ID: 1152436969

View in Genome Browser
Species Human (GRCh38)
Location 17:80282222-80282244
Sequence CTGTATGAACAGTTGCTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152436968_1152436969 3 Left 1152436968 17:80282196-80282218 CCACAGGCATCTGTATGACATAG 0: 1
1: 0
2: 0
3: 21
4: 137
Right 1152436969 17:80282222-80282244 CTGTATGAACAGTTGCTACACGG 0: 1
1: 0
2: 1
3: 10
4: 104
1152436967_1152436969 8 Left 1152436967 17:80282191-80282213 CCTTACCACAGGCATCTGTATGA 0: 1
1: 1
2: 0
3: 14
4: 117
Right 1152436969 17:80282222-80282244 CTGTATGAACAGTTGCTACACGG 0: 1
1: 0
2: 1
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152436969 Original CRISPR CTGTATGAACAGTTGCTACA CGG Intronic
904878798 1:33678531-33678553 GTGAATGAACAGCTGCTGCAGGG + Intronic
905138201 1:35817614-35817636 CTGTAAGAATATTTGCTACAGGG - Intronic
910395815 1:86792857-86792879 CTGTTTGAACAGTTGCCATGGGG - Intergenic
912560374 1:110547337-110547359 CCATATGAACAGTTGCTGCCTGG - Intergenic
913185423 1:116366317-116366339 CTCTTTGAACAGTTACTACATGG + Intergenic
913711301 1:121486514-121486536 TGGTAGGAAAAGTTGCTACATGG + Intergenic
915964238 1:160292561-160292583 CTGTAGGAACAGTTGCTTGTAGG + Exonic
918708008 1:187692468-187692490 ATCTATCAACAGTGGCTACAGGG + Intergenic
920024871 1:202986940-202986962 CAGTAAGGACAGTTGCAACAGGG + Intergenic
920923668 1:210321333-210321355 CTGTCTGGAGAGTTGCTACCAGG + Intergenic
922079989 1:222286376-222286398 CTCTCCCAACAGTTGCTACAAGG + Intergenic
924229100 1:241948515-241948537 CTGAAGGAGCAGCTGCTACACGG + Intergenic
1064544823 10:16439628-16439650 CTGTATGAACACTTTGCACATGG - Intronic
1067151631 10:43739891-43739913 CTGTATCGGCAGTAGCTACAAGG - Intergenic
1067336725 10:45373178-45373200 CAGTATGAGGAGATGCTACAGGG + Intergenic
1075870025 10:125765223-125765245 ATGTGTGTACACTTGCTACAAGG - Intergenic
1082188546 11:49213445-49213467 ATGAATGAACTATTGCTACATGG - Intergenic
1085388130 11:76168788-76168810 CTGTATGTTCACTTGCTGCAGGG + Intergenic
1085532689 11:77201308-77201330 CTGTATGGAGAGTTGTGACAAGG + Intronic
1086677978 11:89633252-89633274 ATGAATGAACTATTGCTACATGG + Intergenic
1088344168 11:108804195-108804217 TTGTATAAAAAGTTACTACAAGG + Intronic
1089656757 11:119952983-119953005 CTGTATGAAGAGTTGGTCCATGG - Intergenic
1090176335 11:124653034-124653056 CTCTATGAACTCTTACTACATGG - Intronic
1091138892 11:133218439-133218461 CTGTATGACAAGATGCTATAGGG - Intronic
1092752091 12:11728277-11728299 CTGTAAGAACAGTTTATACCAGG + Intronic
1095317563 12:40784707-40784729 CTGTAAGAACAGGTTCAACAGGG + Intronic
1095349607 12:41192674-41192696 ATGAATGAACAGTTGAAACAAGG + Intronic
1098688419 12:73455397-73455419 CTGTATGAACAAGTTCCACATGG - Intergenic
1102255185 12:111410879-111410901 CTCTATGAACAGTTGGTGCTAGG + Intronic
1107670702 13:42743618-42743640 CTTTAGGGACAGTTGCTCCAGGG + Intergenic
1108862741 13:54882303-54882325 CTGCCTGGACAGTTACTACAGGG - Intergenic
1108863478 13:54892309-54892331 CTGCATGCACAGTTTCTACTTGG + Intergenic
1110493816 13:76141045-76141067 CTTTATGTATAGTTGCCACAAGG - Intergenic
1115586881 14:34823049-34823071 GTATATGAAAAGTTACTACATGG + Intronic
1121914811 14:97828687-97828709 CTGTATGTACAGTTTCTCTAGGG - Intergenic
1126949896 15:53869313-53869335 GTGTATGACCACTTGCTACAAGG - Intergenic
1136057103 16:27698627-27698649 CTGTCTGAACAGTGGAAACACGG - Intronic
1139309549 16:66016958-66016980 CTGAATGAATAGTTGGTGCATGG + Intergenic
1149017138 17:51921156-51921178 CTGTATGAGCAGTGGTTAGATGG - Intronic
1152436969 17:80282222-80282244 CTGTATGAACAGTTGCTACACGG + Intronic
1153009725 18:527435-527457 CTGCATTAACAGTTGCCAAAGGG - Intergenic
1154486167 18:14872981-14873003 CTGGATGTAGAGTTGCCACATGG + Intergenic
1156420854 18:36951182-36951204 CTGTAGGAACACTTTCTAAAAGG - Intronic
1158364199 18:56712885-56712907 CTTTATGAACATTTACTAGAAGG + Intronic
1161135065 19:2614736-2614758 CTGTATGAACATTTGTGGCAAGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1167997052 19:53414310-53414332 AGGTATGATAAGTTGCTACATGG + Intronic
931124244 2:59256139-59256161 CAGTAGAAACAGTTGCTACATGG + Intergenic
933706485 2:85294730-85294752 CTGTATGTACAGTTGTAAAAGGG - Intronic
936849942 2:116883657-116883679 CTGTATGAACAGAATCTACCTGG - Intergenic
937064154 2:119004679-119004701 CTGTATGTACAGTGTCTGCAAGG + Intergenic
938712414 2:133986915-133986937 CAGTATGAACGGCTGATACAAGG - Intergenic
944332794 2:198491651-198491673 CTTTATGAACATTTTATACAGGG - Intronic
948950588 2:241248683-241248705 CTGTTTTAACAGGTACTACAGGG + Intronic
1173386232 20:42590544-42590566 CTGTATGAACAGGTGACAGAGGG + Intronic
1175205368 20:57307162-57307184 ATGTATGGACATTTGCTACAGGG + Intergenic
1176795136 21:13366392-13366414 CTGGATGTAGAGTTGCCACATGG - Intergenic
1179311719 21:40202057-40202079 CTGTCTGATCACTTGCTCCAGGG + Intronic
1183068263 22:35378647-35378669 CTGAATGAATAGATGCTTCAAGG - Intergenic
1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG + Intergenic
949143390 3:663893-663915 GTGTATGCACAGCTGCTATAAGG - Intergenic
953351846 3:42221807-42221829 CTCTTTTAACAGCTGCTACAGGG - Intronic
955897324 3:63714307-63714329 TTGTATGTGCAGTTTCTACAGGG + Intergenic
956341338 3:68227546-68227568 CTGTATGGAGACTTGCTACATGG - Intronic
959155408 3:102660772-102660794 CTCAATGATCAGTTGCTGCAGGG - Intergenic
961102596 3:124214184-124214206 CTGTATGCACAATTGAGACATGG + Intronic
963125681 3:141813597-141813619 CTGGATCAAAAGGTGCTACAAGG - Intronic
964514721 3:157495329-157495351 CAGTCTGAACAGTTGATGCATGG + Exonic
969037342 4:4265339-4265361 CTGTAAGTGCAGTTGCTCCAGGG - Intergenic
969196073 4:5564954-5564976 CTTTGTGAACAGTAGCTATAAGG + Intronic
973727248 4:53788943-53788965 CTGTAAGCACAGTGACTACATGG + Intronic
974196982 4:58587760-58587782 CTGGTTGAACAGTAGCTGCAAGG + Intergenic
976130570 4:81879603-81879625 CTGTGGGAACAGATCCTACAAGG - Intronic
976526704 4:86100072-86100094 TTTTATGTACAGGTGCTACAGGG - Intronic
977794952 4:101153477-101153499 TTGTATAAACACTTGGTACATGG + Intronic
983027042 4:162750833-162750855 CTGTATGCACAGATGTTTCATGG - Intergenic
983665960 4:170183393-170183415 CAGGATGAAAAGTTGTTACATGG + Intergenic
988699872 5:33662733-33662755 CTGGATGAACACTTGCTGAATGG + Intronic
989735965 5:44706818-44706840 CTTTATGAACAGTAGCTGAATGG + Intergenic
989781736 5:45274401-45274423 TTGTCTGAAGAGTTGCTACTAGG - Intronic
993483760 5:88456180-88456202 CTGTTTGCACAGTTGTTAAATGG + Intergenic
994050291 5:95355020-95355042 CTTTATGAACAATTGCTATTTGG + Intergenic
997206216 5:132051679-132051701 CTGTCTGAACAGTTTCTTCCTGG + Intergenic
997840551 5:137235650-137235672 CTGTGTGAAGATTTGCAACAGGG + Intronic
999102230 5:149036263-149036285 CTGGAAGCACAGTAGCTACATGG - Intronic
1000743882 5:165005820-165005842 CTGTATTAACATGTGATACATGG - Intergenic
1006959827 6:37917377-37917399 GGGTAAAAACAGTTGCTACAGGG - Intronic
1008397404 6:51024987-51025009 TTGAATGAATAGTTGCTAGAAGG - Intergenic
1012318808 6:97816472-97816494 CAGTATGAACATTTGCTACATGG + Intergenic
1012840499 6:104323634-104323656 GTTTATGTACAGTTGATACATGG - Intergenic
1015245168 6:131066503-131066525 CTGTATAAAGAGTTGCTTGAGGG - Intergenic
1018944328 6:168335673-168335695 ATGAATGAACTGTTGCTACGTGG - Intergenic
1019115354 6:169756632-169756654 TTGTACAAACAGTTGCTTCATGG + Intronic
1020917746 7:14217702-14217724 CTGTATGAATATTTTCCACATGG + Intronic
1023237068 7:38100398-38100420 CTGTATTTACAGTTGCTTGAGGG + Intergenic
1026451048 7:70529974-70529996 CTGTTGGAACATTTGTTACAAGG + Intronic
1033737319 7:144235426-144235448 CTTTAAGGACAGTTGCCACATGG + Intergenic
1033745737 7:144315521-144315543 CTTTAAGGACAGTTGCCACATGG - Intergenic
1035917937 8:3645243-3645265 GTGTATGAACACTTACTGCATGG - Intronic
1036003139 8:4631450-4631472 CTGTCTCCATAGTTGCTACAAGG - Intronic
1037163182 8:15796728-15796750 TTGTATGTAAAGTTGCTACCAGG + Intergenic
1039368102 8:36954236-36954258 CTGAATGAACATTTTCTCCAAGG + Intergenic
1039528204 8:38235094-38235116 ATGAATGAACAGTTCCTACTTGG - Intronic
1047397663 8:124516974-124516996 CTGTAAGAACAGAAGTTACATGG + Intronic
1047912201 8:129542542-129542564 CTATGTGAACAGTTTCTAAAAGG + Intergenic
1048786184 8:138052853-138052875 CTGCATGAACAGTTTCCTCATGG - Intergenic
1055372833 9:75619090-75619112 ATGTATGAGAAATTGCTACATGG + Intergenic
1057483640 9:95464848-95464870 GTGTTTGAACATTTTCTACAAGG - Intronic
1057799290 9:98180311-98180333 CTGTATGACCGGCTGCTACAAGG + Intronic
1059412488 9:114141333-114141355 CTGTATGCACGGTAGCTACCAGG + Intergenic
1060157431 9:121329378-121329400 TTCTATGATCAGTTGCTAGAAGG + Intronic
1187277897 X:17832384-17832406 CTGTATGTACAGGTGCGACAGGG - Intronic
1188912613 X:35867612-35867634 CTGTATGTGTAATTGCTACATGG + Intergenic
1191840834 X:65512745-65512767 CTGGATGAACACTTGCACCAGGG + Exonic
1194957148 X:100194379-100194401 CAGTATGAACAGGTGCAAGAAGG - Intergenic
1198086413 X:133286785-133286807 CTGTAAGGACAGTGGCTTCAGGG + Intergenic