ID: 1152425535

View in Genome Browser
Species Human (GRCh38)
Location 17:80216643-80216665
Sequence CGCCATGGCCACAGTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152425535_1152425538 2 Left 1152425535 17:80216643-80216665 CCTGGGACACTGTGGCCATGGCG 0: 1
1: 0
2: 2
3: 26
4: 214
Right 1152425538 17:80216668-80216690 TCACGCTGAGTGAGCCCACCAGG 0: 1
1: 0
2: 2
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152425535 Original CRISPR CGCCATGGCCACAGTGTCCC AGG (reversed) Intronic
900421682 1:2558539-2558561 CTCCATGGCCACAGTGCCCCAGG + Intronic
900990642 1:6096770-6096792 CGCCATGGGGCCAGTGCCCCTGG + Intronic
902923106 1:19679049-19679071 TGCCATGTCCACGCTGTCCCCGG + Exonic
903543722 1:24110891-24110913 AGCCAGGGCCATCGTGTCCCAGG - Intronic
907667529 1:56446614-56446636 CATTTTGGCCACAGTGTCCCAGG + Intergenic
907825601 1:58013997-58014019 CGGCATGGTCACAGTGTTCCAGG + Intronic
911664817 1:100540061-100540083 AGCCGTGCCCGCAGTGTCCCAGG + Exonic
911883688 1:103271310-103271332 CACCATGGCCACTGTGTTCATGG - Intergenic
914919862 1:151839435-151839457 CGCCTAGGGCGCAGTGTCCCAGG - Intronic
915535809 1:156534653-156534675 TGCCATGGCCACAATGTCGAAGG + Exonic
915556409 1:156663320-156663342 CGCCAGGGCCCCAGAGCCCCAGG - Intergenic
916461280 1:165027481-165027503 CTCCATGGCCACTTTGTACCTGG - Intergenic
917605542 1:176624948-176624970 CCCCTTGGCCACAGTGTCCTTGG - Intronic
918478405 1:184951167-184951189 GGCCTTTGCCACAGTCTCCCTGG + Intronic
919740909 1:200981134-200981156 CAGCCTGGCCACAGTCTCCCTGG - Intronic
922649906 1:227328781-227328803 AGCGATGGCCACACTGTCCGAGG - Intergenic
924840656 1:247706982-247707004 CACCATGGCCACTTTGTCCATGG + Intergenic
1062814558 10:489984-490006 CGTCAGAGCCACCGTGTCCCTGG - Intronic
1062814603 10:490181-490203 CGTCAGAGCCACCGTGTCCCTGG - Intronic
1062903048 10:1160029-1160051 CCCCCTGGGCCCAGTGTCCCTGG + Intergenic
1063217535 10:3938040-3938062 CCCCAGGGCCACAGGGACCCAGG + Intergenic
1064772564 10:18738495-18738517 CCCCATGACCACTTTGTCCCTGG - Intergenic
1067498933 10:46785223-46785245 GGCACTGGCCACTGTGTCCCTGG + Intergenic
1067595709 10:47555150-47555172 GGCACTGGCCACTGTGTCCCTGG - Intergenic
1067792367 10:49298075-49298097 AGCCAGGGCCACAGGGACCCAGG - Intergenic
1069058174 10:63866281-63866303 TGGCATAGCCACAGTCTCCCTGG - Intergenic
1069667409 10:70172117-70172139 CCCCATGGACACATTGTCCCTGG - Intergenic
1069817403 10:71207115-71207137 GGCCAAGGCCCCATTGTCCCAGG + Intergenic
1069921451 10:71818149-71818171 GGCCAGGGCCACAGTGCCCTAGG + Intronic
1075333670 10:121593757-121593779 CACCATGGCAACCTTGTCCCTGG - Exonic
1075622534 10:123938601-123938623 GGCCAGGTGCACAGTGTCCCAGG - Intronic
1075910742 10:126123642-126123664 CGCCATGACCCCACTGTCCAAGG + Intronic
1076399929 10:130175848-130175870 CACCATGCCCACAGTGGGCCTGG - Intronic
1076935544 10:133566090-133566112 CTCCATGCCCACAGTGGCCGAGG + Intronic
1077338677 11:2016551-2016573 CGCCATGGCCAGAGGGCCCCAGG + Intergenic
1077875502 11:6301632-6301654 CACCATGTCCACAGTGTCCGTGG - Intergenic
1077981312 11:7303325-7303347 CGCCATGGGCACAGTTCTCCTGG - Exonic
1080588115 11:33699674-33699696 CGCCAAGGCCACAGAGTCCCAGG + Intronic
1081110640 11:39129559-39129581 CGCCATGGCCACTTTGTTCATGG - Intergenic
1083339570 11:61950341-61950363 GGCACTGGCCACAGAGTCCCAGG + Intronic
1083719511 11:64597487-64597509 CGTCATGGCCACTGTGACTCTGG - Intronic
1084358054 11:68652438-68652460 CGCCAAGGCCAGGGTGTCCCAGG - Intergenic
1084456065 11:69268889-69268911 CCCCATGGCCCCAGCCTCCCAGG - Intergenic
1084966042 11:72745109-72745131 CCCAGTGGCCACAGTGTGCCTGG - Intronic
1085516737 11:77116077-77116099 GGGCATGGCCTCAGTGCCCCTGG + Intronic
1085748451 11:79136401-79136423 CACCATGGCCACATTGTTCATGG - Intronic
1087098620 11:94344284-94344306 ACACATGTCCACAGTGTCCCTGG - Intergenic
1088014007 11:105037508-105037530 AGCCATGGCTTCAGTGGCCCGGG - Intergenic
1088728846 11:112663085-112663107 CCCCATGGCCACACAGTCCTGGG - Intergenic
1089519077 11:119051890-119051912 CGCCATGGGGGCAGTGTACCAGG - Exonic
1202821661 11_KI270721v1_random:71733-71755 CGCCATGGCCAGAGGGCCCCAGG + Intergenic
1091765740 12:3118960-3118982 CGCCCTGTCCACAGGGACCCTGG + Intronic
1092920055 12:13223196-13223218 CCCCATGGCCACTCTATCCCAGG + Intergenic
1101350991 12:103930004-103930026 TGCCATGGCTACCGTTTCCCCGG + Intergenic
1102591205 12:113958149-113958171 CACCATGCCCACCGTGTCCATGG + Intronic
1103909692 12:124345396-124345418 AGCCCTGACCTCAGTGTCCCTGG - Intronic
1104830837 12:131750120-131750142 CACCAGGGCCACAGTGTCTGGGG + Intronic
1105476214 13:20730032-20730054 AGCCACGGCCACAGCGGCCCGGG - Intronic
1105661161 13:22496977-22496999 CGTCAGGGCCACAGTGCCCCAGG - Intergenic
1105895283 13:24712095-24712117 GGCCCTTGCCACAGTTTCCCTGG + Intronic
1106132657 13:26952730-26952752 TGCCATGGCCCCACTGTCCAAGG + Intergenic
1113949894 13:114066100-114066122 AGCCGAGGCCACAGTGTCCCGGG - Intronic
1117412756 14:55465856-55465878 GGCGATGGCCACACTGGCCCTGG + Intergenic
1118842069 14:69520929-69520951 CCACATGGCCACAGTGCACCTGG - Intronic
1121312192 14:92941187-92941209 CTCCATGGCCACTGTGGACCGGG - Exonic
1121440329 14:93944805-93944827 AGCCATGGACACAGTGTTCCAGG + Intronic
1122005808 14:98702673-98702695 CCCCATGGCTACAGCTTCCCTGG + Intergenic
1122226934 14:100285707-100285729 CGCCAGGGCCACAGGGACACGGG + Intergenic
1122634475 14:103123622-103123644 CGCCAGGGCCTCAGTTTCCCTGG - Exonic
1122724582 14:103741908-103741930 GGTCAAGGCCACAGTCTCCCAGG - Exonic
1122868550 14:104622235-104622257 CGCTATCACCACATTGTCCCAGG + Intergenic
1126403760 15:48301747-48301769 TGCCATGGGCACAGTGGCTCAGG - Intronic
1128134722 15:65254411-65254433 CACCATGGAGACAGTGTCCTGGG - Intronic
1128173153 15:65530615-65530637 CTCCATGGCCACACTGCCCAGGG - Exonic
1130517028 15:84633555-84633577 CGCCACCGCCTCAGCGTCCCGGG - Intergenic
1131172021 15:90185252-90185274 TGCCATGGCAACAGGCTCCCCGG - Intronic
1132403924 15:101530896-101530918 CTGCAGGGCCACTGTGTCCCCGG + Intergenic
1132670127 16:1099087-1099109 CTCCCTGGCCATGGTGTCCCAGG + Intergenic
1132724015 16:1331102-1331124 CGCCATCCCCTCACTGTCCCCGG + Intergenic
1132954825 16:2585991-2586013 TGCCAAGGCCAGAGAGTCCCTGG - Intronic
1133417828 16:5620181-5620203 CGCCATGCTCACATTATCCCAGG + Intergenic
1135115257 16:19718290-19718312 CGCCATGGCCGCGGTTTCCACGG - Exonic
1135675569 16:24412148-24412170 CTCCAAGGCCACAGTCTTCCTGG - Intergenic
1138014154 16:53413843-53413865 CGCCATGGCCTCCGCCTCCCGGG + Intergenic
1138093390 16:54194339-54194361 CGCCATGGCCCGTGTGGCCCGGG - Intergenic
1138179818 16:54933491-54933513 CTCCATGCCCACCGTGTCCCGGG + Exonic
1138551697 16:57752239-57752261 TTCCCTGGCCCCAGTGTCCCAGG + Intronic
1139337885 16:66245751-66245773 TGCCATGGCCAGAGGTTCCCGGG + Intergenic
1140069172 16:71634400-71634422 GGCCATTGCCACAGTGACCATGG - Intronic
1142032297 16:87844608-87844630 CCCCATGAACGCAGTGTCCCTGG + Intronic
1142122007 16:88391125-88391147 GGACTTGGCCACAGTCTCCCGGG - Intergenic
1142352608 16:89586988-89587010 GGCACTGGCCTCAGTGTCCCTGG + Intronic
1142597700 17:1037581-1037603 CGCCCTGCCCACTCTGTCCCTGG - Intronic
1142856780 17:2735127-2735149 TGCCATGGATACCGTGTCCCTGG - Intergenic
1142890052 17:2937355-2937377 CCCCTTGGCCACAGCATCCCAGG - Intronic
1143169537 17:4919890-4919912 CCCCATGGCCACACTTCCCCCGG - Intergenic
1143862200 17:9899066-9899088 CGCCAGGTCAACAGTTTCCCAGG - Intronic
1143921113 17:10331771-10331793 CCTCAAGGCCTCAGTGTCCCTGG + Intronic
1144785971 17:17831789-17831811 TGCCCTGGCTATAGTGTCCCTGG - Intronic
1147189804 17:38731765-38731787 CGCCTGGGCCACAGATTCCCAGG + Intronic
1150003778 17:61457219-61457241 GGCCATCGCCACAGGCTCCCGGG - Intronic
1152295479 17:79464748-79464770 GGCCCTGGCCTCAGTGTGCCTGG - Intronic
1152425535 17:80216643-80216665 CGCCATGGCCACAGTGTCCCAGG - Intronic
1152625466 17:81386282-81386304 CACCATGCCCTCTGTGTCCCAGG + Intergenic
1153137550 18:1934050-1934072 CACCATGGCCACTATGTCCATGG + Intergenic
1153217572 18:2834782-2834804 CACCATGGCCACATTGTTCATGG + Intergenic
1153772390 18:8426203-8426225 GGCCTTGGCCACAGAGCCCCAGG + Intergenic
1157452374 18:47798578-47798600 GGTCACTGCCACAGTGTCCCAGG - Intergenic
1157586839 18:48806458-48806480 CGCTATGCCCCCAGTGACCCTGG - Intronic
1157882948 18:51339433-51339455 CTTCATGGCCACTGTGTGCCAGG - Intergenic
1160224946 18:77005349-77005371 CGCCATGGCAACATGGTACCTGG - Intronic
1160429907 18:78804146-78804168 CCCCATGGCCCCAGAGTGCCTGG - Intergenic
1160431139 18:78813365-78813387 AGCCATGGCCACGCTGGCCCAGG - Intergenic
1160606867 18:80058187-80058209 GGCCATGTCCACAGTCACCCTGG + Intronic
1161169084 19:2804157-2804179 CGCCAGGGCCACCGTGCCTCAGG - Intronic
1161234819 19:3192627-3192649 GGCCATGGCCGCCGTGCCCCAGG + Exonic
1161876308 19:6913727-6913749 CTCCCTGGCCACAGTCTTCCTGG + Exonic
1163809763 19:19423559-19423581 CGCCATGGCACCAATGGCCCTGG - Intronic
1164686501 19:30169648-30169670 AGAGATGGCCAGAGTGTCCCTGG + Intergenic
1164692305 19:30220422-30220444 CTGCATGGCCACAGGGTCCCAGG - Intergenic
1165158537 19:33802592-33802614 CCCCAAGGCCACAGGGCCCCAGG - Intronic
1165428219 19:35757091-35757113 GGCCACGGTCCCAGTGTCCCTGG - Intronic
925278881 2:2669362-2669384 TCCCATGCGCACAGTGTCCCAGG + Intergenic
925319476 2:2951190-2951212 CACCATCACCACTGTGTCCCAGG - Intergenic
929042870 2:37762552-37762574 TGCCATGGCCCCAGTACCCCTGG - Intergenic
929564272 2:42975036-42975058 CCCCGTGGCCACAGCGTCCTGGG - Intergenic
929580896 2:43081295-43081317 CACAATGGCCACTGTGTACCCGG + Intergenic
929946935 2:46378728-46378750 CGCCATGGACACAGAGGCCAAGG + Exonic
930434864 2:51327999-51328021 AACCATGGCCACAGGGTCACTGG - Intergenic
934162838 2:89268636-89268658 AGCAATGTCCCCAGTGTCCCAGG + Intergenic
934204436 2:89913888-89913910 AGCAATGTCCCCAGTGTCCCAGG - Intergenic
938159602 2:128973463-128973485 TGACATGGCCACAGAGGCCCTGG - Intergenic
941441980 2:165549741-165549763 CGACAAGGCCACAGAGGCCCTGG + Intronic
941489358 2:166124752-166124774 CGCCATGGCCACGGTGTGGCTGG + Intronic
941756456 2:169191734-169191756 CCCCGTGGCCACAGTGCCCAGGG - Intronic
947655312 2:231821546-231821568 CCCCATGGCAAAACTGTCCCTGG - Intergenic
947705930 2:232275466-232275488 TACAATGGGCACAGTGTCCCTGG - Intronic
947773047 2:232686230-232686252 CCTCTTGGCCACAGAGTCCCCGG + Intergenic
948138104 2:235652343-235652365 CCCCCAGGCCACTGTGTCCCTGG + Intronic
948455188 2:238101535-238101557 CCCGCTGGCCACAGGGTCCCGGG - Intronic
948591478 2:239053482-239053504 CGCCATGGCCTCGCTGTCCGTGG - Exonic
948678387 2:239612363-239612385 AGCCATGGCCAGCGTGGCCCTGG - Intergenic
1170767135 20:19299919-19299941 TGCCAGGGCCACAGCGTTCCTGG - Intronic
1172286618 20:33745203-33745225 CGCCCTGGCCACAGTCTCACTGG + Exonic
1172671105 20:36635037-36635059 CCTCATGGCCACCGTGTCCTGGG - Intronic
1174955658 20:55095007-55095029 CTGCATGGCCACTGTGTACCAGG + Intergenic
1176142182 20:63549654-63549676 CGCCAAGGCCGCAGAGCCCCAGG + Intronic
1179166396 21:38938525-38938547 TACCATGGCAACAGTGTCCCTGG - Intergenic
1179222961 21:39425913-39425935 CGCCATGGCCACAGGAGCTCTGG + Intronic
1179391975 21:41002352-41002374 CTCCATGGCAACAGGGTTCCAGG - Intergenic
1179882680 21:44300102-44300124 CGCCATGGCCGCGGTGGACCTGG + Exonic
1181333404 22:22112044-22112066 CACCATGGCTCCAGGGTCCCCGG + Intergenic
1181494663 22:23281217-23281239 GGCCAGGGCCTCAGTGGCCCCGG - Intronic
1181648664 22:24247191-24247213 GGCCCTGGCCAGAGTGCCCCTGG + Intergenic
1184301579 22:43563876-43563898 TGGCATGGCCACTGTGTGCCTGG - Intronic
1184433127 22:44453290-44453312 CCCCAGAGCCACAGTCTCCCAGG - Intergenic
1185280942 22:49969601-49969623 TGCCAAGGCTACAGTGTGCCAGG + Intergenic
1203295058 22_KI270736v1_random:34048-34070 TGCCATGGCCCCAGTGCCCCTGG - Intergenic
949125548 3:442291-442313 CACCATGGCCACTTTGTCCATGG + Intergenic
950566480 3:13772541-13772563 CGCCATGACCACAGAGTCTATGG - Intergenic
952152486 3:30607359-30607381 CGCCATGGGCGGAGTGGCCCAGG - Intronic
954195913 3:48997173-48997195 GGCCATGGCTACAAAGTCCCAGG + Intronic
955359525 3:58261031-58261053 CGCAGTGGCCACAGCATCCCCGG - Intronic
959501206 3:107107662-107107684 TTCCATGGCCTCAGTATCCCAGG - Intergenic
961528455 3:127524470-127524492 CGCCATGGCCACAGATGCCCGGG + Intergenic
962270080 3:133971133-133971155 CGGCCTGGCCACAGTGCCCCAGG + Intronic
964992390 3:162829449-162829471 TGCAATAGCCACAGTGTCACTGG + Intergenic
966852098 3:184170659-184170681 CGACCTGGCCTCAGTGCCCCCGG + Exonic
967154199 3:186677574-186677596 GGCCATGGCAACAGTGACCTTGG - Exonic
968033529 3:195524839-195524861 CGCCATGGCTTCAGTGGCCTCGG + Exonic
969370288 4:6727534-6727556 CACCAAGGCCACAGGGTGCCGGG + Intergenic
971687274 4:29786267-29786289 CACCATGGCCACTGTGTTCATGG + Intergenic
973103029 4:46295563-46295585 CACCATGGCCACATTGTCCATGG - Intronic
974727333 4:65813358-65813380 CACCATGGCCACATTGTTCACGG - Intergenic
976556953 4:86461211-86461233 CGCCTTGGGCACAGTTTCTCAGG - Intronic
976707212 4:88031504-88031526 TGCCTTGGCCACAGTATTCCAGG - Intronic
981819382 4:148868272-148868294 GGCCATGGCCACGGTTTCCATGG + Intergenic
985790801 5:1926080-1926102 CGCCAAGGCCTCTGGGTCCCTGG - Intergenic
987234321 5:15928004-15928026 CACCATGGCCACCGTCTCCCCGG - Exonic
987946325 5:24613647-24613669 GGCAATTGCCACAGTGTCCTAGG - Intronic
992431675 5:76716299-76716321 CGCCGCGGCCCCATTGTCCCGGG - Exonic
997356791 5:133267569-133267591 CACCATGGCCATAGTGCTCCTGG + Intronic
997977021 5:138446612-138446634 CCCCATTGCCACCGTGCCCCTGG + Exonic
998387110 5:141763714-141763736 TGCCATGGCAACAGCCTCCCGGG - Intergenic
1001101599 5:168818850-168818872 GGCCAAGGCCCCAGTGGCCCAGG - Intronic
1002174024 5:177391319-177391341 AGCCAGGGCCACACAGTCCCAGG + Intronic
1002409167 5:179060586-179060608 CCCCTTGGCCACTGGGTCCCGGG + Exonic
1003197609 6:3928946-3928968 CCCCTTAGCCATAGTGTCCCTGG - Intergenic
1003435165 6:6081482-6081504 CACAGTGGCCACAGTGTCCAGGG - Intergenic
1006419617 6:33924946-33924968 CCCCATGGCCTCAGTCTCCAAGG - Intergenic
1009851805 6:69208134-69208156 CACCATGGCCACATTGTTCATGG + Intronic
1010107835 6:72189750-72189772 CACCATGGCCACTGTGTTCATGG + Intronic
1013189338 6:107789041-107789063 TGACCTGCCCACAGTGTCCCTGG - Intronic
1014111065 6:117619014-117619036 CCCCAAGGCCACAGTGTGCAGGG + Intergenic
1016390465 6:143569344-143569366 CACCATGGCAACAGTCTCCTTGG + Intronic
1016796293 6:148121465-148121487 TGACATGGCAACAGTGTCCCAGG - Intergenic
1016982212 6:149864002-149864024 CGCCATGGCCTCCGTCGCCCAGG - Exonic
1017525720 6:155240025-155240047 CGACCTGGCCACAGTGGGCCAGG - Intronic
1018359752 6:163055199-163055221 CTCCATTTCCACACTGTCCCCGG - Intronic
1021303428 7:19001405-19001427 GGACATGACCACAATGTCCCAGG - Intronic
1021877082 7:25059348-25059370 GGACCTGGCCACAGTGTCACAGG - Intergenic
1023346808 7:39279051-39279073 CACCATGGCCCCAGTCTCTCCGG + Intronic
1024113310 7:46169357-46169379 CTCCATGACCAAAGTGTCCCTGG + Intergenic
1024234584 7:47388302-47388324 CTCCATCCCCACAGTCTCCCTGG - Intronic
1024674587 7:51626757-51626779 AGCCATGGCCACGGTGGACCTGG - Intergenic
1025615798 7:63114793-63114815 GGCCATGGCCACAGGTGCCCGGG + Intergenic
1026841517 7:73671866-73671888 CCCCAGGGCCATGGTGTCCCTGG - Exonic
1029515519 7:101020844-101020866 CTTCATGGCCACAGGGACCCCGG + Intronic
1032506967 7:132442890-132442912 AGCCTTGGGCACTGTGTCCCGGG - Intronic
1033504509 7:141986417-141986439 TGCCATGTCCACACTGTCTCTGG - Intronic
1034353550 7:150433052-150433074 CACCAGGGACACAGTGCCCCTGG - Intergenic
1035278588 7:157763381-157763403 CCCCATGGCCACAGTGACTGGGG - Intronic
1035345366 7:158193624-158193646 GGCCATGCCCATCGTGTCCCAGG - Intronic
1040610520 8:48977862-48977884 CGCCTTGACCACGGTTTCCCTGG + Intergenic
1049276176 8:141721153-141721175 AGCCATGGCCACAGGCTCCAAGG - Intergenic
1049289188 8:141792458-141792480 CCCCAGGGCCACAGTGGGCCGGG + Intergenic
1049493186 8:142915684-142915706 CGCCCTGGGCACAGTGCCTCTGG + Intronic
1052227695 9:26109192-26109214 CACCATGGCCACTTTGTTCCTGG - Intronic
1052334670 9:27307319-27307341 AGCAATGGTCACAGTGTCCTGGG + Intergenic
1053056787 9:34997702-34997724 CCCCAGGTCCACAGTGTCCAAGG + Exonic
1053283174 9:36834823-36834845 GGCCATAGCCACAGGGTCACAGG + Exonic
1056259542 9:84834026-84834048 CGCCATAGCCACTGTGTCTGTGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057299495 9:93869725-93869747 CACGATGGCCACAGTCTCCTGGG + Intergenic
1057730657 9:97605448-97605470 TGCCATGCCCACAGTGCCCCGGG + Intronic
1058124691 9:101178198-101178220 CACCATGGCCACTTTGTCCATGG - Intronic
1058801112 9:108545235-108545257 CTCCATAGCCACATTGTCCATGG - Intergenic
1059246066 9:112850709-112850731 TGCCATGGCCAGACTGTCCTAGG + Intronic
1060222870 9:121773679-121773701 CCCCAAGGCTACAGTGTCCCTGG - Intronic
1060230162 9:121820074-121820096 CACCATGGCCCCTCTGTCCCGGG - Intergenic
1060825979 9:126688386-126688408 CGCCACGGTCCCAGGGTCCCAGG - Intronic
1061178737 9:129012030-129012052 CTCCATGGCCACAGGGCACCGGG + Intronic
1061179155 9:129013824-129013846 CGCCCTGGGCACACTGTCCCAGG + Intronic
1061711481 9:132490858-132490880 CGCCATGCAGACAGTGGCCCCGG - Intronic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1189407132 X:40735394-40735416 CGCCATGGCCCCAGTGCAGCTGG - Exonic
1194232966 X:91347105-91347127 CACCATGGCCACTGTGTTCAGGG - Intergenic
1194834060 X:98659618-98659640 CACCATGGCCACTTTGTTCCTGG - Intergenic
1197183566 X:123562574-123562596 GACCATGGCCACCGTGTTCCGGG + Intergenic
1198312817 X:135437435-135437457 CGCCAGGGCCACAGTGGACTAGG + Intergenic
1198651495 X:138868164-138868186 GCCTCTGGCCACAGTGTCCCAGG + Intronic
1200002467 X:153069111-153069133 CACCATGCCTACACTGTCCCCGG - Intergenic
1200005257 X:153080899-153080921 CACCATGCCTACACTGTCCCCGG + Intergenic