ID: 1152438015

View in Genome Browser
Species Human (GRCh38)
Location 17:80288063-80288085
Sequence CGACAGCCCCCTGCAGGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 546}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152438011_1152438015 -9 Left 1152438011 17:80288049-80288071 CCCACCGAGGTTGGCGACAGCCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546
1152438006_1152438015 18 Left 1152438006 17:80288022-80288044 CCACTGGAGGGTGACGGCCTCTC 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546
1152438005_1152438015 23 Left 1152438005 17:80288017-80288039 CCACGCCACTGGAGGGTGACGGC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546
1152438003_1152438015 26 Left 1152438003 17:80288014-80288036 CCACCACGCCACTGGAGGGTGAC 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546
1152438008_1152438015 1 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546
1152438010_1152438015 -4 Left 1152438010 17:80288044-80288066 CCGCGCCCACCGAGGTTGGCGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546
1152438012_1152438015 -10 Left 1152438012 17:80288050-80288072 CCACCGAGGTTGGCGACAGCCCC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152438015 Original CRISPR CGACAGCCCCCTGCAGGCCC AGG Exonic
900108353 1:995692-995714 CCACGGCCCCCTGGAGCCCCAGG - Intergenic
900122701 1:1055628-1055650 CGATAGCCCCTCGCAGGGCCTGG - Exonic
900381267 1:2385216-2385238 CGTCGGCCCCCAGCTGGCCCTGG - Intronic
900441226 1:2656441-2656463 CAACAGCACCCTGCACCCCCAGG + Intronic
900442228 1:2661619-2661641 CAACAGCACCCTGCACCCCCAGG + Intronic
900443121 1:2666235-2666257 CAACAGCACCCTGCACCCCCAGG + Intronic
900444015 1:2670851-2670873 CAACAGCACCCTGCACCCCCAGG + Intronic
900444919 1:2675507-2675529 CAACAGCACCCTGCACCCCCAGG + Intronic
900445627 1:2679241-2679263 CAACAGCACCCTGCACCCCCAGG + Intronic
900446557 1:2684020-2684042 GAACAGCACCCTGCAGCCCCAGG + Intronic
900476431 1:2878496-2878518 CGACAGCTCTCAGCAGCCCCCGG + Intergenic
900764421 1:4494505-4494527 CGCAGGCCCCCTGCAGCCCCTGG + Intergenic
900998030 1:6133389-6133411 CGTCCGCCGCCTGCAGCCCCAGG - Intronic
901203892 1:7483124-7483146 CTTCAGCCCCCTGCAGGCTCAGG + Intronic
901800956 1:11707758-11707780 AGCTAGCCCCCTGCTGGCCCAGG + Intronic
902780285 1:18700525-18700547 CAGCATCCTCCTGCAGGCCCCGG - Intronic
902950987 1:19882681-19882703 CGCCAACCAGCTGCAGGCCCTGG + Exonic
903121062 1:21217491-21217513 CCCCAACCCCCTGCCGGCCCCGG + Intronic
903291548 1:22317451-22317473 GCACAGCCCCCTGCAGGTCTGGG + Intergenic
903303129 1:22393084-22393106 CCACAGCTCTGTGCAGGCCCAGG - Intergenic
903861479 1:26367412-26367434 CGAAAGCCCCCTGCACCCTCAGG + Intronic
904010206 1:27385146-27385168 CCCCACCCCCCAGCAGGCCCTGG - Intergenic
904540635 1:31230597-31230619 CGACATCCCTCTCCAGGCCAGGG + Intronic
904581733 1:31548709-31548731 CGTGGGCTCCCTGCAGGCCCAGG + Intergenic
905346624 1:37315430-37315452 CGACATCCCCTTGCAGCTCCAGG + Intergenic
905629694 1:39511679-39511701 TGACAGCCCCCAGCGGGCCCTGG + Intronic
905668065 1:39774511-39774533 TGACAGCCCCCAGCGGGCCCTGG - Intronic
906716442 1:47973227-47973249 GGGCTGCCCCCTGCTGGCCCAGG - Intronic
906806102 1:48780189-48780211 CCCCACCCCCCTACAGGCCCCGG + Intronic
907524084 1:55043917-55043939 TGCCCGCCGCCTGCAGGCCCAGG + Exonic
908911683 1:69078898-69078920 AGGCAGCCCCCTGCAAGCCAAGG + Intergenic
909897369 1:81089326-81089348 CCACAACCCCCGGCAGGCTCTGG + Intergenic
910775238 1:90868163-90868185 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
910799735 1:91133113-91133135 CCCCAGCCCCCAACAGGCCCCGG - Intergenic
911102577 1:94106020-94106042 TGACAGTGCCCTTCAGGCCCTGG + Intronic
911690406 1:100826522-100826544 CCACATCCCCCAACAGGCCCCGG - Intergenic
912744412 1:112233184-112233206 GGACAGCTCCCTGAAGGCCCAGG - Intergenic
913156221 1:116101766-116101788 CCCCCACCCCCTGCAGGCCCTGG + Intergenic
915431247 1:155868629-155868651 CTACAGCCAGCTGCAGGACCTGG + Exonic
915649657 1:157300213-157300235 CCCCACCCCCCAGCAGGCCCTGG - Intergenic
916395789 1:164386024-164386046 CCCCCACCCCCTGCAGGCCCTGG + Intergenic
916563026 1:165949519-165949541 GGACAGCTCCCTGCAGCCCCTGG - Intergenic
917289522 1:173457953-173457975 CCCCACCCCCCGGCAGGCCCAGG - Intergenic
917772538 1:178295371-178295393 CCTCACCCCCCAGCAGGCCCTGG + Intronic
918156772 1:181855053-181855075 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
918853730 1:189724278-189724300 CCACACCCCCCAACAGGCCCTGG + Intergenic
919146256 1:193639570-193639592 CCTCACCCCCCAGCAGGCCCTGG + Intergenic
919751811 1:201042489-201042511 CGACAACCCCCTTCAGGGCAGGG + Intronic
920951934 1:210580494-210580516 CCCCACCCCCCAGCAGGCCCTGG + Intronic
920997729 1:211011133-211011155 CCACAACCCCCAACAGGCCCTGG + Intronic
921067038 1:211630665-211630687 CCAAAGCCCCCTGCACACCCAGG + Intergenic
922550532 1:226491028-226491050 CTAGAGCCCCTTGCAGGGCCAGG + Intergenic
922887632 1:229032069-229032091 CGACAGCCCCGTCCTAGCCCAGG - Intergenic
922953042 1:229575184-229575206 AGACAGCCATCTGCAAGCCCAGG + Intergenic
923659126 1:235943437-235943459 AGACAGCCATCTGCAAGCCCAGG + Intergenic
924613603 1:245593325-245593347 CCCCAGCCCCCAACAGGCCCCGG + Intronic
924793054 1:247270502-247270524 CCACAGACCCCAGCAGGCCCTGG + Intergenic
1063580266 10:7300153-7300175 CCCCATCCCCCAGCAGGCCCTGG - Intronic
1064218785 10:13421786-13421808 AGACAGCCATCTGCAAGCCCAGG - Intergenic
1064236117 10:13577385-13577407 CCTCCACCCCCTGCAGGCCCCGG + Intergenic
1064356215 10:14620685-14620707 CGCCATCCCCCCACAGGCCCTGG + Intronic
1064582547 10:16808929-16808951 AGACGGCCACCTGCAAGCCCAGG + Intronic
1064848537 10:19683932-19683954 CCTCACCCCCCAGCAGGCCCCGG + Intronic
1066719783 10:38325410-38325432 CCCCATCCCCCAGCAGGCCCTGG - Intergenic
1067174616 10:43935505-43935527 AGACAGCCTTCTGCAAGCCCAGG - Intergenic
1068718407 10:60214515-60214537 CCCCAGCCCCCAACAGGCCCTGG + Intronic
1069024213 10:63521935-63521957 CGGCACCGCCCTGCGGGCCCGGG + Intronic
1071347491 10:84706623-84706645 CTACATGCCCCTGCAGGCCCTGG - Intergenic
1071835594 10:89414665-89414687 CGCCAGGCCTCTGCAGCCCCTGG - Exonic
1073111603 10:101066200-101066222 CGACAGCCTCCTACACGCCAGGG + Intronic
1073913229 10:108371500-108371522 CCCCACCCCCCTACAGGCCCTGG + Intergenic
1074690766 10:116002157-116002179 CACCATCCCCCTGCCGGCCCTGG - Intergenic
1074766479 10:116703769-116703791 ACCCAGCACCCTGCAGGCCCCGG - Intronic
1076507459 10:130987507-130987529 TCAGAGGCCCCTGCAGGCCCTGG - Intergenic
1076548847 10:131264332-131264354 CGACAGCCCCTTCCCGACCCAGG - Intronic
1076871441 10:133196911-133196933 CGACACCCAACTACAGGCCCCGG - Intronic
1076889165 10:133275565-133275587 CGATTGCCCCCAGCCGGCCCTGG - Exonic
1076900707 10:133336139-133336161 CCACAGCCCCCTGCAGCGCCAGG - Intronic
1076944642 10:133637792-133637814 CCAGGGCCACCTGCAGGCCCCGG + Intergenic
1077265973 11:1650431-1650453 CCACAGCGCCCTGCAGGCACAGG - Intergenic
1077655073 11:4010872-4010894 CCCCAGCCCCCAACAGGCCCTGG + Intronic
1077783811 11:5360977-5360999 CCCCACCCCACTGCAGGCCCTGG - Intronic
1079261116 11:18882309-18882331 CCACATCCCCCAACAGGCCCTGG + Intergenic
1079312927 11:19382065-19382087 AGGCAGCCCCCTGGAAGCCCAGG - Intronic
1080848483 11:36047045-36047067 CAGCAGCCCCCTCCAGCCCCAGG - Intronic
1081612765 11:44572943-44572965 AGGCAGCCTCCTGCAGGACCAGG + Intronic
1082951845 11:58825302-58825324 CCCCAGCCCCCGACAGGCCCTGG + Intergenic
1083276138 11:61598098-61598120 CCACTTCCCCCTGCAGACCCAGG + Intergenic
1083571784 11:63765136-63765158 CCCCAGCCCCCTGCTGCCCCCGG + Exonic
1083878122 11:65535428-65535450 CCACAGCCTCCTCCAGGGCCAGG + Intronic
1084155539 11:67310810-67310832 CCACAGGCCCCTGCAGGCCCTGG + Intronic
1084183378 11:67457560-67457582 CGGCCGCCCACTGCAGACCCAGG - Exonic
1084566247 11:69930690-69930712 CCCCAGACCCCTGCAGGCCTCGG + Intergenic
1084721243 11:70906937-70906959 CGAAAACCCCATGCAGGGCCAGG + Intronic
1085393407 11:76194133-76194155 CCACAGCCCTCTCCACGCCCTGG + Intronic
1086889866 11:92245328-92245350 CGCCACCCCCCGACAGGCCCCGG - Intergenic
1088420163 11:109636288-109636310 AGACAGGATCCTGCAGGCCCAGG - Intergenic
1088797309 11:113274547-113274569 CGAGAGCCCCTTGCAGCCCATGG - Intronic
1088959029 11:114642427-114642449 CCCCAGCCCCCGACAGGCCCAGG + Intergenic
1089083329 11:115796012-115796034 CGACAGCCGCCTGCATTCCAGGG + Intergenic
1089184254 11:116604079-116604101 AGACTGCCTCCTGAAGGCCCTGG + Intergenic
1089620202 11:119717756-119717778 CGGCAGGCACCTGCAGGCCCGGG + Intronic
1089846723 11:121464614-121464636 CCTCAGCCCCCTGCGTGCCCTGG - Intronic
1090246796 11:125221880-125221902 CTACAGCCCACTGCCCGCCCGGG + Intronic
1090308311 11:125710943-125710965 CCACACCCCCCGACAGGCCCCGG - Intergenic
1090985923 11:131766064-131766086 AGTCAGCCCCCTCCATGCCCAGG - Intronic
1091361155 11:134979245-134979267 GCACAGCCCGCTGCACGCCCGGG + Intergenic
1092242460 12:6843571-6843593 CCACAGCCCACTGGAAGCCCAGG - Intronic
1093330705 12:17834435-17834457 CCCCACCCCCCAGCAGGCCCTGG - Intergenic
1093905271 12:24684026-24684048 CGCCAGCCCTCAACAGGCCCTGG + Intergenic
1094361717 12:29638298-29638320 CGACAGACCCCAGCAGACACTGG + Intronic
1095695332 12:45137510-45137532 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1096106323 12:48998600-48998622 CTGCAGCACCCTGGAGGCCCAGG + Exonic
1096700633 12:53380527-53380549 CGCCCGCCCCCTGCCCGCCCCGG + Intronic
1097401974 12:59139028-59139050 CTCCAGCCCCCGACAGGCCCTGG + Intergenic
1099055410 12:77833914-77833936 CGACAGGCACCTGCAGACACCGG - Intronic
1099637025 12:85226684-85226706 CCCCACCCCCCAGCAGGCCCCGG + Intronic
1099892142 12:88602957-88602979 CCCCACCCCCCTGCAGGCCCCGG + Intergenic
1100399110 12:94212479-94212501 CCCCACCCCCCGGCAGGCCCCGG + Intronic
1100797671 12:98199316-98199338 CCCCAGCCCCTGGCAGGCCCTGG + Intergenic
1100962967 12:99984362-99984384 GGAGAGCTCCCTGCAGCCCCAGG + Intronic
1100980231 12:100157539-100157561 CCATGGCCCCCTGCAGGGCCTGG + Intergenic
1101381218 12:104215727-104215749 CGCGAGCCCCCTGCCGGCCGCGG - Intergenic
1101967807 12:109293006-109293028 CTGCAGCCCCCCGCAGGCCCAGG + Intronic
1102035451 12:109768469-109768491 CGTCATCCCCCTGCCGGGCCGGG + Exonic
1102258158 12:111428165-111428187 GGCCAGCCCCCTCCAGGCCTCGG - Intronic
1102599396 12:114017753-114017775 CCACAGCACCCTGCAGGATCAGG + Intergenic
1103828844 12:123762682-123762704 CGCCCGCCACGTGCAGGCCCCGG + Intronic
1104217403 12:126747718-126747740 CGAGCGCCCCCTGCTGGCCATGG + Intergenic
1104267461 12:127248068-127248090 CGACAGCTCCCTGCAGCTCGTGG - Intergenic
1104961641 12:132490837-132490859 CTTCAGCACCCTGGAGGCCCTGG + Exonic
1105874961 13:24542948-24542970 CCACCGCCCCCGACAGGCCCTGG + Intergenic
1106248814 13:27968892-27968914 CGTCAGCCCCCCGCAGTACCCGG - Exonic
1106873759 13:34049781-34049803 CCAAAGCCCCCAACAGGCCCTGG + Intergenic
1107624416 13:42268488-42268510 CCCCAACCCCCTACAGGCCCCGG + Intergenic
1107869545 13:44734537-44734559 CTCCAGCTCCCTGCTGGCCCTGG + Intergenic
1108199057 13:48024774-48024796 CCCCAGCCCCCGACAGGCCCTGG - Intergenic
1108477445 13:50835030-50835052 CCCCACCCCCCTACAGGCCCCGG - Intronic
1108510131 13:51148519-51148541 CGGCAGCCCCCTGCAGAGCCAGG + Intergenic
1109087795 13:57998588-57998610 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
1109409729 13:61946225-61946247 CCACACCCCACTACAGGCCCCGG - Intergenic
1110390549 13:74968489-74968511 CCCCAGCCCCCGACAGGCCCCGG + Intergenic
1110540580 13:76702423-76702445 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1111770332 13:92588079-92588101 CTCCAGCCCCCAACAGGCCCTGG + Intronic
1112617191 13:101017742-101017764 TGACAGCCCCCTGCATGCCCGGG - Intergenic
1112784843 13:102940309-102940331 CAACTGCCCCCTGCTGGCACAGG - Intergenic
1113647738 13:112011052-112011074 TGGCAGCCCCTTGCTGGCCCTGG + Intergenic
1113764790 13:112874550-112874572 CCACAGCCCTCTGCAGACCTGGG + Intronic
1113774142 13:112933146-112933168 CCACAGCCTCCTGGAGGTCCGGG + Intronic
1113962582 13:114133492-114133514 CCCCAGTCCCCTGCAGACCCCGG + Intergenic
1114700774 14:24676066-24676088 CCCCACCCCCCAGCAGGCCCTGG + Intergenic
1115771043 14:36663890-36663912 CGGCAGCCCCAAGCAGGCTCGGG - Intronic
1116331844 14:43606463-43606485 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1117600630 14:57370540-57370562 CACCAGCCCCCGACAGGCCCTGG - Intergenic
1119129781 14:72161222-72161244 CCCCAGCCCCCAACAGGCCCTGG - Intronic
1119159535 14:72441567-72441589 CGCCAGCCCTCAGCAGGGCCAGG + Intronic
1119427492 14:74545304-74545326 GTACAGCCACCTGCAAGCCCAGG - Intronic
1122434090 14:101680901-101680923 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
1122771175 14:104098622-104098644 CCCCAGGCCCCTGCAGGCTCCGG + Intronic
1122788822 14:104175965-104175987 TGACTGCTCCCTGCGGGCCCTGG + Exonic
1122926449 14:104905284-104905306 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926469 14:104905370-104905392 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926479 14:104905413-104905435 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926487 14:104905456-104905478 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926521 14:104905628-104905650 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926541 14:104905714-104905736 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926551 14:104905757-104905779 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926569 14:104905843-104905865 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926587 14:104905929-104905951 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926614 14:104906058-104906080 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926640 14:104906187-104906209 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926666 14:104906316-104906338 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926676 14:104906359-104906381 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926694 14:104906445-104906467 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926727 14:104906579-104906601 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926737 14:104906622-104906644 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926789 14:104906842-104906864 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1122926799 14:104906885-104906907 CGACAGCTCCCTGCCCGTCCTGG - Intergenic
1122926817 14:104906971-104906993 CGACAGCTCCCTGCGCGTCCTGG - Intergenic
1123069881 14:105637478-105637500 CTGCTGCCCCCTGCAGGGCCTGG - Intergenic
1202926604 14_KI270724v1_random:31462-31484 CCAGGGCCACCTGCAGGCCCCGG - Intergenic
1125335822 15:38625357-38625379 CCACACCCCCCAACAGGCCCCGG + Intergenic
1125423532 15:39527955-39527977 AGACAGCCACCTGCAAGCCAAGG - Intergenic
1125609494 15:40960960-40960982 GGACAGGCTCCTGCAGGCTCTGG - Intergenic
1126128627 15:45319148-45319170 CCCCAGCCCCCAACAGGCCCCGG - Intergenic
1126177649 15:45752662-45752684 CCACACCCCCCAACAGGCCCCGG + Intergenic
1127317298 15:57809307-57809329 CCCCAACCCCCGGCAGGCCCTGG + Intergenic
1127963317 15:63906330-63906352 CAAGAGCCCCTCGCAGGCCCAGG + Intergenic
1128511347 15:68315797-68315819 CCACAGCCCCCTGCTGGCTTGGG + Intronic
1128784415 15:70384216-70384238 CCACATCCCCTTGCAGGGCCTGG + Intergenic
1129302295 15:74632350-74632372 CCTCAGCCCCCTGCACGGCCAGG - Exonic
1129767639 15:78180561-78180583 CGACTGTCCCCAGCAGGCCCTGG + Intronic
1130276172 15:82477405-82477427 CCATGGCCCCCTGCAGGGCCCGG + Intergenic
1130468531 15:84204798-84204820 CCATGGCCCCCTGCAGGGCCCGG + Intergenic
1130485221 15:84394964-84394986 CCATGGCCCCCTGCAGGGCCTGG - Intergenic
1130495733 15:84468744-84468766 CCATGGCCCCCTGCAGGGCCCGG - Intergenic
1130571732 15:85051976-85051998 CCACACCCCACAGCAGGCCCCGG + Intronic
1130590824 15:85209397-85209419 CCATGGCCCCCTGCAGGGCCCGG + Intergenic
1131799271 15:96053012-96053034 CGGCAGCCCCGCGCTGGCCCCGG + Intergenic
1131864026 15:96687642-96687664 TGACAGCATCCTGCAGCCCCTGG - Intergenic
1132349983 15:101133529-101133551 CCACAGGCCCCTTCAGGGCCAGG + Intergenic
1132365672 15:101254545-101254567 CCACAGCCCCCTGGAGGCCAAGG + Intergenic
1132380095 15:101360427-101360449 CCACTGCCCCCTGCAGCCTCGGG + Intronic
1132553748 16:564008-564030 GGCCAGCCCCCTGCTGCCCCCGG + Exonic
1132578190 16:673522-673544 CGACAACCCCCAGCAGCCCCCGG - Exonic
1132794934 16:1715412-1715434 TGACTGCCCCCTGCCAGCCCAGG + Intronic
1133013820 16:2929774-2929796 CGGCAGCCCCCAGGAAGCCCAGG + Exonic
1133072315 16:3254606-3254628 CGACAGCCCCCTCCCGGCCTCGG + Exonic
1133786303 16:8976061-8976083 CCCCACCCCCCAGCAGGCCCTGG + Intergenic
1134018790 16:10907442-10907464 CGACAGCCCCCCCGGGGCCCTGG + Exonic
1134802568 16:17099070-17099092 CCACAGCCAACTGCAGGCCCAGG - Intergenic
1136639633 16:31552713-31552735 CCCCAGCCCCCTCCAGGCTCTGG + Intergenic
1136929469 16:34406381-34406403 AGACAGCCATCTGCAAGCCCAGG + Intergenic
1136975105 16:35005423-35005445 AGACAGCCATCTGCAAGCCCAGG - Intergenic
1137581936 16:49638981-49639003 CCACAGCCCCCTGCAGCCGTTGG - Intronic
1137876973 16:52006406-52006428 AGAGAGTCCCCTGCAGACCCTGG - Intronic
1139492221 16:67292329-67292351 GGACAGGCCCCTGCCAGCCCAGG - Intronic
1141140961 16:81496721-81496743 GGTCAGCCCCCTGCGGACCCTGG + Intronic
1141506427 16:84481419-84481441 AGGCAGCACCCGGCAGGCCCCGG - Intronic
1142033487 16:87850051-87850073 CTGCATCCCCCTGCAGGCCCAGG + Intronic
1142690866 17:1605537-1605559 CCCCAGCCTCCTGCAGGCCAGGG - Intronic
1143016463 17:3893315-3893337 GCACGGTCCCCTGCAGGCCCAGG - Intronic
1143479380 17:7219833-7219855 CTACAGCTCCCAGCATGCCCCGG + Intronic
1143704396 17:8687147-8687169 CAACAGGCCCCTGTAAGCCCTGG + Intergenic
1144338342 17:14292701-14292723 CCCCATCCCCCAGCAGGCCCTGG + Intergenic
1146722039 17:35130519-35130541 CACCAGCACCCTGCGGGCCCGGG + Exonic
1147558868 17:41496897-41496919 AGCCTGCCCCCTGCAGGGCCTGG + Intergenic
1147685841 17:42286540-42286562 CAACAGGCCTCTGCAGGCCCTGG + Intergenic
1148537165 17:48449688-48449710 CGCCACCCCCCAACAGGCCCTGG - Intergenic
1148581214 17:48745250-48745272 CCTCAGCTCCCTGCAGACCCTGG + Intergenic
1149178588 17:53905266-53905288 CCACAGCCCCCGACAGGCCTTGG - Intergenic
1150221139 17:63496564-63496586 GGACAGACCCCTCAAGGCCCAGG - Intronic
1150289331 17:63972592-63972614 CGGCATCCCCCTGGAGGACCTGG - Exonic
1152438015 17:80288063-80288085 CGACAGCCCCCTGCAGGCCCAGG + Exonic
1152566262 17:81101745-81101767 CCACAGTGCCCAGCAGGCCCAGG - Intronic
1152686064 17:81694406-81694428 GGCCAGGCCGCTGCAGGCCCAGG + Intronic
1152699744 17:81813012-81813034 GGACAGCCACCAGCAGGCCCTGG - Exonic
1152755604 17:82085763-82085785 CGACCGCCACCCCCAGGCCCTGG - Exonic
1152780635 17:82226123-82226145 CTACAGGGCCCTCCAGGCCCTGG - Intergenic
1152804481 17:82348568-82348590 GGCCAGCCCCCTGCAGCCCCAGG - Intergenic
1153568866 18:6448146-6448168 TGACAGCCCCGTGCGGCCCCTGG + Intergenic
1154007006 18:10539499-10539521 CCCCAGCCCCCGACAGGCCCAGG - Intronic
1154367699 18:13726472-13726494 CGCTAGCCCCCTGCCGCCCCCGG + Exonic
1157318101 18:46610387-46610409 CCCCAGCCCCCGACAGGCCCCGG - Intronic
1157675530 18:49565805-49565827 GGACAGCCCCCTCCAGGCAGTGG - Intronic
1160561883 18:79764147-79764169 GGACAGTTCCCTGCAGGGCCTGG + Intergenic
1161283839 19:3458993-3459015 CGCCACCTCCCTGCAGACCCCGG + Intronic
1161304253 19:3557914-3557936 GGACAGCCCACTGCGGGCCGGGG + Intronic
1161590644 19:5127757-5127779 GGACAGCCCCCGGGAGGCCTAGG + Intronic
1162498677 19:11038413-11038435 AGAAGGCCCCCTGCAGACCCAGG - Intronic
1162583107 19:11542478-11542500 CCACTGCACCCTGCCGGCCCTGG + Intronic
1162725707 19:12688856-12688878 CCACAGCCCCAAGCAGGCACAGG + Intronic
1162785657 19:13033167-13033189 CGACGGCGGCCTGCAGGGCCGGG - Intronic
1162951781 19:14075242-14075264 CTACCGCCCCCTGGCGGCCCGGG + Intergenic
1163635430 19:18435099-18435121 CGGGAGCCCCACGCAGGCCCTGG + Exonic
1163677859 19:18664315-18664337 CACCAGCCTCCTGCAGGGCCTGG + Exonic
1164575824 19:29404832-29404854 CGACAGCCTTCTCCAGGTCCTGG + Intergenic
1165749455 19:38251338-38251360 CCTCAGCCCCCTCCAGGACCGGG - Exonic
1165838029 19:38771133-38771155 CGACCCTCCCCTGCAGGCCGTGG - Exonic
1165841536 19:38791564-38791586 CGACCCTCCCCTGCAGGCCGTGG + Exonic
1166425942 19:42677952-42677974 CGCCATCCCCCAACAGGCCCCGG + Intronic
1166979428 19:46623973-46623995 CAACAGCTCCCTGCTGGGCCTGG - Exonic
1167649379 19:50721110-50721132 GAACTGCCCCCTGCAGGCCCTGG - Intergenic
1167820636 19:51924525-51924547 CCACAACCCCCAACAGGCCCCGG - Intronic
1168133845 19:54337652-54337674 CGACAGGGCCCTGCAGGGTCAGG + Exonic
1168187541 19:54709577-54709599 CGACAGGGCCCTGCAGGGTCAGG - Intergenic
925281304 2:2687172-2687194 CTCCATCCCCCAGCAGGCCCTGG - Intergenic
925750925 2:7090192-7090214 CTCCTGCCCCCTGCAGCCCCAGG + Intergenic
925928206 2:8685450-8685472 CGACCGCCCCGCGCTGGCCCCGG - Intergenic
926217777 2:10915786-10915808 GGACAGCCCCTTTCAGGCCAGGG - Intergenic
926434469 2:12824251-12824273 CCACAGCCCCCAGAAGGTCCTGG - Intergenic
926661276 2:15469824-15469846 CCCCACCCCCCAGCAGGCCCCGG - Intronic
927355155 2:22164528-22164550 CCCCAGCCCCCAACAGGCCCCGG + Intergenic
927387170 2:22548184-22548206 CCCCACCCCCCAGCAGGCCCTGG - Intergenic
927403552 2:22742261-22742283 CCACAGATCCCTGCAGGCCAGGG + Intergenic
927519710 2:23691337-23691359 GTTCAGCCCACTGCAGGCCCTGG - Intronic
927559388 2:24059183-24059205 CGACTGCTCCCGGCAGTCCCTGG - Intronic
928095781 2:28404247-28404269 CTACAGCCCCCTGCCGGGCCTGG + Exonic
929589057 2:43133494-43133516 CCACAGATGCCTGCAGGCCCAGG + Intergenic
929782271 2:44964826-44964848 TGACAGCCCCCTGCAGGTGGAGG + Intergenic
930352458 2:50274382-50274404 CCCCAACCCCCAGCAGGCCCTGG - Intronic
930359448 2:50359211-50359233 CCACAGCCCCCTGCAAGCAAGGG + Intronic
933374984 2:81467496-81467518 CCCCAGCTCGCTGCAGGCCCAGG + Intergenic
933900568 2:86846729-86846751 CGCCAGCCACCAGCAGGCCAAGG + Exonic
934735012 2:96685703-96685725 CCCCACCTCCCTGCAGGCCCTGG + Intergenic
934775023 2:96931996-96932018 GCACAGTCCCCTGAAGGCCCTGG - Intronic
935371798 2:102355711-102355733 CGCAAGCACCCTGCAGGCCGCGG - Intronic
935535359 2:104286988-104287010 CCACAGCTCTCTGCAGGCTCCGG - Intergenic
935667930 2:105529249-105529271 CCCCATCCCCCAGCAGGCCCTGG + Intergenic
935779980 2:106502496-106502518 CGCCAGCCACCAGCAGGCCAAGG - Intergenic
936695540 2:114943053-114943075 CTCCACCCCCCAGCAGGCCCAGG + Intronic
937219014 2:120330826-120330848 GGACGGCCACCTGCAAGCCCAGG + Intergenic
937438444 2:121897745-121897767 AGACAGCCACCTGCTGGCCAAGG - Intergenic
937584113 2:123525341-123525363 CCAAACCCCCCGGCAGGCCCAGG - Intergenic
937899116 2:127003630-127003652 AGACAGCCATCTGCAGGCCAAGG + Intergenic
938184542 2:129218134-129218156 CCCCACCCCCCTACAGGCCCCGG - Intergenic
939036370 2:137136135-137136157 CCTCACCCCCCAGCAGGCCCTGG - Intronic
939116630 2:138068847-138068869 CTCCTGCCCCCTACAGGCCCCGG + Intergenic
939187266 2:138875971-138875993 CCCCAGCCCCCAACAGGCCCCGG + Intergenic
939400342 2:141684441-141684463 CCCCACCCCCCGGCAGGCCCTGG - Intronic
939408926 2:141798985-141799007 AGACAGCCACCTGCAAGCCAAGG + Intronic
942302012 2:174571854-174571876 CGCCACCTCCCAGCAGGCCCGGG - Exonic
942363034 2:175192714-175192736 CGCCAGCCCACGACAGGCCCCGG - Intergenic
944491506 2:200262717-200262739 CCACAGCCCCATGCAGCCTCAGG + Intergenic
944628794 2:201600423-201600445 CTCCAGCCCCCTACAGGCCCTGG - Intronic
944845550 2:203664493-203664515 CCCCATCCCCCAGCAGGCCCTGG + Intergenic
944866560 2:203868196-203868218 CAACTGCTCCCTGCTGGCCCTGG - Intronic
945753898 2:213822731-213822753 CCCCAGCCCCCAACAGGCCCTGG + Intronic
945993665 2:216417428-216417450 AGACAGCCACCTGCAGGGCATGG - Intronic
946013085 2:216582276-216582298 CAAGAGCCCCCTGCAAGTCCAGG - Intergenic
947133699 2:226955694-226955716 AGACAGCCACCTGCAAGCCAAGG - Intronic
947137185 2:226987164-226987186 CCCCAGCCCCCAACAGGCCCTGG - Intronic
947714093 2:232331213-232331235 TGCCACCTCCCTGCAGGCCCAGG - Intronic
947733301 2:232442591-232442613 TGCCACCTCCCTGCAGGCCCAGG - Intergenic
948464540 2:238145901-238145923 CGAGAGCCCCATGCTGGCCTCGG + Intronic
948622705 2:239246440-239246462 GGACAGCCCCATTCAGCCCCCGG - Intronic
948890689 2:240905679-240905701 AGACAGCCCCTGGCAGCCCCTGG + Intergenic
948893928 2:240919549-240919571 GTCCAGCCTCCTGCAGGCCCGGG + Intronic
1168882865 20:1223142-1223164 CCCCACCCCCCAGCAGGCCCCGG - Intergenic
1168952482 20:1811842-1811864 CCACAGCCCACTTCAAGCCCAGG + Intergenic
1169498811 20:6139656-6139678 CCCCAGCCCCCAGCAGGCCCCGG + Intergenic
1170759500 20:19237254-19237276 TGACCCCCGCCTGCAGGCCCAGG - Intronic
1170966359 20:21075555-21075577 AGACAGCCACCTGCAAGCCAAGG - Intergenic
1171163428 20:22949587-22949609 AGACAGCCCCTTGTGGGCCCAGG + Intergenic
1171536007 20:25890022-25890044 CCACACCCCCCGACAGGCCCTGG - Intergenic
1172028930 20:31968214-31968236 CGGCAGCCCCCTCCGGGTCCGGG - Exonic
1172064191 20:32207685-32207707 CGCCAGGCCCCCTCAGGCCCCGG + Exonic
1172178447 20:32986531-32986553 CCACAGCCCCCTGCACCCCTGGG - Intronic
1172511501 20:35504144-35504166 GGACAGCTGGCTGCAGGCCCAGG + Exonic
1172577008 20:36017249-36017271 AGACAGCCCTCTGCAGGCACAGG - Intronic
1172624786 20:36340769-36340791 CGACAGCCCCCCGAGGGACCAGG - Intronic
1172654432 20:36528305-36528327 CTACCCCGCCCTGCAGGCCCGGG - Exonic
1172785583 20:37466273-37466295 AGGCAGCCCCCTGCGGGACCTGG + Intergenic
1172959658 20:38789758-38789780 AGACAGCCATCTGCAAGCCCAGG + Intergenic
1173708679 20:45135722-45135744 AGACAAGCCCCTGCAGACCCAGG - Intergenic
1173793138 20:45841028-45841050 AGACCGCCCCCTGCTGACCCTGG + Exonic
1174178540 20:48659862-48659884 CCAGAGCCCCCTGCAGGCATGGG - Intronic
1174246988 20:49188561-49188583 CTACAACTCCCGGCAGGCCCCGG - Intergenic
1175026789 20:55910880-55910902 CCCCACCCCCCTACAGGCCCCGG - Intergenic
1175733563 20:61370392-61370414 GCAAAGCCCCCTGCATGCCCAGG - Intronic
1175764786 20:61584785-61584807 TGTCAGCCCCCTGCAGGCTCTGG - Intronic
1175811764 20:61862156-61862178 AGGCAGCCCCCTCCATGCCCTGG + Intronic
1175905249 20:62376464-62376486 CGCCAGCCTCCTGCGGGGCCTGG - Intergenic
1175989551 20:62781052-62781074 TGCCAGCCACCTGCAGGCTCCGG + Intergenic
1176124995 20:63471407-63471429 GGACAGCCCCTTCCAGGCCCAGG + Intronic
1176414838 21:6468210-6468232 CGAGAGCGCCCGGCAGCCCCTGG - Intergenic
1176973334 21:15290348-15290370 CGCCAGCCCCCTGCTGCCTCAGG - Intergenic
1176975556 21:15316859-15316881 CCCCAGCCCCCGACAGGCCCTGG + Intergenic
1177048357 21:16200407-16200429 CCCCATCCCCCAGCAGGCCCTGG + Intergenic
1178631528 21:34265413-34265435 AGATAGGCCCCTGGAGGCCCAGG + Intergenic
1178803072 21:35815161-35815183 CCACAAACTCCTGCAGGCCCTGG + Intronic
1179541814 21:42087852-42087874 AGACAGCCGTCTGCAGGCCAAGG - Intronic
1179690338 21:43076532-43076554 CGAGAGCGCCCGGCAGCCCCTGG - Intronic
1179908766 21:44437262-44437284 CTGCAGCCCCCTGCAGCCCCTGG + Intronic
1179997383 21:44980279-44980301 CCTCAGCCCCGGGCAGGCCCAGG + Intergenic
1180109798 21:45642683-45642705 CGGCCTCCCCCTGCAGCCCCCGG + Intergenic
1180738014 22:18033239-18033261 CCACAGCCCCCTGCCTGCCTGGG - Intergenic
1180842127 22:18964359-18964381 CCACAAGGCCCTGCAGGCCCAGG + Intergenic
1180922341 22:19527414-19527436 CGATCTCCACCTGCAGGCCCTGG - Exonic
1180987831 22:19915932-19915954 CTCCAGCCCCCAGCAGGGCCTGG + Intronic
1182302103 22:29342758-29342780 CGACAGTCCCATGGAGGCCCAGG + Intronic
1182910294 22:33978588-33978610 AGACAGCCACCTGCAAGCCATGG - Intergenic
1183332806 22:37230329-37230351 CCACAGGACTCTGCAGGCCCAGG - Intronic
1183489195 22:38107815-38107837 CGAGTGACCCCTCCAGGCCCTGG + Intronic
1183744703 22:39685850-39685872 CGACAGCCCCCGGCGTGCCCTGG + Exonic
1183744951 22:39686751-39686773 CAAAAGCCCCGTCCAGGCCCTGG - Exonic
1183915632 22:41116369-41116391 CCCCATCCCCCAGCAGGCCCTGG + Intronic
1183931478 22:41238264-41238286 CGGCGGGGCCCTGCAGGCCCTGG - Exonic
1184526000 22:45023205-45023227 CCACTGCCCCCCGCAGACCCTGG + Intergenic
1184636839 22:45839413-45839435 GCTCAGCCCCCTGCAGCCCCAGG - Intronic
1184840872 22:47051708-47051730 CGGCACCTCCCTGCAGCCCCAGG + Intronic
950008235 3:9704803-9704825 CCAGAGCCCCCTCCCGGCCCAGG + Intronic
950528879 3:13540843-13540865 ACACAGCCCCCTGGAGTCCCAGG - Intergenic
950665722 3:14493674-14493696 CGCCAGGCCCCAGCAGTCCCCGG - Exonic
951139535 3:19145676-19145698 CCCCAGCCCCCAACAGGCCCGGG + Intergenic
951705008 3:25535564-25535586 CCCCAGCCCCCGACAGGCCCTGG + Intronic
952830418 3:37560105-37560127 CGCCACCCCCCGACAGGCCCCGG + Intronic
953013784 3:39052858-39052880 CCCCAGCCCCCGACAGGCCCCGG - Intronic
953232544 3:41077612-41077634 CAGCAGCACCCTTCAGGCCCAGG - Intergenic
953355358 3:42251756-42251778 CAACAGCATCCTGCAGGGCCTGG - Intergenic
953988844 3:47467879-47467901 CCCCATCCCCCGGCAGGCCCTGG + Intronic
954712995 3:52514174-52514196 CAACCGCTCCCTGGAGGCCCAGG + Exonic
956167205 3:66405789-66405811 AGTCAGCGCCCTGCAGGCCTTGG - Intronic
956417888 3:69052218-69052240 CGACAGCCTCCCGCGAGCCCGGG + Exonic
956460368 3:69465544-69465566 CCCCAGCCCCCGACAGGCCCCGG + Intronic
956489560 3:69756287-69756309 CCACAACCCCCGACAGGCCCTGG + Intronic
956542525 3:70357573-70357595 TCCCAGCCCCCAGCAGGCCCTGG - Intergenic
957083513 3:75658614-75658636 CCAGGGCCACCTGCAGGCCCCGG - Intergenic
957773123 3:84720009-84720031 CTCCAGCCCCCAACAGGCCCTGG + Intergenic
959735577 3:109654207-109654229 CTCCAGCCCCCAACAGGCCCCGG - Intergenic
960148209 3:114225864-114225886 TGAGACCCACCTGCAGGCCCAGG + Intergenic
961528656 3:127526085-127526107 AGACAGCCACCTGCAAGCCAAGG + Intergenic
962454210 3:135550033-135550055 CGCCACCCCCCAGGAGGCCCAGG + Intergenic
962675757 3:137756908-137756930 CCCCAGCCCCCAACAGGCCCCGG - Intergenic
962684746 3:137836593-137836615 AAACAGCCACCTGCAAGCCCAGG + Intergenic
963428082 3:145157652-145157674 CTCCAGCCCCCCACAGGCCCAGG - Intergenic
963689801 3:148484124-148484146 CCTCAGCCCCCAACAGGCCCTGG - Intergenic
964859639 3:161186903-161186925 CCCCAGCCCCCAACAGGCCCTGG - Intronic
967168559 3:186806121-186806143 GGACAGCATCTTGCAGGCCCCGG - Intronic
967876506 3:194271465-194271487 GCTCAGCCCCCTCCAGGCCCAGG + Intergenic
969217763 4:5735749-5735771 TGAAAGGCCCCTGCATGCCCAGG + Intronic
969225350 4:5793722-5793744 GTACAGCTCCCTGAAGGCCCAGG + Intronic
969683136 4:8654177-8654199 CCACATCCCCCAACAGGCCCTGG + Intergenic
970745021 4:19283929-19283951 CCCAAGCCCCCTACAGGCCCCGG - Intergenic
970988015 4:22180603-22180625 AGACAGCCCCCTACAAGCCAAGG + Intergenic
971993660 4:33935031-33935053 CCCCAGCCCCCGACAGGCCCCGG - Intergenic
972393052 4:38631491-38631513 TGACAGCCCCCTGAAGGCAGAGG - Intergenic
976483286 4:85569895-85569917 GGACAGGCCCCTGCAGGCCTAGG - Intronic
978061415 4:104344814-104344836 CGAGGGACACCTGCAGGCCCAGG - Intergenic
979978069 4:127221457-127221479 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
980489985 4:133511813-133511835 CCACATCCCCCAACAGGCCCTGG - Intergenic
981456266 4:144956763-144956785 CCCCATCCCCCAGCAGGCCCTGG + Intergenic
982123386 4:152163014-152163036 AGACAGCCATCTGCAAGCCCAGG + Intergenic
983747824 4:171223638-171223660 CCCCACCCCCCTACAGGCCCTGG - Intergenic
984578021 4:181474152-181474174 CCCCATCCCCCTACAGGCCCTGG - Intergenic
985213972 4:187629169-187629191 AGACTGGCCCCTGCAGACCCAGG + Intergenic
985448028 4:190038302-190038324 CCAGGGCCACCTGCAGGCCCCGG + Intergenic
985483186 5:131264-131286 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
985758313 5:1732369-1732391 CGCCAGCTCCCACCAGGCCCAGG + Intergenic
985775208 5:1837727-1837749 TGGCTGACCCCTGCAGGCCCAGG - Intergenic
985854311 5:2413103-2413125 CAACAGTCCCCTGCCTGCCCAGG + Intergenic
986137914 5:4999810-4999832 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
986982634 5:13466910-13466932 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
990351194 5:54918557-54918579 CCCCACCCCCCCGCAGGCCCCGG - Intergenic
990618354 5:57531044-57531066 CCCCAGCCCCCGACAGGCCCCGG - Intergenic
990619441 5:57543821-57543843 CTCCAGCCCCCAACAGGCCCTGG + Intergenic
990870520 5:60426517-60426539 CCACACCCCCCAACAGGCCCTGG - Intronic
991523144 5:67523664-67523686 CTCCAGCCCCCAACAGGCCCCGG + Intergenic
991718213 5:69471866-69471888 CCCCACCCCCCTACAGGCCCTGG - Intergenic
991951459 5:71950382-71950404 CCCCACCCCCCAGCAGGCCCTGG + Intergenic
991955221 5:71987543-71987565 TGACAGCCCCCTGCAGCCATAGG - Intergenic
992078434 5:73213045-73213067 CCACACCCCTCAGCAGGCCCCGG - Intergenic
992690361 5:79235928-79235950 CGACAGCCGGCTCCAGCCCCGGG + Intronic
994627793 5:102242949-102242971 AGAGAGCTCCCTGCTGGCCCAGG - Intronic
995093381 5:108207483-108207505 CCCCAGCCCCCAACAGGCCCCGG + Intronic
996043992 5:118849863-118849885 CCACACCCCCCAACAGGCCCTGG - Intronic
996146652 5:119985308-119985330 CCCCTACCCCCTGCAGGCCCCGG + Intergenic
996280154 5:121720540-121720562 CCCCAGCCCCCAACAGGCCCCGG + Intergenic
997352867 5:133243602-133243624 CTACAGCCACCTACATGCCCTGG - Intronic
998507845 5:142686352-142686374 GGACAGCCAGCAGCAGGCCCAGG + Intronic
999238875 5:150115882-150115904 TGACAGCCCCCTGGAGCCCCAGG - Exonic
999980258 5:156951238-156951260 AGACAGCCACCTGCAAGCCAAGG + Intronic
1000690078 5:164306690-164306712 AGACAGCCACCTGCAAGCCAAGG + Intergenic
1001368803 5:171174954-171174976 CTTCACCCCCCTACAGGCCCTGG + Intronic
1001601428 5:172931418-172931440 CCAGAGCCCCGTGCAGGGCCTGG - Intronic
1001853146 5:174986942-174986964 GGACAGCCACCTGCAAGCCAAGG + Intergenic
1002001587 5:176199346-176199368 CGACCGCCCCATGCCTGCCCGGG + Intergenic
1002133706 5:177095979-177096001 CACCACCCCCCAGCAGGCCCGGG - Intronic
1002252753 5:177939634-177939656 CGACCGCCCCATGCCTGCCCGGG - Intergenic
1004203920 6:13574413-13574435 CGCGAGCCCGCGGCAGGCCCTGG - Intergenic
1004354914 6:14922493-14922515 CGATAGCTTCCTGCAGTCCCCGG - Intergenic
1005834079 6:29694758-29694780 TCACAGCCTCCTGCAGGGCCAGG + Intergenic
1006149775 6:31980718-31980740 CGACAGGCGCCCGCCGGCCCAGG - Exonic
1006156076 6:32013456-32013478 CGACAGGCACCCGCCGGCCCAGG - Intergenic
1006308504 6:33240223-33240245 TGTCAGCTCCCTGCAGGCTCTGG + Intergenic
1007682635 6:43645107-43645129 CGACAGCCTCCTGCTGTCTCTGG + Exonic
1007831682 6:44643643-44643665 CCAAAGCCCCCTGGAGGCTCTGG + Intergenic
1008089111 6:47275491-47275513 CGCCACCCCCCAACAGGCCCCGG - Intronic
1008131201 6:47721509-47721531 CTACAGCCCCCAGCTGGCCAGGG - Exonic
1010038588 6:71355500-71355522 CCCCAGCCCCCAACAGGCCCCGG + Intergenic
1011222703 6:85072194-85072216 CCACACCCCCCGACAGGCCCCGG - Intergenic
1012701413 6:102461460-102461482 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1013391499 6:109690511-109690533 CGACAGCCCCGCGGAGTCCCTGG - Intronic
1013973316 6:116046618-116046640 CCCTACCCCCCTGCAGGCCCTGG - Intronic
1013991488 6:116258779-116258801 CGAGAACCCTCTGCAGGTCCTGG - Intronic
1014513816 6:122357503-122357525 CCTCAGCCCCCGACAGGCCCTGG - Intergenic
1015961161 6:138650467-138650489 TGACAGCCTCCACCAGGCCCTGG - Intronic
1015965384 6:138692392-138692414 CGCCCGCCCCCTGGCGGCCCTGG - Intronic
1016781652 6:147965774-147965796 CCCCAGCCCCCTACAGGCCCTGG - Intergenic
1016782001 6:147969104-147969126 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
1018056044 6:160053257-160053279 CCCCAGCCCCCAACAGGCCCTGG - Intronic
1018167021 6:161107848-161107870 AGACAGCCCCCTGCAGTGGCTGG + Intronic
1018488055 6:164262567-164262589 CCACACCCGCATGCAGGCCCTGG - Intergenic
1018937541 6:168283578-168283600 AGACAGGCCCATGCAGTCCCGGG + Intergenic
1018941038 6:168308910-168308932 CCCCAGCCCCCTGCACGCCGTGG - Exonic
1019429225 7:991035-991057 CGAGGGTCCCCTGCAGGGCCGGG - Intergenic
1019656716 7:2199936-2199958 GGAGAGCCCCCTGCAGTCACTGG + Intronic
1020096229 7:5371004-5371026 CCACAACCCCCTGCAGGGCTGGG + Exonic
1020192168 7:6008865-6008887 AGGCAGCCCCCTGGAGGCCCCGG - Intronic
1021171686 7:17405083-17405105 CCCCAGCCCCCGACAGGCCCCGG - Intergenic
1021311803 7:19106496-19106518 CGAAAGCTCCCTGCAGGCTCAGG - Intronic
1021804814 7:24344385-24344407 AAACAGCCACCTGCAGGCCAAGG - Intergenic
1022104584 7:27188989-27189011 AGGCAGCCCTCTGCAGGGCCGGG + Intergenic
1023929419 7:44696255-44696277 GCAAAGCCCCCTGCAGACCCTGG + Intronic
1023970228 7:44985570-44985592 CCACAGCCCCCAGCAGGGACTGG - Intergenic
1024542716 7:50492089-50492111 AGACAGCCATCTGCAAGCCCAGG + Intronic
1024759823 7:52582383-52582405 CCCCACCCCCCTACAGGCCCCGG - Intergenic
1024763498 7:52629093-52629115 TGGCAGCCCCCTGCAGGCATAGG - Intergenic
1025287473 7:57676718-57676740 CCACACCCCCCGACAGGCCCTGG - Intergenic
1026522949 7:71132295-71132317 CGACGGCCGCCTGCGGGCCAAGG + Exonic
1027151995 7:75739394-75739416 GGATAGCCCCCTGCAGGAGCGGG - Intergenic
1027817325 7:82992579-82992601 CCACACCCCCCGACAGGCCCTGG - Intronic
1027827213 7:83131306-83131328 CAACGGCTGCCTGCAGGCCCTGG - Intronic
1027938262 7:84637106-84637128 AGAAAGCCACCTGGAGGCCCAGG - Intergenic
1027973781 7:85122074-85122096 CCCCAGCCCCCAACAGGCCCTGG - Intronic
1028582794 7:92424536-92424558 GGACACCCCACTGCTGGCCCGGG + Intergenic
1028657939 7:93232310-93232332 CTACAGTTCCCAGCAGGCCCAGG + Intergenic
1029021377 7:97368182-97368204 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1029045290 7:97621437-97621459 CTACAGCTTCCTGCAGGACCAGG - Intergenic
1029608480 7:101614179-101614201 GGGCAGGCCCTTGCAGGCCCAGG - Intronic
1029843518 7:103390242-103390264 TGACAGCTGCCTGCAGGACCTGG - Intronic
1029899243 7:104022243-104022265 CGCCAGCCCCTTGCAGCCTCAGG + Intergenic
1031172859 7:118313450-118313472 CCTCAACCCCCTACAGGCCCTGG + Intergenic
1031574986 7:123404380-123404402 CCACACCCCCTGGCAGGCCCCGG - Intergenic
1032537527 7:132677403-132677425 CCTCAGTCCCCTGCAGGCCGAGG - Intronic
1032717308 7:134520609-134520631 CCCCAGCCCCCAGCAGGCCCCGG - Intergenic
1032956573 7:136978605-136978627 CCACACCCCCCGACAGGCCCCGG + Intronic
1033762078 7:144446566-144446588 CACCAACCCCCAGCAGGCCCTGG - Intergenic
1034288547 7:149908159-149908181 AGGCAGCCCTCTGCAGGCCGTGG + Intergenic
1034338974 7:150340507-150340529 CCAGGGCCACCTGCAGGCCCCGG + Exonic
1034662526 7:152784708-152784730 AGGCAGCCCTCTGCAGGCCGTGG - Intronic
1034763287 7:153693943-153693965 CGACAGCCCCTGGCAAACCCTGG + Intergenic
1035167570 7:157000534-157000556 CGGCAGCCCCCTCCAAGCCTGGG + Intronic
1036621221 8:10425416-10425438 TCGCAGCCACCTGCAGGCCCAGG - Intronic
1037966114 8:23135193-23135215 CCACAGCTCCCAGGAGGCCCAGG - Intergenic
1038101429 8:24381306-24381328 CCCCACCCCCCAGCAGGCCCCGG + Intergenic
1038452987 8:27651648-27651670 AGACACCCCCCTGCAGCCCGGGG - Intronic
1038997821 8:32945433-32945455 TGACACCCACCTGCAGGCCTGGG - Intergenic
1039648111 8:39309104-39309126 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1041739591 8:61144204-61144226 CTCCAGCCCCCAACAGGCCCCGG + Intronic
1042116101 8:65433170-65433192 CCCCACCCCCCAGCAGGCCCCGG + Intergenic
1043443957 8:80301181-80301203 CGACAACCCTCTGCAGGTCCTGG + Intergenic
1043982482 8:86658067-86658089 CCATGGCCCCCTGCAGGGCCGGG + Intronic
1044628658 8:94258524-94258546 TCATAGCCCCCTGCAGCCCCAGG - Intronic
1045018866 8:98024027-98024049 CGACTACCCCCAACAGGCCCCGG - Intronic
1046433377 8:114156339-114156361 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1047178515 8:122565358-122565380 CCCCAGCCCCCAACAGGCCCCGG - Intergenic
1047435841 8:124834917-124834939 CCCCAGCCCCCTCCAGGCCTTGG + Intergenic
1047625292 8:126649911-126649933 CTACAGCCCCCTGGAAGCCCTGG - Intergenic
1047956804 8:129982857-129982879 TGACAGCCAGCTGCAGGCCTGGG - Intronic
1048282192 8:133113854-133113876 CGACAGCTCCCTCATGGCCCAGG - Intronic
1048833714 8:138498596-138498618 CCACAGCACCCAGCAAGCCCAGG + Intergenic
1048930846 8:139314551-139314573 CGGCAGCCCCATGCTGGCCAGGG - Intergenic
1049641062 8:143716259-143716281 CCCCCGCCCCCGGCAGGCCCCGG - Exonic
1049776181 8:144406416-144406438 GGACAGGGCCCTGGAGGCCCAGG - Intronic
1049883135 9:11393-11415 CCACCGCCCCCTGCTGGCGCCGG + Intergenic
1050308274 9:4327939-4327961 CGAGAGCCTTCTGAAGGCCCAGG - Intronic
1050963929 9:11772180-11772202 CCCCACCCCCCTACAGGCCCCGG - Intergenic
1052539801 9:29795835-29795857 CCCCACCCCCCAGCAGGCCCCGG + Intergenic
1053021982 9:34701438-34701460 GGGGCGCCCCCTGCAGGCCCAGG - Intergenic
1053350717 9:37411745-37411767 GGATGGCTCCCTGCAGGCCCAGG - Intergenic
1053485538 9:38452358-38452380 CAACAGCTCCCTGCAGTCCAAGG + Intergenic
1055620419 9:78119661-78119683 AGAGAGCCTCCTGGAGGCCCTGG - Intergenic
1057054186 9:91949093-91949115 CGCCAGCCTCCTACAGGTCCCGG + Intronic
1057083632 9:92189861-92189883 CGCCAGCCCCTCGCAGGCTCCGG - Intergenic
1058082506 9:100714792-100714814 CTACTGCCCCCTGCTGGCCTAGG - Intergenic
1058720548 9:107760028-107760050 CGACAGTGCCCTGCAGGTACAGG + Intergenic
1059382186 9:113935110-113935132 CGGCAGCCCCATGCCAGCCCAGG - Intronic
1060153031 9:121300706-121300728 CAACAGCCTCCTGCAGACCCTGG + Intronic
1060812075 9:126615619-126615641 GGTCAGCCCCCTGCCGGGCCCGG + Intronic
1060948654 9:127586576-127586598 CAACAGTCCACTGCAGGTCCAGG - Intergenic
1061062557 9:128257991-128258013 CCATGGCCCCCTGCAGGGCCCGG + Exonic
1061604275 9:131697153-131697175 CAGCAGCCCTCTGCTGGCCCAGG + Intronic
1061931532 9:133835542-133835564 AAACAGCCCCCTGTAGCCCCAGG + Intronic
1062026579 9:134343415-134343437 CGTCAGCATCCTGCAGCCCCTGG + Intronic
1062027304 9:134346516-134346538 CGAGAGCCCCCAACACGCCCGGG - Intronic
1062219871 9:135409432-135409454 CGAGAGCCCTCGGCAGGCACTGG - Intergenic
1062266529 9:135688990-135689012 GGAGAGCATCCTGCAGGCCCAGG + Intergenic
1062481274 9:136753694-136753716 CGCCAGCCCCCAGCACGGCCGGG - Intergenic
1062729909 9:138103056-138103078 TGAGAGCCCCCTGGAGGCTCAGG + Intronic
1185482192 X:455169-455191 CCACAGCCCTCGACAGGCCCGGG - Intergenic
1185491527 X:520985-521007 CCCCAGCCCCCGACAGGCCCTGG - Intergenic
1185657860 X:1700584-1700606 CCCCAGCCCCCAACAGGCCCCGG + Intergenic
1185677957 X:1864020-1864042 CCCCAGCCCCCAACAGGCCCAGG + Intergenic
1185679909 X:1880016-1880038 CCCCACCCCCCGGCAGGCCCTGG - Intergenic
1185695451 X:2190886-2190908 CCCCAACCCCCAGCAGGCCCCGG - Intergenic
1185835435 X:3342227-3342249 CCCCACCCCCCAGCAGGCCCTGG - Intronic
1185963906 X:4577956-4577978 TGCCATCCCCCTACAGGCCCTGG + Intergenic
1186950707 X:14621517-14621539 CCCCAGCCCCCGACAGGCCCCGG + Intronic
1188896909 X:35680183-35680205 CTCCAACCCCCGGCAGGCCCCGG + Intergenic
1189230016 X:39444877-39444899 CCTCATCCCCCAGCAGGCCCAGG - Intergenic
1189787154 X:44569351-44569373 AGACAGCTCCCTACAGGCCCAGG + Intergenic
1189925227 X:45946384-45946406 CCCCAGCCCCCAACAGGCCCTGG + Intergenic
1190373893 X:49769828-49769850 CTCCATCCCCCTACAGGCCCTGG + Intergenic
1190493702 X:51007135-51007157 CCTCACCCCCCAGCAGGCCCTGG + Intergenic
1191632490 X:63337207-63337229 CCACACCCCCCAACAGGCCCTGG - Intergenic
1191677175 X:63803737-63803759 CCCCAACCCCCAGCAGGCCCCGG - Intergenic
1191738263 X:64410110-64410132 CCCCAGCCCCCGACAGGCCCCGG - Intergenic
1191822212 X:65323347-65323369 CCACATCCCCCGACAGGCCCTGG + Intergenic
1191966206 X:66761209-66761231 CCACAACCCCCAACAGGCCCCGG + Intergenic
1192245888 X:69371289-69371311 TTACAGCCCTATGCAGGCCCTGG - Intergenic
1192525260 X:71837409-71837431 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1192889518 X:75374218-75374240 CTCCAGCCCCCGACAGGCCCCGG - Intronic
1193120892 X:77821997-77822019 CCTCACCCCCCAGCAGGCCCCGG + Intergenic
1193265805 X:79467869-79467891 CGCCAACCCCCAACAGGCCCTGG - Intergenic
1195897587 X:109762755-109762777 CCCCAGCCCCCAACAGGCCCTGG - Intergenic
1196251745 X:113468852-113468874 CGCCACCCCCCGACAGGCCCCGG - Intergenic
1196635653 X:117999530-117999552 CCCCACCCCCCAGCAGGCCCTGG - Intronic
1200279017 X:154761339-154761361 CCTCAGCCCACTGCATGCCCAGG + Intergenic
1200569916 Y:4815586-4815608 CTACACCCCACTACAGGCCCTGG - Intergenic
1201986448 Y:19973718-19973740 TCCCAGCCCCCAGCAGGCCCTGG - Intergenic