ID: 1152438008

View in Genome Browser
Species Human (GRCh38)
Location 17:80288039-80288061
Sequence CAACCTCGGTGGGCGCGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152438008_1152438023 17 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438023 17:80288079-80288101 GCCCAGGCTTTGGGAGAGGCAGG 0: 1
1: 1
2: 4
3: 55
4: 553
1152438008_1152438017 7 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485
1152438008_1152438014 -5 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438014 17:80288057-80288079 GGTTGGCGACAGCCCCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1152438008_1152438026 22 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438008_1152438015 1 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546
1152438008_1152438022 13 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG 0: 1
1: 1
2: 3
3: 47
4: 491
1152438008_1152438027 29 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438008_1152438019 8 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152438008 Original CRISPR CAACCTCGGTGGGCGCGGAG AGG (reversed) Exonic
902286362 1:15410669-15410691 CAGCCTCGGTGTGTGCGGTGTGG - Intronic
907581239 1:55574603-55574625 CAACCTCGGAGGGAATGGAGGGG + Intergenic
920041938 1:203103697-203103719 CAACCTCGTTGGGGGTTGAGGGG + Intronic
922177577 1:223208644-223208666 AACCCTGGGTGGGCTCGGAGTGG - Intergenic
1070593711 10:77818188-77818210 CAACCTGGGTGGGCCTGGGGAGG + Intronic
1074434516 10:113422574-113422596 CAACATTGGTGGGCGGGGAGAGG - Intergenic
1080385983 11:31811538-31811560 GAATCTCGGCGTGCGCGGAGCGG - Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1096073759 12:48789476-48789498 GACCCTCGGTGGGCGGGGCGGGG - Intergenic
1115474611 14:33800794-33800816 TCACCTCGGCGGGCGCGTAGCGG - Exonic
1119793568 14:77376469-77376491 CAACCCGGGTGGGGGCCGAGAGG + Intronic
1123829358 15:24118245-24118267 CAACCTTGGTGGGAATGGAGTGG - Intergenic
1143513663 17:7408690-7408712 CGTCCTCGGTGGGCACGTAGAGG - Exonic
1146833215 17:36088624-36088646 CGACCTCGGTGGGCCCAGTGGGG - Exonic
1147318292 17:39631547-39631569 CAACCTCCGCAGGAGCGGAGGGG - Intronic
1148122545 17:45221665-45221687 CAACCATGGCGGGCGGGGAGTGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1160772842 19:840818-840840 CAACCTTTGTGGGGGCGGGGAGG - Intergenic
1160864904 19:1252216-1252238 GCTCCTCGGTGGGGGCGGAGGGG - Intronic
1161284701 19:3463302-3463324 CGTCCTCGGTGGGGGCTGAGGGG - Intronic
1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG + Intronic
1162145613 19:8610939-8610961 GAACCGCGGGGGGCGGGGAGGGG + Intergenic
1163830713 19:19545981-19546003 CTACCCCGGCGGGTGCGGAGGGG - Exonic
1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG + Intronic
1167423055 19:49415032-49415054 CAGCCTCTGTGGGTGTGGAGTGG - Intronic
931430995 2:62208943-62208965 CAACCTGGGTGGGGGCAGTGGGG + Intronic
932002332 2:67896261-67896283 AAACCTAGGTGGGTGCGGAGCGG - Intergenic
940929705 2:159413404-159413426 CAAACTGGCTGGGCGCGGACTGG + Intronic
948487318 2:238289076-238289098 CCAGCTCGGGGAGCGCGGAGTGG + Intronic
948988651 2:241541077-241541099 CAAGCAGGGCGGGCGCGGAGCGG - Intergenic
1172245459 20:33442893-33442915 CAACCAAGGTGGGTGCAGAGGGG - Intronic
1180844079 22:18972060-18972082 CAGCCCTGGTGGGTGCGGAGTGG - Intergenic
950345176 3:12287235-12287257 CAACATGGGTGGGGACGGAGTGG - Intergenic
967184115 3:186930755-186930777 CGACCGGCGTGGGCGCGGAGCGG + Exonic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
986077616 5:4354278-4354300 CAGCCTCGATGGGAGGGGAGGGG - Intergenic
986690207 5:10307785-10307807 CAAGCCCGGAGGGGGCGGAGAGG + Exonic
997654386 5:135544622-135544644 CAACCTCGGAAGGCGCCCAGAGG - Intergenic
998176440 5:139904632-139904654 CTACCTCGGTGGGCCCAGGGAGG - Intronic
1014586330 6:123202230-123202252 CCACCACGGTGGGGGCGGGGGGG - Intergenic
1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG + Intronic
1025819329 7:64947684-64947706 CACCCTGTGTGGGGGCGGAGGGG + Intergenic
1031025077 7:116671766-116671788 AAACCCGGGTGGGCGCGGGGCGG + Intergenic
1033313821 7:140281804-140281826 CAAGCTCGGTGTGCACGTAGAGG - Intergenic
1035745350 8:1958686-1958708 CAACCTCGGGGGGCTGGGTGGGG + Intergenic
1036733282 8:11284727-11284749 CAGGCTGGGTGGGCGCGGCGAGG - Exonic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1049465759 8:142750624-142750646 CAACGTCGGTGGGAGGAGAGAGG - Intronic
1060845927 9:126837538-126837560 CCTCCTGGGTGGGCGTGGAGAGG + Exonic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1200292367 X:154885882-154885904 CAACCGGGGTGGGGACGGAGAGG + Intronic
1200339205 X:155381619-155381641 CAACCGGGGTGGGGACGGAGAGG + Intergenic
1200347264 X:155459073-155459095 CAACCGGGGTGGGGACGGAGAGG - Intergenic