ID: 1152438017

View in Genome Browser
Species Human (GRCh38)
Location 17:80288069-80288091
Sequence CCCCCTGCAGGCCCAGGCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 8, 3: 64, 4: 485}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152438011_1152438017 -3 Left 1152438011 17:80288049-80288071 CCCACCGAGGTTGGCGACAGCCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485
1152438013_1152438017 -7 Left 1152438013 17:80288053-80288075 CCGAGGTTGGCGACAGCCCCCTG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485
1152438008_1152438017 7 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485
1152438006_1152438017 24 Left 1152438006 17:80288022-80288044 CCACTGGAGGGTGACGGCCTCTC 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485
1152438012_1152438017 -4 Left 1152438012 17:80288050-80288072 CCACCGAGGTTGGCGACAGCCCC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485
1152438010_1152438017 2 Left 1152438010 17:80288044-80288066 CCGCGCCCACCGAGGTTGGCGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485
1152438005_1152438017 29 Left 1152438005 17:80288017-80288039 CCACGCCACTGGAGGGTGACGGC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 64
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152438017 Original CRISPR CCCCCTGCAGGCCCAGGCTT TGG Exonic
900409087 1:2504793-2504815 CTCCCGGGAGGCCCAGGCTGTGG - Exonic
900624647 1:3602659-3602681 CCTCCTGCACCCCCAGCCTTGGG + Intronic
900764425 1:4494511-4494533 CCCCCTGCAGCCCCTGGATGGGG + Intergenic
901667588 1:10835413-10835435 CCCCCGGCAGGCCCAGCCCAGGG - Intergenic
902383939 1:16065704-16065726 TACCCTGCAGGACCAGGCTGAGG + Intronic
902821976 1:18949029-18949051 CACCCTGCACTGCCAGGCTTGGG + Intronic
902920677 1:19664788-19664810 CCTCCTGCAGGGCCAGGGCTCGG + Intergenic
903130990 1:21279404-21279426 TCCGCTGCAGGCCCAGGCCCTGG + Intronic
903261804 1:22135682-22135704 ACCCCTGGAGGGGCAGGCTTTGG + Intronic
903621218 1:24699863-24699885 CTGCCTCCAGGCCCAGGCTCAGG + Intergenic
903815452 1:26061120-26061142 TGCCCAGCAGGCCCAGGCTGGGG + Intronic
903886930 1:26546134-26546156 CACCCTGCAGGGCCAGGCCTGGG - Intronic
904035169 1:27555146-27555168 GCTCCCCCAGGCCCAGGCTTTGG - Intronic
904045495 1:27605928-27605950 ATCACTTCAGGCCCAGGCTTTGG - Intergenic
904468858 1:30723617-30723639 CCCACTGCCCGCCCAGCCTTTGG + Intergenic
904795814 1:33055592-33055614 CCCTCTGCAGCCCCAGCCTGGGG + Intronic
905775649 1:40665682-40665704 CCTCCCGCCGGCCCAAGCTTGGG - Intergenic
905792924 1:40799713-40799735 CCTCGTGGAGGCCAAGGCTTGGG - Intronic
906684567 1:47755288-47755310 CACCCTGCAGGCTCAGGTTTGGG + Intergenic
907158663 1:52356071-52356093 CCCACAGCGGGGCCAGGCTTGGG + Intronic
907271936 1:53296407-53296429 CCCTGTGCTGGCCCAGGCCTGGG - Intronic
907545989 1:55260475-55260497 CTCCCAGCAGGCCAAGGCTGTGG - Intergenic
908227040 1:62066759-62066781 CTCCCTGAAGGCTCAGACTTTGG + Intronic
912394299 1:109328885-109328907 GCCCCTGCAGGCTCAGGGTAGGG + Intronic
913319411 1:117577929-117577951 GCCCCTCCAGGCCCATGGTTTGG + Intergenic
913968374 1:143395217-143395239 CTCCCTTCAGGGCCAAGCTTAGG - Intergenic
914062752 1:144220813-144220835 CTCCCTTCAGGGCCAAGCTTAGG - Intergenic
914116398 1:144745541-144745563 CTCCCTTCAGGGCCAAGCTTAGG + Intergenic
914250655 1:145918963-145918985 GCCCCTGCAGGCCCCGCCCTTGG - Intergenic
915096527 1:153466506-153466528 CTCCCTGGAGGCCCAGCCTGGGG - Intergenic
915164159 1:153939355-153939377 CCCTCTGGAGCCCCAGGCTTGGG - Intronic
915458962 1:156058305-156058327 CCCTCTGCAGGCCCAGGCTTTGG + Exonic
915953079 1:160203014-160203036 CCTCCAGCAGGCCCAGGTCTGGG - Intergenic
916725314 1:167517737-167517759 CACCCGGCAGTCCCAGGCGTGGG + Intronic
918181407 1:182088168-182088190 CCTCCTGCAGCCCCAGGCACAGG - Intergenic
919031784 1:192251794-192251816 CCCCCTGTGGGCTCAGGCTCAGG + Intergenic
919169402 1:193935026-193935048 CCCCCATCCGGCCCTGGCTTAGG - Intergenic
919762986 1:201110110-201110132 GAGCCTGCAGCCCCAGGCTTGGG - Intronic
919880039 1:201895178-201895200 CACCCTGCATGGCCAGGCTGGGG - Intergenic
920123413 1:203675454-203675476 CCCCCTCCAGGCCCTGGATGAGG + Intronic
921945040 1:220880292-220880314 CGCCCTGCAGCCCCCGGCCTCGG + Exonic
923199201 1:231695054-231695076 TCCTCTGCAGGCCCCGGCTTAGG + Intronic
923226745 1:231944683-231944705 CCCCCTGCACCCTCAGGCCTAGG + Intronic
923544348 1:234913436-234913458 CTCCCTGGAGACCCATGCTTTGG + Intergenic
923569371 1:235100342-235100364 GCCGCTGCAGGCCTGGGCTTGGG - Intergenic
924039730 1:239972606-239972628 CGCCCTGCAAGCCCAGGCCATGG - Intergenic
924824007 1:247521505-247521527 CCCCCTGCAATCCCAGGCACTGG - Intronic
1063097378 10:2920394-2920416 CGCCCTGCAGGCCAATGTTTAGG + Intergenic
1063351076 10:5355557-5355579 CCCGTGGCAGGCCTAGGCTTTGG + Intergenic
1065770267 10:29071654-29071676 CCCATTGCAGGCAGAGGCTTGGG - Intergenic
1065964447 10:30759687-30759709 CCTCCTGTAGGCCCAAGTTTTGG + Intergenic
1066441529 10:35444200-35444222 CCTCCTGCAGGCCCTGCCTGAGG + Intronic
1067043477 10:42970774-42970796 GCCTCTGCCGGCCCAGGCCTGGG - Intergenic
1067228094 10:44388224-44388246 CCTCTTGCAGGCCCAGCCGTTGG - Intergenic
1068211355 10:53924411-53924433 CTCCCTGCGGGGCAAGGCTTGGG + Intronic
1068838801 10:61587317-61587339 CCCCTTGCAGGACCAGGCAGAGG + Intergenic
1069553865 10:69383823-69383845 CCTCCTGGAAGCCCAGGCTGGGG + Intronic
1069843160 10:71352648-71352670 CCCCCAGCACCCCCAAGCTTTGG + Intronic
1070650412 10:78231402-78231424 CTCCCTGCAGGATCAGGCCTTGG + Intergenic
1070669571 10:78368528-78368550 ACTCCTGGAGGCCCAGGCATGGG + Intergenic
1070801643 10:79247482-79247504 CCCCCTGCCTGGCCAGGCTCAGG + Intronic
1070914659 10:80145112-80145134 CCCCCTCCAGGCTCAGACCTGGG + Exonic
1071504049 10:86222297-86222319 GCACCTGGAAGCCCAGGCTTGGG - Intronic
1071559277 10:86632554-86632576 ACCCCTGCAGGGCCAGCCTCAGG + Intergenic
1071569568 10:86689517-86689539 CATGCTGCAGGCCCAGGCTGGGG + Intronic
1072252908 10:93595764-93595786 CCCCCTGCAGAGCCTGGGTTTGG - Intronic
1072628342 10:97128647-97128669 ACCACTGCCAGCCCAGGCTTTGG - Intronic
1072725664 10:97811760-97811782 CCCGCTGCAGGTGCAGGCTCAGG + Intergenic
1073072900 10:100806071-100806093 CCCCAGGCTGGCCCTGGCTTGGG + Intronic
1073097107 10:100986699-100986721 CCAACTGCAGCCCCAGGCTTTGG - Intronic
1073331017 10:102669831-102669853 CCCCCTGGAGGCACAGCCCTAGG - Intergenic
1073510167 10:104037884-104037906 CTCCCTCCTGGCCCAGCCTTGGG - Intronic
1073866377 10:107809130-107809152 CTCCCTGCATTCCTAGGCTTTGG - Intergenic
1074317867 10:112375618-112375640 CCCCCTGTAGCCACAGCCTTAGG + Intronic
1075080794 10:119382181-119382203 CCCTCTGCAGGCTCTGCCTTGGG + Intronic
1075419013 10:122287065-122287087 CTCCCTCCAGGCTCAGGCTCAGG - Intronic
1076481265 10:130786634-130786656 GCCCCTGCAGGCCGAGGGCTGGG + Intergenic
1076526947 10:131117942-131117964 CCCCAGGCAGGGCCAGGGTTGGG - Intronic
1076691343 10:132225203-132225225 CCCCCTGCAGCCCCTGGGCTTGG - Intronic
1076729724 10:132432278-132432300 CGCCCTGCAGGCCCAGGGGAGGG + Intergenic
1076944644 10:133637798-133637820 CCACCTGCAGGCCCCGGCGCTGG + Intergenic
1076988587 11:257248-257270 CCCCCAGCCAGCCCAGCCTTGGG + Intergenic
1077044444 11:538176-538198 CCCCTTGCACCCCCAGGCCTTGG + Intronic
1077138766 11:1014367-1014389 CCCCCTGCAGGTCCTGGGTCTGG - Intronic
1077168894 11:1157732-1157754 ACCCCTGCAGGCCAGGGCTTGGG + Intergenic
1077362452 11:2146733-2146755 CTCCCTGCAGGCCCTGTCGTGGG + Exonic
1077378113 11:2215128-2215150 CCACCTGCCTCCCCAGGCTTTGG + Intergenic
1077596301 11:3534596-3534618 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1078106284 11:8360017-8360039 AGCCCTGGAGGCCAAGGCTTGGG - Intergenic
1079205637 11:18412243-18412265 CCCCCCGCCGGCCCAGGCGCGGG - Intergenic
1080055301 11:27900631-27900653 CCCCCTGCAGACCAAGTCTCAGG - Intergenic
1081616596 11:44594968-44594990 CCCACCGCCAGCCCAGGCTTTGG - Intronic
1082004445 11:47412004-47412026 GCACGTGTAGGCCCAGGCTTCGG - Exonic
1083226042 11:61285528-61285550 CCCACTGCTGGCCCAGGCTCTGG - Intronic
1083479372 11:62933854-62933876 TCCCCTGCAGGGCCAGGTGTGGG + Intergenic
1083592765 11:63904975-63904997 CCCCCCGCCGGCCCTGGCTGTGG - Exonic
1083603001 11:63960700-63960722 TCCACAGCAGGGCCAGGCTTGGG - Intergenic
1083621193 11:64050200-64050222 CTCCCTGCATCCCCAGGCTGGGG - Intronic
1083625072 11:64068242-64068264 ACCCCTTCAGTCCCAGGCATTGG + Intronic
1083731936 11:64656996-64657018 CCCTCTTCAGGCCCAGCCTGGGG + Intronic
1083799352 11:65037585-65037607 CACACTGCAGTTCCAGGCTTTGG - Intronic
1084043746 11:66557291-66557313 GGCTCTGCAGGCCCACGCTTGGG - Intronic
1084252209 11:67908573-67908595 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1084820640 11:71687460-71687482 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1084954273 11:72683191-72683213 CCCTCTGCAGGTCCAGGTCTGGG + Intergenic
1085022490 11:73218269-73218291 CCCCCTGCCTGGCCCGGCTTCGG + Intergenic
1085043564 11:73340858-73340880 CCCCCTGCATGCCCAGCCCTGGG + Intronic
1085401517 11:76238711-76238733 GCCCCAGCAGGCCCAGGCCGGGG + Intergenic
1085861796 11:80244080-80244102 CCCCCTGCAGCCTCAGGACTTGG + Intergenic
1089099792 11:115952713-115952735 GCCCCAGCAGCCCCAGGCTGTGG - Intergenic
1089366412 11:117923576-117923598 CACACTGCAAGCCCAGGCTCTGG - Intronic
1089660264 11:119981096-119981118 CCACCTGGAAACCCAGGCTTGGG - Intergenic
1089764570 11:120753255-120753277 TCAACTGCTGGCCCAGGCTTTGG - Intronic
1090413918 11:126527838-126527860 CTCCCTCCAAGGCCAGGCTTGGG - Intronic
1090705438 11:129332115-129332137 CACCATGCAGGCCCAGGCCTTGG + Intergenic
1091587186 12:1822951-1822973 GCCCCTGCAGGCCCAGGGTGTGG + Intronic
1091649849 12:2301809-2301831 ACCACTGCAGGGCCAGGCTGGGG - Intronic
1091774409 12:3175101-3175123 ACCCCTGCAGGGCGAGGCTGGGG + Intronic
1092422476 12:8343367-8343389 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1094722073 12:33075531-33075553 CTCCCTGCAGGGCAGGGCTTGGG + Intergenic
1096292106 12:50351890-50351912 CCCTCAGCAGGCCCAGGCACTGG - Exonic
1096292114 12:50351926-50351948 CCCTCAGCAGGCGCAGGCTCAGG - Exonic
1096292124 12:50351962-50351984 CCCTCAGCAGGCCCAGGCTCTGG - Exonic
1096292134 12:50351998-50352020 CCCTCAGCAGGCGCAGGCTCAGG - Exonic
1096292168 12:50352106-50352128 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292213 12:50352250-50352272 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292236 12:50352322-50352344 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292260 12:50352394-50352416 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292289 12:50352502-50352524 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292295 12:50352538-50352560 CCCTCAGCAGGCACAGGCTCAGG - Exonic
1096292323 12:50352646-50352668 CCCTCAGCAGGCTCAGGCCTTGG - Exonic
1096292360 12:50352790-50352812 CCCTCAGCAGGCCCAGGCCTTGG - Exonic
1096292457 12:50353150-50353172 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292502 12:50353294-50353316 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292551 12:50353474-50353496 CCCTCAGCAGGCCCAGGCCCTGG - Exonic
1096292571 12:50353546-50353568 TCCTCAGCAGGCCCAGGCTCAGG - Exonic
1096500841 12:52063123-52063145 GCCCCTGGAGGCCCTGGCCTTGG + Intergenic
1096769575 12:53926329-53926351 CCAGCTGCAGGCCCAGGATTTGG + Intergenic
1097712926 12:62934874-62934896 CCCCCTGCAGCACTAGGCTCTGG - Exonic
1099842692 12:87985902-87985924 CCCGCAGCAGGCCCACGCATGGG - Exonic
1100482044 12:94988601-94988623 CACGCTGCTGGCCCAAGCTTGGG - Intronic
1101654057 12:106704554-106704576 CCCTGGGCAGGCCCAGGCTGAGG + Intronic
1102043292 12:109814609-109814631 CGCCCTGCTGGCCCAGGCGATGG - Exonic
1102223514 12:111211268-111211290 CCCACTGCAAGCCCAGCCCTTGG - Intronic
1102587273 12:113932299-113932321 CTCGCTGCAGGCCCAGGCTCAGG - Intronic
1102599397 12:114017759-114017781 CACCCTGCAGGATCAGGCTCAGG + Intergenic
1102817495 12:115879584-115879606 CCCCAGGCAGGCCCAGGCCCCGG - Intergenic
1102952189 12:117038269-117038291 CCCGCAGCAGGCACAGGCTCGGG + Intergenic
1103249266 12:119485995-119486017 GCCCCTGCAGGCCTGGGCTTTGG - Intronic
1103459186 12:121090141-121090163 CCCTCTGCAGGCCCAGCCTGGGG + Intergenic
1103568745 12:121830391-121830413 CCCCCTGGAGCCCCTGGCTCCGG + Exonic
1104390464 12:128387368-128387390 CCACCTGGAGCACCAGGCTTGGG + Intronic
1105356523 13:19664420-19664442 CCCCCTTCATGCCAAGCCTTAGG + Intronic
1113681500 13:112248015-112248037 GTCCCTGCTGGCCCAGGCTCAGG + Intergenic
1113893809 13:113750271-113750293 AGCCCTGCATACCCAGGCTTGGG + Intergenic
1113962412 13:114133096-114133118 CCCCCTGCAGACCCCAGCATGGG + Intergenic
1113962432 13:114133139-114133161 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962451 13:114133181-114133203 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962469 13:114133222-114133244 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962486 13:114133260-114133282 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962504 13:114133299-114133321 CCCCCTGCAGACCCCGGCACGGG + Intergenic
1113962521 13:114133338-114133360 CCCCCTGCAGACCCCGGCACCGG + Intergenic
1113962569 13:114133460-114133482 CCCCCTGCAGACCCCAGCATGGG + Intergenic
1113962586 13:114133498-114133520 TCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962604 13:114133537-114133559 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962623 13:114133578-114133600 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962640 13:114133617-114133639 TCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962691 13:114133736-114133758 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962725 13:114133816-114133838 CCCCCTGCAGACCCCGGCATGGG + Intergenic
1113962742 13:114133855-114133877 CCCCCTGCAGACCCCAGCATGGG + Intergenic
1118947108 14:70398634-70398656 CCCCCTGCACCCACAGGCTCAGG - Intronic
1119546766 14:75477721-75477743 CCTGCTGCAGGCCCAAGCTAGGG - Intergenic
1120716291 14:87844469-87844491 ACCCCTGCCAGCCCAGGGTTAGG - Intronic
1121242392 14:92440138-92440160 CCCCCTGCTGGGCCCAGCTTGGG + Intronic
1121412895 14:93760110-93760132 CCCCCTGGCAGCCCAGGCTGTGG - Intronic
1121719446 14:96098902-96098924 CTCCCTGCAGGACCAAGCTGAGG + Intergenic
1122788823 14:104175971-104175993 CTCCCTGCGGGCCCTGGCCTCGG + Exonic
1122895691 14:104755722-104755744 GCCCCTGTAGGGCCAGGCTTTGG - Exonic
1122924786 14:104894599-104894621 TCCCTTGCTGCCCCAGGCTTGGG - Intronic
1122998787 14:105280775-105280797 CCACCTGCACACCCAGGCTCAGG - Intronic
1123044177 14:105503336-105503358 CACTGTGCAGGCCCAGGCTCAGG - Intergenic
1123077146 14:105673016-105673038 ACCGCTGCAGGCCGAGGCTGAGG + Intergenic
1123113394 14:105883190-105883212 CCCCTGGCAGGCCCAGCCTTTGG + Intergenic
1202926602 14_KI270724v1_random:31456-31478 CCACCTGCAGGCCCCGGCGCTGG - Intergenic
1123500503 15:20877571-20877593 CCCCCTCCCTGCCCAGGCCTGGG - Intergenic
1123504747 15:20929787-20929809 CCCCATGCAGGACTAGGATTAGG - Intergenic
1123557748 15:21451264-21451286 CCCCCTCCCTGCCCAGGCCTGGG - Intergenic
1123561994 15:21503488-21503510 CCCCATGCAGGACTAGGATTAGG - Intergenic
1123593975 15:21888545-21888567 CCCCCTCCCTGCCCAGGCCTGGG - Intergenic
1123598238 15:21940769-21940791 CCCCATGCAGGACTAGGATTAGG - Intergenic
1123783034 15:23645729-23645751 CCCCCAGCAGGCCCAGGCATCGG - Exonic
1124093545 15:26628592-26628614 GCCCCTGGAGGGCCAGTCTTGGG + Intronic
1124190042 15:27566615-27566637 CCCACTGCGGGACCAGGCATGGG - Intergenic
1124270148 15:28272940-28272962 CCCCCTGCAGGACCAGCACTTGG - Exonic
1124646824 15:31442816-31442838 CCCCCTGCAGGCACAGGGTGGGG - Intergenic
1125581501 15:40789071-40789093 CCACCAGCAGGCCCATGTTTTGG - Intronic
1126759148 15:51953492-51953514 ACCCCTGTAGTCCCAGCCTTCGG + Intronic
1126943796 15:53794776-53794798 AACCCTGGAGGCTCAGGCTTTGG + Intergenic
1127339072 15:58022001-58022023 CCACCTGCCGGTCCAGGCTGTGG + Intronic
1127567323 15:60204406-60204428 CACCATGCTGGCTCAGGCTTAGG - Intergenic
1127812911 15:62580062-62580084 CCCACTGCAGGCCAGGGCCTGGG - Intronic
1128336240 15:66787401-66787423 CCACCTTCAGGCCCAGGCTCTGG + Intergenic
1128455278 15:67828270-67828292 CTCTCCGCAGGCCCAGCCTTGGG + Intronic
1128999880 15:72323213-72323235 GCGCCTGTAGTCCCAGGCTTGGG - Intronic
1129363934 15:75042989-75043011 CCCTCTGCAGGCCAAGGCGCTGG - Intronic
1129702392 15:77775313-77775335 CCCACTGCAGGCCCAAGTTTGGG + Intronic
1130146014 15:81274051-81274073 CCCACTGCAGGCCAAGGACTGGG + Intronic
1130993163 15:88888874-88888896 CCCCCAGCACCCCCAGGCTTGGG - Intronic
1131021592 15:89103823-89103845 CTCCCTGGAGGCCCAGTGTTGGG + Intronic
1132105421 15:99059362-99059384 CACCCTGCAGCCCCAGGCGCGGG + Intergenic
1132241874 15:100264241-100264263 CCCCCTCCTCCCCCAGGCTTGGG - Intronic
1202970339 15_KI270727v1_random:230614-230636 CCCCATGCAGGACTAGGATTAGG - Intergenic
1132625172 16:888144-888166 CCCCCTGCACCCCAAGGCTTGGG - Intronic
1132669102 16:1095426-1095448 GCCCCTGCAGGCCCTGCCCTGGG - Intronic
1132892423 16:2210781-2210803 ACCCCTGTAGGCCCAGGTTTGGG + Exonic
1133375805 16:5286234-5286256 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1133413752 16:5589850-5589872 CCCTCTGCAGGCCAAGGCAGTGG - Intergenic
1133867095 16:9654536-9654558 CCCCCTCCAGGCCCAAGCTTTGG - Intergenic
1134068569 16:11246265-11246287 CCCCCAGCATGCCCAGCCCTGGG - Intergenic
1136092218 16:27928686-27928708 CGCCAAGCAGGCCCAGGCCTCGG + Intronic
1136669204 16:31840217-31840239 ACCCCTGCAGACACAGGCTCCGG + Intergenic
1137253662 16:46758099-46758121 TGCACTGCAGCCCCAGGCTTTGG - Intronic
1137766973 16:50985245-50985267 AGCCCTGGAGGCCCAGGCTGGGG + Intergenic
1138268633 16:55678853-55678875 CCCCCAGCAGGCCCAAACCTTGG - Intronic
1138519919 16:57565141-57565163 CCCCCAGCAGTACCAGGCTTTGG - Exonic
1138552576 16:57755543-57755565 CCACCTGCCTGCCCGGGCTTGGG + Intronic
1138584442 16:57960903-57960925 CCCTCTGCAGGCCTGGGCTGCGG - Exonic
1139310352 16:66023339-66023361 CCACCTCCCAGCCCAGGCTTTGG + Intergenic
1139469264 16:67169689-67169711 CCCCAGGCAGGCCCAGGGCTGGG - Exonic
1139675744 16:68522270-68522292 CCCCTGGCAGGCCCAGCCTCAGG + Intergenic
1140469755 16:75207352-75207374 TCTCCTCCAGGCCCAGGCTTGGG + Intergenic
1140910122 16:79443450-79443472 CCCCCAGGAAGCCCAGGCTTGGG - Intergenic
1141443280 16:84042853-84042875 CCCCCTGCAGGCCCGGCCCCGGG + Intergenic
1142199038 16:88752561-88752583 CCCCTTGCAGCCTCAGGCTCGGG - Intronic
1142619573 17:1156203-1156225 CCCCCTGCAGCCGGAGGCCTAGG - Intronic
1143016462 17:3893309-3893331 TCCCCTGCAGGCCCAGGAGAAGG - Intronic
1143564555 17:7713727-7713749 TCCCCTCCAGGCCGAGGCTAGGG - Intergenic
1143642572 17:8207540-8207562 CCCCGTCCACCCCCAGGCTTGGG + Intronic
1145068690 17:19783824-19783846 TCCCCGCCTGGCCCAGGCTTCGG - Exonic
1145190731 17:20841167-20841189 GCCCCACCAGGCCCCGGCTTGGG - Intronic
1145759863 17:27419998-27420020 TCCCCTGCAGGTCCAGCCTGAGG + Intergenic
1145930070 17:28679007-28679029 GCTCCTGCAGGGCCAGCCTTGGG - Intronic
1145944009 17:28759502-28759524 CCACCCCCAGGCCCAGGCTCTGG - Exonic
1145957917 17:28867658-28867680 CCCTCTCGAGGTCCAGGCTTGGG + Intergenic
1146159826 17:30553922-30553944 TCCCCTGCAGGTCCAGCCTGAGG + Intergenic
1146938222 17:36825792-36825814 ACCCCTGCTGGCCCAGGATGGGG - Intergenic
1147450191 17:40499618-40499640 CCCCCTGCAGGACCTGGCCAAGG - Intronic
1147732808 17:42614433-42614455 ACCCCTGCAGGTCCAGGGTGTGG - Intronic
1147783705 17:42962768-42962790 ACACCTGTAGGCCCAGCCTTTGG + Intronic
1148104891 17:45113838-45113860 CCACCCTCAGGGCCAGGCTTGGG + Intronic
1148432109 17:47650510-47650532 CCTCCCGGAGGCCCAGGCCTCGG + Intronic
1148444126 17:47727422-47727444 CCCGCTGCACTCCCAGGCTAGGG - Intergenic
1148593154 17:48831411-48831433 CCTCCCGCGGGCCCAGGCTGTGG + Intronic
1148658945 17:49311892-49311914 CTACCTACAGGCCCAGGCCTAGG - Intronic
1148829895 17:50424931-50424953 ACCCTTGCAGGCCCAGCCTCCGG + Intergenic
1149597475 17:57872818-57872840 CCCTCTCCACTCCCAGGCTTGGG + Exonic
1150136412 17:62697665-62697687 CCCCCTGCAGCCCCAGTATGAGG - Intergenic
1150280981 17:63929526-63929548 TCCCCTGCTGGGCCAGGCTGGGG + Intronic
1151453738 17:74214226-74214248 CACCCTGCAGGCCGGGGCTGGGG - Intronic
1151501613 17:74493699-74493721 CCCTCTGCACGCCCAGTCCTTGG + Intergenic
1151903813 17:77034997-77035019 CCCCCTCCAGGCCCAGCCCTGGG + Intergenic
1152034620 17:77864434-77864456 GCCCCTGCTGGCCCAGGCCATGG - Intergenic
1152119397 17:78408933-78408955 CCCCGATCAGGACCAGGCTTGGG - Intronic
1152183822 17:78841400-78841422 TCCTCGGCAGCCCCAGGCTTTGG - Intronic
1152245295 17:79182264-79182286 ACCCCTGCAGGCCCAAGCAGAGG + Intronic
1152291239 17:79441270-79441292 GCCCCTGCAGGCCGAGGCTCCGG - Intronic
1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG + Exonic
1152477271 17:80526455-80526477 CCCCCCTCATGCCCAGGTTTGGG + Intergenic
1152592066 17:81218638-81218660 CGCCCTGCTGGCCCAGGCTTTGG + Intronic
1152592120 17:81218831-81218853 CCCCTGGCAGGCCCAGGCCAGGG - Intronic
1152614022 17:81329738-81329760 CCCACTGCAGGCCCTGGGGTGGG - Intronic
1152616868 17:81341890-81341912 CCGCCGGCAGGCAGAGGCTTCGG + Intergenic
1152758466 17:82096946-82096968 CCACCTCCATGCCCCGGCTTTGG - Intronic
1152766781 17:82145740-82145762 CCCCCTGCAGGCCCCTGAGTGGG + Intronic
1152804478 17:82348562-82348584 CCCCCTGCAGCCCCAGGCCCTGG - Intergenic
1152830530 17:82494510-82494532 CCCTCTGCATTCCCTGGCTTGGG - Intergenic
1154015482 18:10612677-10612699 CCCCCTCCACCCCCTGGCTTTGG - Intergenic
1154190028 18:12222954-12222976 CCCCCTCCACCCCCTGGCTTTGG + Intergenic
1155508009 18:26549883-26549905 CCCCCGGCGCGCCCAGGCTCCGG + Intronic
1156600794 18:38603695-38603717 CTCCCTGAAGGCAGAGGCTTTGG - Intergenic
1161156241 19:2733119-2733141 CCTCCTGCAGGCCCAGGGCCAGG + Exonic
1161421301 19:4177178-4177200 ATCCCTGGATGCCCAGGCTTTGG + Intronic
1161633876 19:5374810-5374832 GCCCCTGCAATCCCAGGCTGAGG + Intergenic
1161669035 19:5594305-5594327 CCCCCTGCACGCGCAGCTTTAGG - Intronic
1161953036 19:7478219-7478241 CCCTGTGCAGGCCCATGCTGGGG - Intronic
1162031340 19:7918717-7918739 CCCGCGGCAGGCGCGGGCTTTGG + Intronic
1162317059 19:9945870-9945892 CCCCCTGCTGGGCCTGGCTTGGG - Intergenic
1162384857 19:10354651-10354673 TCCCCAGCAGGCCCACACTTGGG + Intronic
1162745675 19:12796749-12796771 CCTTCTTCAGGCTCAGGCTTGGG - Intronic
1162818337 19:13209003-13209025 CCCTCACCCGGCCCAGGCTTGGG - Exonic
1162914271 19:13865715-13865737 CCCCCTGGCGGCCCCGGCTCCGG - Intronic
1163243134 19:16076456-16076478 CCCCGCGCAGGCAAAGGCTTGGG + Intronic
1163687382 19:18719440-18719462 GCCCCGGCAGGCCCAGGATCTGG + Intronic
1164566224 19:29327768-29327790 CCACCACCAGGCCCTGGCTTTGG - Intergenic
1164670915 19:30071433-30071455 CCCACACCAGGCCCTGGCTTCGG + Intergenic
1164779415 19:30880501-30880523 CCCCCAGCAGGATCAGGCTGTGG - Intergenic
1165424710 19:35739521-35739543 CCCCCACCTGGCCCAGGCTCAGG + Exonic
1165755482 19:38290446-38290468 CCCCATGGAGGCCCTGGCTGAGG + Intronic
1166361812 19:42255636-42255658 CCCCATTCAGGCTCAGGGTTGGG - Intergenic
1166831821 19:45643816-45643838 CCCTCTGCAGGTCCAGGCACCGG - Intronic
1166978142 19:46617149-46617171 CCCCCTGCAGGCCTTGGCTGAGG - Intergenic
1167095483 19:47373043-47373065 CCCCAGGCAGGCCCAGTCTGTGG - Intronic
1168352773 19:55686069-55686091 CAACCTGCAGGCCCTGGCTCTGG - Intronic
1202702161 1_KI270712v1_random:172685-172707 CTCCCTTCAGGGCCAAGCTTAGG - Intergenic
925085061 2:1101260-1101282 ACCCCTCCAGGCCCAGGCCCAGG + Intronic
925141041 2:1550101-1550123 CCTCCATCAGGCCCTGGCTTTGG + Intergenic
925180534 2:1814312-1814334 GGCCCTCCAGGCCCAGGCTCTGG + Intronic
926056292 2:9775989-9776011 CCCCCTGCAGGCCCAGAGGAAGG - Intergenic
926120997 2:10241110-10241132 TCCCCTGCAGGCCCAGGGGAAGG + Intergenic
926217518 2:10914462-10914484 CCCCCTGCAGGCCCAGGATGGGG + Intergenic
926243901 2:11107969-11107991 CCTCGTGCAGGCCCCGGGTTTGG - Intergenic
927256302 2:21043700-21043722 GCCCCTGCAGGCTCAGGATGGGG - Intronic
928301530 2:30129675-30129697 CCCACTGCATGCTCAGGCATGGG - Intergenic
929760382 2:44801840-44801862 CCCCCTGCAGCCCCAGCCAAGGG - Intergenic
930770752 2:55128280-55128302 CACCCTGAAGGCCCAGTTTTTGG - Intergenic
932050004 2:68388963-68388985 GCCTCTGCATGCCCAGGTTTTGG - Intronic
932338409 2:70943932-70943954 CCCCATGGAGGCCCAGCCCTGGG + Intronic
932494396 2:72139226-72139248 CACTCTGCAGGCCGAGGCTCCGG - Intronic
932779121 2:74549112-74549134 CCGCCTGCCCGCCCAGGCGTCGG + Intronic
933725013 2:85421751-85421773 CCTCCTGCAGGCCCCAGCTTAGG - Intronic
934173076 2:89556131-89556153 CTCCCTTCAGGGCCAAGCTTAGG - Intergenic
934283391 2:91630488-91630510 CTCCCTTCAGGGCCAAGCTTAGG - Intergenic
934573294 2:95385183-95385205 CCTCCTGCTGGCTGAGGCTTGGG + Exonic
935111558 2:100099008-100099030 GCCCCTCCAGGCCCATGCTGAGG + Intronic
935128288 2:100242759-100242781 CCTCCTGCACCCCCAGGCTCTGG + Intergenic
936123410 2:109766156-109766178 GCCCCTCCAGGCCCATGCTGAGG - Intergenic
936221275 2:110605308-110605330 GCCCCTCCAGGCCCATGCTGAGG + Intergenic
937340815 2:121089288-121089310 GTCCCTGCAGGCGCAGGCTCTGG + Intergenic
938265067 2:129922763-129922785 CCCCCTCCAGGCTCAGACCTGGG - Intergenic
940757458 2:157699457-157699479 CCACCTGCTGGTCCAGGCTACGG + Intergenic
942452715 2:176118192-176118214 CTCCCTGCAAGGCCAGCCTTAGG + Intronic
942506085 2:176642948-176642970 CCCCAGGCAGTACCAGGCTTTGG + Intergenic
943731034 2:191304136-191304158 CCCACTGCAGACCCAGCCTCAGG - Intronic
943876474 2:193073097-193073119 CCACCCACTGGCCCAGGCTTTGG - Intergenic
944393712 2:199246219-199246241 ACTCCTGGAGGCCCAGCCTTGGG - Intergenic
944933640 2:204545571-204545593 CCCACTCCAGCCCCCGGCTTGGG + Intergenic
945483861 2:210371145-210371167 ACTCCTGCAGTCCCAGGCATGGG - Intergenic
946076035 2:217074427-217074449 CCCCTGGCAGGCCCAGCCTCAGG + Intergenic
947684365 2:232069605-232069627 ACCCCAGCAGACCCAGCCTTGGG + Intronic
947714090 2:232331207-232331229 CTCCCTGCAGGCCCAGGCCTAGG - Intronic
947733298 2:232442585-232442607 CTCCCTGCAGGCCCAGGCCTAGG - Intergenic
947944846 2:234092699-234092721 CACCCTGCAAGCACAGGCTGGGG + Intergenic
948771799 2:240255049-240255071 CCTCCTGCAGGGTCAGGCTCTGG + Intergenic
948990111 2:241549638-241549660 CCCCGTTCAGGCCGAGGCTGCGG + Intergenic
1168799145 20:633485-633507 CTCCCTGCTGGGCCAGGCCTTGG + Intergenic
1169755002 20:9034403-9034425 CTCCCTGCAGGAACAGGCTGAGG + Intergenic
1170570442 20:17629467-17629489 GCCACTGCGGACCCAGGCTTGGG + Intronic
1170695936 20:18658893-18658915 CCCCCTGATGCCCCAGGCTTGGG + Intronic
1170766211 20:19291749-19291771 TCTCCTGCAGGCCCAGGGCTGGG - Intronic
1170830304 20:19833875-19833897 CTCCCTGCAGGCTTAGGCTGAGG + Intergenic
1171213059 20:23331683-23331705 CCCCCAGCGGGGCCAGGCTGAGG - Intergenic
1171781983 20:29427789-29427811 CCACCTGCAGGCCCCGGCGCTGG + Intergenic
1172985671 20:38986977-38986999 ACCCCAGCAGCCCCAGGCTCAGG - Intronic
1173224276 20:41152842-41152864 CCCCCACCAGGCCCAGGCCAGGG - Intronic
1173322583 20:42001569-42001591 CCACCTGCTGGCCCAGACTGTGG - Intergenic
1173704260 20:45098519-45098541 CCGCCTGCAGGCCGCGGCGTCGG - Exonic
1173854455 20:46241092-46241114 CACGCTGCGGGCCCAGGCTCGGG - Exonic
1174173190 20:48629539-48629561 CTCCCAGCAGCACCAGGCTTTGG + Exonic
1175482029 20:59318583-59318605 CACCCGGAAGGCCCAGGCCTTGG + Intronic
1175735039 20:61379528-61379550 CTCCCTGCAGCCGCTGGCTTGGG - Intronic
1175918205 20:62437399-62437421 CCCCCCGAAGCCCCAGTCTTGGG - Intergenic
1175991361 20:62791375-62791397 TCCCCTGCAGGGCCAGGCCACGG - Intergenic
1176024489 20:62978784-62978806 CCCCATGCTGGCTCAGGCTGCGG - Intergenic
1176124999 20:63471413-63471435 CCCCTTCCAGGCCCAGGGCTGGG + Intronic
1176241604 20:64078187-64078209 GCCTCTGCATGCCCAGGCCTCGG - Intronic
1178408734 21:32347034-32347056 CCCCCTGGAGGCCGAGCCCTGGG + Exonic
1178631529 21:34265419-34265441 GCCCCTGGAGGCCCAGGCCTTGG + Intergenic
1178883352 21:36465678-36465700 CCCCCTGGGAGGCCAGGCTTGGG - Intronic
1178908285 21:36653964-36653986 CACCCAGCAGGCCCAGGCTGGGG - Intergenic
1179463139 21:41551108-41551130 CTGCCTGCAGGCGCAGGCTGAGG + Intergenic
1179494142 21:41761054-41761076 CTCCCTGCAGCCACAGGCTTGGG + Intronic
1179618251 21:42595570-42595592 CACCTTGCAGGCCCATGCTGTGG + Intergenic
1179657682 21:42855300-42855322 CACCCTGAAAGCCCAGGCCTTGG - Intronic
1180036274 21:45251997-45252019 CCAGCAGTAGGCCCAGGCTTGGG - Intergenic
1180067681 21:45420766-45420788 CCCACTGCAGGCCCAGCCCAAGG - Intronic
1180877171 22:19179957-19179979 CCCTCTGCAGGCCCTGCCGTGGG - Exonic
1180999466 22:19981367-19981389 CCACCTGGTGGCCCAGGCTCAGG + Exonic
1181041591 22:20195029-20195051 CCCCCTGCAGGCCCTCCCCTGGG + Intergenic
1181678209 22:24471737-24471759 ACCCCAGCAGGCTCAGCCTTAGG - Intergenic
1182277916 22:29202069-29202091 CACCCTGCAGGGCCAGGGTCGGG - Intergenic
1182296459 22:29313333-29313355 CCCCCTGCAGGCGCAGGGCCGGG + Exonic
1183287635 22:36977429-36977451 ACCCCAGCAGGCCAAGGCTGTGG + Intergenic
1183300677 22:37057567-37057589 CTTCCTGCAGCCCCAGCCTTGGG + Intronic
1183332804 22:37230323-37230345 GACTCTGCAGGCCCAGGGTTTGG - Intronic
1183395471 22:37568678-37568700 CTCCCAGGAGGCCCGGGCTTGGG - Exonic
1184128700 22:42504563-42504585 CCCTCTGCAGCCCCAGGCAGTGG + Intergenic
1184137495 22:42557878-42557900 CCCTCTGCAGCCCCAGGCAGTGG + Intronic
1184160483 22:42694487-42694509 GCTCCGGCAGGCCCAGGCGTTGG + Intronic
1184203492 22:42985483-42985505 CCACATGCAGGCCCAGGTCTAGG + Intronic
1184206128 22:43004768-43004790 CACCCTGCAGGTCCAGGCAGAGG + Intronic
1184322666 22:43754393-43754415 TCCCCTGCCTGCCCAGGGTTGGG + Intronic
1184373161 22:44095582-44095604 CACCCTGCAAGCCCAGGCCGCGG - Intronic
1184508920 22:44920551-44920573 CCCCCTGCTTGGCCAGGCTGGGG - Intronic
1184553485 22:45218704-45218726 CCTCCTGCAGGGCCAGGCTAAGG - Intronic
1184805982 22:46795198-46795220 CCTTCTGCAGGCCCAGTCCTGGG + Intronic
1184951160 22:47843526-47843548 CCTCCTGTAGGGCCAGGTTTCGG + Intergenic
1185053911 22:48568097-48568119 CTGCCTGCTGGCCCAGGGTTTGG - Intronic
1185071402 22:48658748-48658770 GCCCCTGCTGGCCCAGACCTAGG + Intronic
1185080972 22:48709150-48709172 CCTCCTGCAGGCCCACACCTGGG - Intronic
1185082517 22:48717856-48717878 CACCCTGGAGAGCCAGGCTTAGG + Intronic
950012275 3:9731982-9732004 CCCCCTGCCGCCCCACGCTTTGG - Exonic
950150256 3:10681276-10681298 CCCCCAGCAGCTCCACGCTTGGG + Intronic
950615031 3:14151470-14151492 AACCCTGCAGGCCCAGGCAGGGG + Intronic
950747060 3:15099069-15099091 CCCCCTTCAGGCCCGGGCTCTGG + Exonic
951898363 3:27632809-27632831 CCCCGCGCAGGCAAAGGCTTGGG + Intergenic
952967476 3:38630258-38630280 CCCCCTGGGGGCCCACGCTGGGG - Intronic
953548307 3:43881195-43881217 CCCACTGCAGTCCCAGGAATAGG + Intergenic
953979941 3:47408585-47408607 ACCCCTCTAGGCCCTGGCTTGGG + Intronic
954220877 3:49153210-49153232 ACACCTGCAGGCGAAGGCTTAGG + Intergenic
954300954 3:49700546-49700568 CCACCTGTAGGCCCAGGTCTGGG - Exonic
954518052 3:51197794-51197816 CCACCCGCTGGCCCAGGCTCTGG - Intronic
955132728 3:56187074-56187096 CTCCCTGCAAGTCCAGGCTCAGG - Intronic
956186807 3:66570376-66570398 CCCACTGCAGTGCAAGGCTTAGG + Intergenic
957083511 3:75658608-75658630 CCACCTGCAGGCCCCGGCGCTGG - Intergenic
957623342 3:82624147-82624169 CCATCTGCAGCCCCAGGGTTGGG - Intergenic
958710743 3:97714100-97714122 CCCCTACCATGCCCAGGCTTAGG - Intronic
962350276 3:134651208-134651230 CCCGGTGCAGGTCAAGGCTTGGG - Intronic
962973694 3:140427920-140427942 GCCCACACAGGCCCAGGCTTGGG - Intronic
963114874 3:141719280-141719302 CCCCTTCCAGGTCCACGCTTTGG + Intergenic
963748771 3:149152582-149152604 CCACCTGCTGACTCAGGCTTTGG + Intronic
963870683 3:150410368-150410390 CCCACTGCAGGGCCCGGCTGCGG - Exonic
965113948 3:164463454-164463476 CAACCTGCAGGCACAGGCTGTGG + Intergenic
966405021 3:179587740-179587762 GCCCCTGGAGTCCCAGGCTGAGG + Intronic
967168558 3:186806115-186806137 CATCTTGCAGGCCCCGGCTTTGG - Intronic
967867709 3:194204064-194204086 GCCCCTGGAGTCCCAGGTTTGGG + Intergenic
968552675 4:1231729-1231751 CCACATGCAGGCCCAGGGTGGGG + Intronic
968761402 4:2444238-2444260 AACCCTGCAGGCCCAGGCCATGG - Intronic
968788678 4:2643811-2643833 CCCCTGGCAGGCCAAGGCGTAGG + Intronic
969010341 4:4056512-4056534 CACTCTTCACGCCCAGGCTTGGG - Intergenic
969010880 4:4061040-4061062 CCACCTGGAGGCCCAGGGATTGG + Intergenic
969251075 4:5969277-5969299 ATCCTTGGAGGCCCAGGCTTAGG + Intronic
969614064 4:8242227-8242249 CCCACTGCTGGTCCAGGCCTGGG + Intergenic
969716349 4:8870159-8870181 CCCTCTGCAGGCTCCGGCTCTGG - Intronic
969802569 4:9580945-9580967 CCACCTGGAGGCCCAGGGTTTGG - Intergenic
969928310 4:10606249-10606271 CCCTATGCAGGCCTAGGCTAAGG - Intronic
973890873 4:55366063-55366085 CCTTCAGCAGGGCCAGGCTTAGG + Intronic
975766815 4:77677158-77677180 CCCCATGCTGGCCCATGGTTGGG + Intergenic
976092286 4:81471439-81471461 ACCCGGGCAGGGCCAGGCTTGGG - Intronic
977290803 4:95162372-95162394 CCTCCTGCAGGCACAGGATGAGG - Intergenic
980053028 4:128056974-128056996 GCCCCTGCAGGCTCTGCCTTAGG + Intergenic
980595411 4:134948281-134948303 CTCCCTGCAGGGCAGGGCTTGGG - Intergenic
982116854 4:152105200-152105222 CCCTCTGCAGAGCCAGGCTGGGG + Intergenic
983475085 4:168203581-168203603 GCCCCTGCAGGCACAAGCCTTGG - Intergenic
985084624 4:186299609-186299631 CTCTCTGCACCCCCAGGCTTTGG - Intergenic
985374601 4:189321929-189321951 GCCCCTGCATGCCCAGTCTGTGG - Intergenic
985448030 4:190038308-190038330 CCACCTGCAGGCCCCGGCGCTGG + Intergenic
985713469 5:1443017-1443039 CCCCGTGGAGGCCCAGGATCGGG - Exonic
986667548 5:10116624-10116646 CCTCCTGCTGGCTCTGGCTTTGG - Intergenic
986796009 5:11212782-11212804 CTCCGTGCAGGCCCAGGCCCAGG - Intronic
987085221 5:14461589-14461611 CTCCCTCCTGGCCCAGGCCTGGG - Intronic
988322461 5:29716504-29716526 CACCCTGCAGGCTCAGACTCAGG + Intergenic
991009357 5:61866893-61866915 CTCCCTGAAGGCCAAGGCCTAGG - Intergenic
991720864 5:69493315-69493337 CTCGCTGCAGCCTCAGGCTTAGG - Intronic
992019938 5:72612598-72612620 GCCACTGCAGGCCCAAGCTGTGG - Intergenic
993902769 5:93595827-93595849 CCCCAGGCTGGCCCAGGCTGCGG - Intergenic
997347613 5:133203285-133203307 CACCCTGCAGGCCAAGCCTCAGG - Intronic
997385241 5:133467364-133467386 CCTCCTGCAGGCCCAGCCGTGGG - Intronic
997412995 5:133704402-133704424 CTCCCTACAGGCCAAGGCTGGGG + Intergenic
997523250 5:134536747-134536769 CCTGCTGGAGGCCCAGGCTAAGG + Intronic
998153676 5:139771903-139771925 CCCTCTGCAGGCCCTGCCCTTGG - Intergenic
999179180 5:149656855-149656877 ACACCTGCAGGCCCAGGCCCAGG + Intergenic
1001988386 5:176095349-176095371 TCCTCTGCAGGCCCAGGCCAAGG - Intronic
1002098437 5:176845536-176845558 CCCTCTGCAGCCCAGGGCTTGGG + Intronic
1002184375 5:177447286-177447308 CCCCCTGCACCCCCGGGCTGTGG - Intronic
1002189125 5:177469774-177469796 CCCCATGCAGGCCCAGGCTGAGG + Intronic
1002228482 5:177742784-177742806 TCCTCTGCAGGCCCAGGCCAAGG + Intronic
1002579186 5:180197281-180197303 CCCCCTGCCGTCCCAGGGTTCGG - Intronic
1002762818 6:214937-214959 CCCACTGCAGGCCTAGGGATGGG + Intergenic
1003135429 6:3431383-3431405 TCCCCTGCAGAGCCAGGCTTAGG - Intronic
1004902808 6:20209815-20209837 GCCCCTGCAGGCTGAGGCCTTGG + Intronic
1006139703 6:31920895-31920917 CACCCTGCAGGCCCAGACACTGG - Intronic
1007107592 6:39294414-39294436 CTCTCTGCAGGCCCTGGCTTTGG - Intergenic
1007473719 6:42106119-42106141 CCCCCTTCTAGCCGAGGCTTAGG + Exonic
1007509279 6:42363067-42363089 ACTCCTGCAGGCCCTGGCTGTGG - Exonic
1007681491 6:43636641-43636663 CCCCAGGTAGGCACAGGCTTTGG + Exonic
1007902520 6:45423784-45423806 CCCCCTGAACGCCCCCGCTTCGG - Intronic
1008270187 6:49482044-49482066 CCCCCCGCAGCCGCTGGCTTGGG + Intronic
1008296177 6:49781188-49781210 CCCTCTGTAGGCCCAGGCTAAGG - Intergenic
1010388737 6:75312358-75312380 CCCTCTGCAGGCCTGCGCTTTGG + Intronic
1010496355 6:76537678-76537700 CCCACTACTGGCCCAGGCTATGG - Intergenic
1013003777 6:106051324-106051346 GCCCCCGCAGACCCAGTCTTAGG + Intergenic
1013621931 6:111898661-111898683 GCCACTGCAAGCCCAGGTTTGGG + Intergenic
1014014317 6:116512215-116512237 CTCCCTTCAGGCCCAGTCTCAGG + Exonic
1015459583 6:133473772-133473794 CCCCTTGCAGGGCCAGGATTAGG + Intronic
1017008726 6:150047331-150047353 ACACCTGGAGGCCCTGGCTTCGG + Intergenic
1018270355 6:162070876-162070898 ACCCCTGCTGGCCCAGGGCTTGG + Intronic
1018344748 6:162888686-162888708 ACCCCTGCAGACCCAGGCAGGGG - Intronic
1018854776 6:167667513-167667535 CCCCCTGGAGCGCCAGGGTTGGG + Intergenic
1018909808 6:168095497-168095519 CCCCTGGCAGCCCCCGGCTTTGG + Intergenic
1019567634 7:1692410-1692432 GGCCCTCCCGGCCCAGGCTTGGG - Intronic
1019616609 7:1965787-1965809 CCTCCTGCAGGGCCGGGCGTGGG + Intronic
1022325826 7:29331334-29331356 CCCCCTCCAGACCCGGGGTTGGG - Intronic
1025071395 7:55902556-55902578 CCCTGTTCAGGCCCAGGCTCTGG - Intronic
1027471595 7:78581181-78581203 AGAGCTGCAGGCCCAGGCTTGGG + Intronic
1028979716 7:96954032-96954054 CCCCTAGCAGGGCCAGCCTTAGG - Intergenic
1029070160 7:97889050-97889072 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1029116813 7:98241823-98241845 GGCCCTGCAGGACCAGGCCTAGG + Intronic
1031464374 7:122090620-122090642 CTCCCTGCAGGGCCAGGACTAGG + Intronic
1033368513 7:140689339-140689361 CCAGCTGCAGGCCCCAGCTTTGG - Intronic
1034338976 7:150340513-150340535 CCACCTGCAGGCCCCGGCGCTGG + Exonic
1034934860 7:155192387-155192409 CCACGTGCATGCCCCGGCTTAGG - Intergenic
1035168831 7:157006736-157006758 CCCTCTGCAGGGCCAGGCCTTGG - Intronic
1035833369 8:2722681-2722703 CCCTCAGCAGTCCCAGGGTTAGG - Intergenic
1035952268 8:4035550-4035572 CCCCGTGCAGGCCTAGGCTAGGG + Intronic
1036248395 8:7140637-7140659 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1036252413 8:7173700-7173722 CCACCTGGAGGCCCAGGGATTGG + Intergenic
1036283031 8:7417565-7417587 CCACCTCCTGGCCCAGGCCTGGG - Intergenic
1036338438 8:7893954-7893976 CCACCTCCTGGCCCAGGCCTGGG + Intergenic
1036365081 8:8113760-8113782 CCACCTGGAGGCCCAGGGATTGG - Intergenic
1037963192 8:23115154-23115176 TCCCCAGCAGGCCCAGGCTTTGG + Intronic
1038415818 8:27395029-27395051 CCCCCTGAAGGACCTGGCTGAGG + Intronic
1038676042 8:29623898-29623920 CCTCCTGCAGGCCAAAGCTAAGG + Intergenic
1039685898 8:39801659-39801681 CCCCCTGGGGGCTCAGGCTCAGG + Intronic
1040049642 8:43000568-43000590 CCCCCTCCTGCCCCATGCTTTGG + Intronic
1041982046 8:63873455-63873477 GCCCCTTCAGGCCTAGGATTGGG - Intergenic
1045016613 8:98006185-98006207 ACACATGCAGTCCCAGGCTTTGG + Intronic
1047255000 8:123207707-123207729 CCCTCCGCAGGCCCAGGGCTGGG + Exonic
1047381756 8:124371695-124371717 CCCCCAGCCGTCCCAGGCGTGGG + Intronic
1048271930 8:133036194-133036216 CATCCTTCAGGTCCAGGCTTAGG - Intronic
1048877643 8:138849619-138849641 CCATCTGCTGGTCCAGGCTTTGG - Intronic
1049428774 8:142549680-142549702 CTCCCTGGAGGCCCAGACCTGGG + Intergenic
1049600628 8:143505777-143505799 ACCCCTGGAGGCCCTGGCTGTGG - Intronic
1049786567 8:144453798-144453820 CCCCCTACAGGTCCAGAGTTTGG + Intronic
1051434647 9:17018158-17018180 ACCCCTGCAGTCCCTGGCTGTGG - Intergenic
1052606864 9:30715265-30715287 GCCCCTGTGGCCCCAGGCTTTGG - Intergenic
1053013185 9:34647003-34647025 CCACCAGCAGGCCCAAGCTCGGG - Intronic
1053283556 9:36836702-36836724 CACCCTGGTGGCCCTGGCTTGGG + Exonic
1053355377 9:37441182-37441204 CCACCTGCAGGCCCAGCCTCTGG + Exonic
1056789393 9:89615907-89615929 CTCCCTGCAGACCCAGCCTTAGG - Intergenic
1056826433 9:89879370-89879392 GCCCCTGCAGGCCCATCCTCCGG + Intergenic
1057276921 9:93680961-93680983 CGCCCTTCAGGCCCGGGCTCTGG + Intergenic
1057562793 9:96141062-96141084 CCCCCTTCATGCTCAGGCTGAGG + Intergenic
1057937598 9:99253887-99253909 TCCCCTGCAGGCCCACCCTGTGG - Intergenic
1058711394 9:107682245-107682267 CTCCCAGCAGGACCAGCCTTGGG + Intergenic
1058837023 9:108866256-108866278 CCCACTGCAGGCACAGGCAAGGG + Intergenic
1058915409 9:109559895-109559917 TACCCTTCAGGCCCAGGATTGGG - Intergenic
1060110854 9:120905285-120905307 CAGCTTGGAGGCCCAGGCTTGGG + Intronic
1060722770 9:125989649-125989671 CCCTCTCTGGGCCCAGGCTTAGG - Intergenic
1061386114 9:130290220-130290242 CCCCCTGTAGGGCCAGGCCTGGG - Intronic
1061410963 9:130421463-130421485 CCCCCTACAAGGCCAGGATTGGG - Intronic
1061418598 9:130461429-130461451 CGCCCTGCAGGTCCAGGATGGGG - Intronic
1062601388 9:137320074-137320096 CCCCCTGCCCGCCCCGGCCTGGG - Intronic
1203441771 Un_GL000219v1:16014-16036 CCACCTGCAGGCCCCGGCGCTGG + Intergenic
1203512581 Un_KI270741v1:134923-134945 CCACCTGCAGGCCCCGGCGCTGG + Intergenic
1187127427 X:16467183-16467205 CTACCTGCTGGCCCAGGCTTTGG + Intergenic
1187228600 X:17398784-17398806 GCCTCTTGAGGCCCAGGCTTAGG + Intronic
1190332855 X:49246787-49246809 CCCCAAGCAGGCCCCAGCTTTGG - Exonic
1191109374 X:56793155-56793177 CTACCTGCAGCTCCAGGCTTTGG + Intergenic
1191910428 X:66143842-66143864 GCCCCTGCAGACCCAGGATCTGG - Intergenic
1192144503 X:68672567-68672589 CCCCAGGCAGACCAAGGCTTGGG - Intronic
1194383204 X:93221044-93221066 CACTCTGCAGGCCCAGCCTCTGG - Intergenic
1195221064 X:102745858-102745880 CAACCCGCAGGCCCAGGCTGGGG + Intronic
1196961218 X:121004337-121004359 CCCCTTGGAGACCCTGGCTTTGG - Intergenic
1197401145 X:125992362-125992384 CCACCTGCAGGTCAGGGCTTGGG + Intergenic
1198051980 X:132958979-132959001 CCTCCTGCAGGCACAGGGTTTGG - Intronic
1199601459 X:149543777-149543799 CCCCCTTCAGACTCAGCCTTAGG - Intronic
1199648917 X:149935707-149935729 CCCCCTTCAGACTCAGCCTTAGG + Intronic
1200010022 X:153113814-153113836 CCTCCGTCAGGCCCAGGCTTGGG + Intergenic
1200029578 X:153286108-153286130 CCTCCGTCAGGCCCAGGCTTGGG - Intergenic