGGGTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 128
1152424273_1152424285 22 Left 1152424273 17:80210496-80210518 CCTCCAGGACGCCGTCGGGGGCG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1152424285 17:80210541-80210563 CCCACTGCCACTTGGCCAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 220
1152424273_1152424280 -4 Left 1152424273 17:80210496-80210518 CCTCCAGGACGCCGTCGGGGGCG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1152424280 17:80210515-80210537 GGCGCACACCCAGGGGTCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1152424273_1152424283 14 Left 1152424273 17:80210496-80210518 CCTCCAGGACGCCGTCGGGGGCG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1152424283 17:80210533-80210555 GTGGGTCTCCCACTGCCACTTGG 0: 1
1: 2
2: 0
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152424273 Original CRISPR CGCCCCCGACGGCGTCCTGG AGG (reversed) Exonic
900156884 1:1206731-1206753 CGCCCCTGCCGGCGACCTGCGGG - Intergenic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
900589713 1:3454287-3454309 CTTCCCCGAAGGCTTCCTGGAGG + Intergenic
901002181 1:6154357-6154379 TGCCCCCGACGTGGGCCTGGAGG - Intronic
905206144 1:36343885-36343907 GGCCGCCGCCGACGTCCTGGAGG - Exonic
913536673 1:119779551-119779573 GGCCCCCGAAGGCCTCCTGGGGG - Intergenic
915593612 1:156884164-156884186 AGCCCCCCACGGGGTCCTTGGGG - Intergenic
922744704 1:228037475-228037497 CACCCCCGAGGGGCTCCTGGGGG - Intronic
922925479 1:229343329-229343351 CGCCCCCGGCCGCAGCCTGGGGG - Intergenic
1063384871 10:5609868-5609890 AGCCCCCCACTGAGTCCTGGAGG - Intergenic
1063461983 10:6220814-6220836 CGCCCCCGATGCGGCCCTGGAGG - Exonic
1065342702 10:24722776-24722798 CGCCCCGGCCGGCGTCCCCGAGG + Intronic
1072656731 10:97334879-97334901 CGCCCCGGACCCCCTCCTGGAGG - Intergenic
1076795130 10:132794644-132794666 CGACCCACACTGCGTCCTGGCGG - Intergenic
1076808121 10:132869616-132869638 CTCCTCGGACGGCGTCCAGGAGG - Intronic
1077008412 11:369617-369639 CGCGGCCGAGGGCGGCCTGGGGG + Intergenic
1077798868 11:5518471-5518493 AGCCCCAGAGGGCCTCCTGGTGG + Intronic
1081617824 11:44601045-44601067 AGGCCCTGACGGCTTCCTGGAGG - Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1081873178 11:46392268-46392290 CGACCCCGACGGATCCCTGGCGG - Intergenic
1091594157 12:1864634-1864656 CGCCGTCGGCGGCGCCCTGGTGG - Intronic
1091857782 12:3753161-3753183 CGTCCCGGAGGGCGTCCAGGGGG - Intronic
1096460870 12:51820976-51820998 CGGCCGCGAAGGCGGCCTGGAGG + Intergenic
1108221048 13:48233447-48233469 CCCCCCCGACGCCGTCGCGGTGG + Exonic
1108643647 13:52406187-52406209 CGCCCCCGACGGCGTGGGGAGGG + Intronic
1112216319 13:97434314-97434336 CGCCGCCGCCGGCGCCCAGGGGG + Exonic
1113185177 13:107679612-107679634 CGCCCCCCACGGGGTCAGGGAGG + Intronic
1122975447 14:105168929-105168951 CGCCCCCCAGGGCGCCCGGGCGG + Intergenic
1124426889 15:29570413-29570435 CGCCCGCGGTGGCGTCCCGGCGG + Intronic
1124515919 15:30367432-30367454 TGCCCCCGTCGGGGTCGTGGTGG + Exonic
1124623786 15:31296799-31296821 TGCCCCTCCCGGCGTCCTGGTGG - Intergenic
1124727000 15:32163299-32163321 TGCCCCCGTCGGGGTCGTGGTGG - Exonic
1128877604 15:71215064-71215086 CGCCGCCGCCGTCGTCCTCGGGG - Exonic
1129336418 15:74854601-74854623 CGCCCCGCAGGGCGGCCTGGCGG - Exonic
1129814624 15:78540708-78540730 AGCCCCCGACGGCGGCCGGCGGG - Intronic
1131215047 15:90529753-90529775 CGCCGCCGGCGGCCACCTGGAGG - Intergenic
1132523392 16:401761-401783 CGCCCCCGCCCGCGGCCTGCTGG - Intronic
1132591796 16:729321-729343 GGTCCCCGCCGACGTCCTGGAGG + Exonic
1142246925 16:88974455-88974477 CTCCTCTGACAGCGTCCTGGGGG - Intronic
1152424273 17:80210496-80210518 CGCCCCCGACGGCGTCCTGGAGG - Exonic
1153226873 18:2906576-2906598 GGTCCCCGGCGGCGTCCGGGTGG + Intronic
1154174505 18:12076626-12076648 CGGCCCCGCCGGCGTCCGGGCGG + Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160500894 18:79400666-79400688 CGCTCGCGGCGGGGTCCTGGGGG + Intronic
1160753647 19:747116-747138 CGCGCCCACCGGGGTCCTGGCGG + Exonic
1161080971 19:2309952-2309974 CGCCCCCCACAGCATCCTGTGGG - Intronic
1161984749 19:7647155-7647177 GGTCCTCCACGGCGTCCTGGCGG - Exonic
1163843970 19:19628305-19628327 CGCCCCCGACGCGGCCGTGGAGG - Intronic
1165830829 19:38729454-38729476 CACCCCCGACGGCCTCCAGGAGG + Exonic
1167125332 19:47545121-47545143 CGGCCCCGGCGGTGGCCTGGAGG - Exonic
1167416291 19:49374836-49374858 CGCCCTCCAGGGCATCCTGGTGG - Exonic
925725247 2:6865507-6865529 CGCCCCCGACCCCCGCCTGGCGG - Exonic
935692762 2:105745304-105745326 CGCCCCCGACCGCGGACTGCCGG + Intronic
936985735 2:118310213-118310235 CGCCCCCGCCGGCGTAATCGCGG - Intergenic
941812626 2:169768875-169768897 CCCACCCGACGGTTTCCTGGAGG + Intronic
942046146 2:172100572-172100594 CGCCCCCGCCGCCGTGATGGTGG + Exonic
944743858 2:202636011-202636033 CGCCCCGCACGGCTCCCTGGTGG + Intronic
948824651 2:240568408-240568430 CGCCCCCGGCGGCGGCCGAGCGG + Intronic
948892294 2:240913342-240913364 CGCCCACGCAGGCTTCCTGGGGG - Intergenic
1169191364 20:3660797-3660819 CGCCCCCGACGGCTGCCTGCTGG - Exonic
1173562769 20:44018072-44018094 CGGCACCGAAGGCTTCCTGGAGG + Intronic
1175367545 20:58466512-58466534 CGGCCCCAGCGGCGCCCTGGAGG + Intronic
1176178870 20:63740459-63740481 CGCCCCCGTCCACGTCCGGGGGG - Exonic
1176190099 20:63804452-63804474 CGCCCGGGAGGGCTTCCTGGAGG - Intronic
1179887328 21:44319745-44319767 CCCCCCTGCAGGCGTCCTGGCGG + Intronic
1180952275 22:19725889-19725911 CGGCCCCGACAGCGTCCTCACGG - Intergenic
1180952344 22:19726216-19726238 CGGCCCCGACAGCGTCCTCACGG - Intergenic
1185319577 22:50194279-50194301 CGGGCCCGGCGGCGTCCTTGGGG + Intronic
1185338859 22:50282866-50282888 CGCCCCAAACTTCGTCCTGGGGG + Exonic
954716182 3:52528058-52528080 CGTCTCGGATGGCGTCCTGGGGG + Exonic
959419341 3:106111831-106111853 CTCCTCCGACGGGGTGCTGGCGG + Intergenic
968820222 4:2844169-2844191 CGGCGCCGAGGGCGTCTTGGAGG + Intronic
968835725 4:2963260-2963282 CGCTCCCGCCGGCGCCCCGGAGG + Exonic
971018962 4:22515756-22515778 CGGCCCCGCCGGCGTCCGGGTGG + Exonic
973845998 4:54913982-54914004 TGCCCTTGAAGGCGTCCTGGTGG + Intergenic
985973196 5:3393433-3393455 CGCCCCCCACCGTGTCCTCGGGG + Intergenic
999731864 5:154481250-154481272 CTCCCCCGACGTCATCCTGCTGG - Intergenic
1002194140 5:177493179-177493201 GGCCCCCGACAGGGTGCTGGGGG - Intronic
1010001926 6:70956863-70956885 CGTCCCAGAGAGCGTCCTGGGGG - Exonic
1015904875 6:138107075-138107097 CGGCCCCGAGGGCTTCCTGGAGG + Intronic
1018888295 6:167960784-167960806 CGTCACCGACGGCTTCCTTGTGG + Intronic
1019198552 6:170296317-170296339 CGCACCTGAGGGCTTCCTGGAGG + Intronic
1019298334 7:290570-290592 TGCGCCCCACGGCGTCCTGCGGG + Intergenic
1019436699 7:1025891-1025913 CGTCCCAGGCAGCGTCCTGGTGG - Intronic
1019624083 7:2006997-2007019 TGCCCCGGCCTGCGTCCTGGGGG - Intronic
1019755120 7:2763047-2763069 AGCCCCGGTCTGCGTCCTGGAGG - Intronic
1024961382 7:54980688-54980710 GGCGCCCGAGGGCGTCCTGGGGG - Intergenic
1026894577 7:74002846-74002868 CGCCCAGGCCGGCGTCCGGGAGG - Intergenic
1035421980 7:158737328-158737350 CTCCCCCGACGGCTGCCTGGTGG + Intronic
1035537977 8:406963-406985 CGCACCTGACGGCGACCAGGCGG - Exonic
1040558877 8:48506172-48506194 CGGCCCTGACGGCTGCCTGGAGG - Intergenic
1049482814 8:142834960-142834982 CACCCCCGGCGGCGTCCTGGCGG - Intronic
1062569605 9:137179074-137179096 CCCGCCCGCCGGCCTCCTGGCGG + Intronic
1196866653 X:120076986-120077008 GCCCCCCGACGGCGCCCTGTGGG + Exonic
1196876446 X:120159295-120159317 GCCCCCCGACGGCGCCCTGTGGG - Exonic