ID: 1152432074

View in Genome Browser
Species Human (GRCh38)
Location 17:80254078-80254100
Sequence CGGGACTGCCCGGGCAGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152432074_1152432087 18 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432087 17:80254119-80254141 AGGGGAGGGCCTCTGTAACCAGG No data
1152432074_1152432081 -2 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432081 17:80254099-80254121 CGGCCAATGTCAGCGCAGCAAGG No data
1152432074_1152432089 26 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432089 17:80254127-80254149 GCCTCTGTAACCAGGGCTGCTGG No data
1152432074_1152432083 0 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432083 17:80254101-80254123 GCCAATGTCAGCGCAGCAAGGGG No data
1152432074_1152432085 3 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432085 17:80254104-80254126 AATGTCAGCGCAGCAAGGGGAGG No data
1152432074_1152432086 4 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432086 17:80254105-80254127 ATGTCAGCGCAGCAAGGGGAGGG No data
1152432074_1152432088 19 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432088 17:80254120-80254142 GGGGAGGGCCTCTGTAACCAGGG No data
1152432074_1152432082 -1 Left 1152432074 17:80254078-80254100 CCCGTTCTGCCCGGGCAGTCCCG No data
Right 1152432082 17:80254100-80254122 GGCCAATGTCAGCGCAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152432074 Original CRISPR CGGGACTGCCCGGGCAGAAC GGG (reversed) Intergenic
No off target data available for this crispr