ID: 1152438019

View in Genome Browser
Species Human (GRCh38)
Location 17:80288070-80288092
Sequence CCCCTGCAGGCCCAGGCTTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 1, 2: 11, 3: 60, 4: 513}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152438010_1152438019 3 Left 1152438010 17:80288044-80288066 CCGCGCCCACCGAGGTTGGCGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513
1152438008_1152438019 8 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513
1152438005_1152438019 30 Left 1152438005 17:80288017-80288039 CCACGCCACTGGAGGGTGACGGC 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513
1152438006_1152438019 25 Left 1152438006 17:80288022-80288044 CCACTGGAGGGTGACGGCCTCTC 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513
1152438011_1152438019 -2 Left 1152438011 17:80288049-80288071 CCCACCGAGGTTGGCGACAGCCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513
1152438012_1152438019 -3 Left 1152438012 17:80288050-80288072 CCACCGAGGTTGGCGACAGCCCC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513
1152438013_1152438019 -6 Left 1152438013 17:80288053-80288075 CCGAGGTTGGCGACAGCCCCCTG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 1
2: 11
3: 60
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152438019 Original CRISPR CCCCTGCAGGCCCAGGCTTT GGG Exonic
900163603 1:1236048-1236070 CCTCTGCAGGCCAAGGATTGAGG + Intergenic
900179049 1:1303428-1303450 CCCAGGCAGGCCCAGGCGTGAGG - Intronic
900209116 1:1444854-1444876 TCCCCGCTGGCCCAGGCTTCCGG + Intergenic
900218953 1:1496772-1496794 TCCCCGCTGGCCCAGGCTTCCGG + Intronic
900556853 1:3284959-3284981 CCCCTCTGGGCCCGGGCTTTCGG + Intronic
900665815 1:3814865-3814887 CCCCTGCAGGCCCCGTCTGCTGG - Exonic
901019290 1:6247862-6247884 CCCCTCCAGTCCCTGGCTGTGGG - Exonic
901215729 1:7554220-7554242 CCCTTGCTGGCCCAGGGCTTAGG + Intronic
902616931 1:17628915-17628937 CCCCTGCAGTGCCAAGCTTCAGG + Intronic
902643231 1:17780079-17780101 CACCTGCAGTCCCAGCCTCTTGG + Intronic
903190298 1:21652237-21652259 GCCGTGCAGACCCAGGCTTCTGG - Intronic
903815453 1:26061121-26061143 GCCCAGCAGGCCCAGGCTGGGGG + Intronic
903853469 1:26321757-26321779 TCCCTCCAGGCCCCAGCTTTCGG - Intergenic
903969969 1:27112327-27112349 CCTCTGCAGCCCCAGCCTTCAGG - Intronic
904468860 1:30723618-30723640 CCACTGCCCGCCCAGCCTTTGGG + Intergenic
904562284 1:31406860-31406882 CCCCTGCAGGCCTTGGCTGGTGG + Intergenic
904610442 1:31723143-31723165 CCCCTGCAGCCCTAGACTCTGGG - Intergenic
905896243 1:41547625-41547647 CTCCTGCTGGGCCAGGCGTTAGG + Intronic
906284066 1:44574574-44574596 GCACTGAAGGGCCAGGCTTTAGG - Intronic
906980216 1:50621523-50621545 CCCCTGTAGTCCCAGGTATTTGG - Intronic
907387322 1:54134421-54134443 GGCCTGCAGGCCCAGGCTGGAGG + Intronic
908227041 1:62066760-62066782 TCCCTGAAGGCTCAGACTTTGGG + Intronic
908351186 1:63287099-63287121 CCCCTGTAGACCCAGGCTCCAGG + Intergenic
909660566 1:78077038-78077060 CACCTGTAATCCCAGGCTTTGGG - Intronic
909905249 1:81186465-81186487 ACCCTGCAGGCCTGGGCTTGAGG - Intergenic
910914382 1:92273714-92273736 CGCTTGTAGGCCCAGGCCTTTGG - Intronic
911764808 1:101661598-101661620 CCTCTGCAGACCCAGGCTCCAGG - Intergenic
912399806 1:109380715-109380737 CACCTGTAATCCCAGGCTTTGGG + Intronic
913165485 1:116180944-116180966 CCCCTGCAGGACAAGACTTCAGG - Intergenic
913366672 1:118047428-118047450 CCCCTGCAGACTCAGGCTCTAGG + Intronic
913366872 1:118048389-118048411 CCTCAGCAGACCCAGGCTTCAGG + Intronic
914438700 1:147682184-147682206 CCCCTACAGACTCAGGCTTAAGG + Intergenic
915164157 1:153939354-153939376 CCTCTGGAGCCCCAGGCTTGGGG - Intronic
915436005 1:155906980-155907002 CGCCTGCAGTCCCAGGTATTTGG + Intronic
915936891 1:160094943-160094965 CGCCTGCAGGCCCAGGATGCCGG - Exonic
916365065 1:164017360-164017382 CCTCTGCAGACCCAGGCTCCAGG + Intergenic
916864007 1:168836877-168836899 CGCCTGCAGTCCCAGGCACTCGG - Intergenic
917116813 1:171611629-171611651 ACCCTGCAGGTCCAGGCAGTGGG - Intergenic
917751074 1:178054062-178054084 CCCCTGCAATCCCAGGACTTTGG + Intergenic
919452480 1:197788045-197788067 CCCACACAGCCCCAGGCTTTAGG - Intergenic
919452708 1:197789253-197789275 CTCCTGTAGACCCAGGCTTCAGG + Intergenic
919742642 1:200990111-200990133 CCCCAGCAGGCCCAGCCCTGCGG + Intronic
919762985 1:201110109-201110131 AGCCTGCAGCCCCAGGCTTGGGG - Intronic
920108247 1:203569569-203569591 GCCCTGCAGGCCCCAGCTCTAGG - Intergenic
920650371 1:207832978-207833000 GCCCTGGAGGCCCAGGCACTTGG + Intergenic
921156915 1:212446012-212446034 CCCCTGCAGGAGCAGGTTCTTGG + Exonic
921245426 1:213234269-213234291 CCCCTGCAATCCCAGCATTTTGG - Intronic
921309937 1:213832842-213832864 TCACTGCAGGCCAAGACTTTAGG - Intergenic
922161070 1:223079491-223079513 CATCTGCTGCCCCAGGCTTTTGG + Intergenic
923145395 1:231194184-231194206 CCCCAGGGGGCCCATGCTTTGGG + Intronic
923564166 1:235064228-235064250 CACCTGCAGTCCCAGCATTTTGG + Intergenic
924039729 1:239972605-239972627 GCCCTGCAAGCCCAGGCCATGGG - Intergenic
924312875 1:242763977-242763999 ACCATGCAGCCCCAGGCTTCAGG + Intergenic
924824005 1:247521504-247521526 CCCCTGCAATCCCAGGCACTGGG - Intronic
924949291 1:248867591-248867613 CCTCTGCAGCTCCAGGCTTCAGG + Intergenic
924949317 1:248867729-248867751 CCCCTGTAGACCTAGGCTTCAGG + Intergenic
1065353952 10:24820935-24820957 TCCCAGCAGGCCCAGGCTGGAGG + Intergenic
1065711459 10:28522158-28522180 CCCCGGGAGGCCCAGGCTTGCGG + Intergenic
1065745689 10:28839554-28839576 CCCCTGCTGGGCCAGGATGTGGG + Intergenic
1067228093 10:44388223-44388245 CTCTTGCAGGCCCAGCCGTTGGG - Intergenic
1067469679 10:46527536-46527558 GCCCTGCAAGCCCAAGCCTTGGG + Intergenic
1067554932 10:47262265-47262287 CCACTGCAGGCTAGGGCTTTAGG - Intergenic
1069280606 10:66649947-66649969 CCCATGCAGTCCCAGGCCTCAGG + Intronic
1069376670 10:67800095-67800117 CACCTGCAGTCCCAGCCATTTGG + Intronic
1070325406 10:75385457-75385479 CAACTCCTGGCCCAGGCTTTGGG - Intergenic
1070597791 10:77844889-77844911 CGCCTGCAGGCCCTGCCTCTGGG - Intronic
1070628513 10:78067982-78068004 CCCCTCCAGACACAGGCATTGGG + Intergenic
1070706847 10:78645939-78645961 CGCCTGCAGGCCCAGCTCTTAGG - Intergenic
1070724761 10:78780381-78780403 CCCATGCTGGCCCAGCCTCTGGG - Intergenic
1070794207 10:79207528-79207550 CCGCTTCAGGCCCAGGCTGCAGG - Intronic
1071067672 10:81656078-81656100 CCCCTGCAGGCTTAGGCTTAAGG - Intergenic
1071504048 10:86222296-86222318 CACCTGGAAGCCCAGGCTTGGGG - Intronic
1071538205 10:86454501-86454523 CGCCTGCAGTCCCAGGCACTAGG - Intronic
1071559279 10:86632555-86632577 CCCCTGCAGGGCCAGCCTCAGGG + Intergenic
1072110709 10:92317357-92317379 CACCTGCAATCCCAGGATTTTGG - Intronic
1072252906 10:93595763-93595785 CCCCTGCAGAGCCTGGGTTTGGG - Intronic
1072574523 10:96687899-96687921 CCACTCCAGGCTCAGGCCTTAGG - Intronic
1072628340 10:97128646-97128668 CCACTGCCAGCCCAGGCTTTGGG - Intronic
1073441690 10:103556131-103556153 CCCCTCCAGCTCCAGGCTGTGGG - Intronic
1073707201 10:105998328-105998350 CCCCAGTAGCCCCAGGCTCTAGG - Intergenic
1074196088 10:111186615-111186637 CACATGCAGGCACAGGCCTTGGG - Intergenic
1074943266 10:118255409-118255431 CCCCTTCAGTCCCAGGCCTTTGG - Intergenic
1076368188 10:129935639-129935661 GCCCTGGACGCCCAGGCTCTGGG - Intronic
1076566163 10:131400859-131400881 CCCCTGGATTCCCAGGCATTTGG + Intergenic
1076594831 10:131619022-131619044 CCCCAGCAGCCCCAGGCCATCGG + Intergenic
1076822436 10:132946195-132946217 CCTGTGCAGGGCCAGGCTCTGGG + Intergenic
1077044446 11:538177-538199 CCCTTGCACCCCCAGGCCTTGGG + Intronic
1077168896 11:1157733-1157755 CCCCTGCAGGCCAGGGCTTGGGG + Intergenic
1077284092 11:1758253-1758275 CCCCTGCAGGCCCAGGGACCCGG - Intronic
1077378114 11:2215129-2215151 CACCTGCCTCCCCAGGCTTTGGG + Intergenic
1077718128 11:4601302-4601324 CACCTGCATGCCCATGCTATGGG + Intronic
1078464191 11:11538457-11538479 ACCCTGCAGGCCCAGGCCTCTGG - Intronic
1078783139 11:14459026-14459048 CACCTGCAGTCCCAGCATTTTGG - Intronic
1081616594 11:44594967-44594989 CCACCGCCAGCCCAGGCTTTGGG - Intronic
1082004444 11:47412003-47412025 CACGTGTAGGCCCAGGCTTCGGG - Exonic
1083255783 11:61494634-61494656 CCCCTCCAGGCCCAGGCAGTCGG + Intergenic
1083625074 11:64068243-64068265 CCCCTTCAGTCCCAGGCATTGGG + Intronic
1083799351 11:65037584-65037606 ACACTGCAGTTCCAGGCTTTGGG - Intronic
1084043745 11:66557290-66557312 GCTCTGCAGGCCCACGCTTGGGG - Intronic
1084173310 11:67410744-67410766 CATCTGCAGGCCCAGGCTCCAGG + Intronic
1084208420 11:67609443-67609465 CCCCTGCAGGCCCAAGTATCTGG + Exonic
1084399974 11:68937808-68937830 CCTCTGGAGCCCCAGGCTCTGGG - Intronic
1084608549 11:70186539-70186561 CCCCAGCTGGCCCAGTCTCTAGG + Intronic
1084875684 11:72131025-72131047 CCCCTGTAGTCCCAGTATTTTGG + Intronic
1084910108 11:72381502-72381524 CCCCTACAGACTCAGGCTTCAGG + Intronic
1084976572 11:72803065-72803087 CCCCTGCAGGACCAGCCACTTGG + Intergenic
1085284237 11:75349839-75349861 GTGCTGGAGGCCCAGGCTTTGGG - Intronic
1085510383 11:77085100-77085122 TCCCTGCAGGCCCAGCCTTGTGG - Intronic
1086103821 11:83128795-83128817 CCCCCACATCCCCAGGCTTTAGG + Intergenic
1086305903 11:85481862-85481884 CCCCTGCAGCCCCAGACTCCTGG + Intronic
1087381541 11:97409704-97409726 TCCCTGCAGACCCAGGCTCCAGG + Intergenic
1088420162 11:109636281-109636303 ATCCTGCAGGCCCAGGCTCCAGG - Intergenic
1088420194 11:109636471-109636493 CCCCCACAGCCTCAGGCTTTAGG - Intergenic
1088837647 11:113591343-113591365 CCCCAGCATGCTCAGGCTTAAGG - Intergenic
1089366411 11:117923575-117923597 ACACTGCAAGCCCAGGCTCTGGG - Intronic
1089672718 11:120067621-120067643 CCCAGGCAGGCCCTGGCTTATGG + Intergenic
1091084095 11:132703792-132703814 CCCCTGAAGACCCAGGCTTTAGG - Intronic
1091460154 12:638083-638105 CCCCTGCACCCCTATGCTTTAGG + Intronic
1091479519 12:812979-813001 CACCTGTAATCCCAGGCTTTGGG + Intronic
1091587188 12:1822952-1822974 CCCCTGCAGGCCCAGGGTGTGGG + Intronic
1091624666 12:2112922-2112944 CCCCACCAGGTCCAAGCTTTGGG + Intronic
1091774411 12:3175102-3175124 CCCCTGCAGGGCGAGGCTGGGGG + Intronic
1091955836 12:4641455-4641477 CACCTGCAGGCCAAGGCTGGCGG - Intronic
1092753739 12:11743528-11743550 CCACTGCTGGCCCAGGCTCTAGG - Intronic
1094631805 12:32183158-32183180 CCCCTGTAATCCCAGGATTTGGG - Intronic
1095105964 12:38233322-38233344 CCTCTGAAGAGCCAGGCTTTAGG - Intergenic
1095494562 12:42771042-42771064 CCCCTGAAGGCCCAATCTTTTGG + Intergenic
1096292104 12:50351889-50351911 CCTCAGCAGGCCCAGGCACTGGG - Exonic
1096292122 12:50351961-50351983 CCTCAGCAGGCCCAGGCTCTGGG - Exonic
1096292166 12:50352105-50352127 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292211 12:50352249-50352271 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292234 12:50352321-50352343 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292258 12:50352393-50352415 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292287 12:50352501-50352523 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292321 12:50352645-50352667 CCTCAGCAGGCTCAGGCCTTGGG - Exonic
1096292358 12:50352789-50352811 CCTCAGCAGGCCCAGGCCTTGGG - Exonic
1096292419 12:50353005-50353027 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292434 12:50353077-50353099 CCTCAGCAGGCGCAGGCTCTCGG - Exonic
1096292455 12:50353149-50353171 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292500 12:50353293-50353315 CCTCAGCAGGCCCAGGCCCTGGG - Exonic
1096292569 12:50353545-50353567 CCTCAGCAGGCCCAGGCTCAGGG - Exonic
1097712924 12:62934873-62934895 CCCCTGCAGCACTAGGCTCTGGG - Exonic
1098006545 12:66003563-66003585 CCCCTGCAGGGCCTGGACTTGGG - Intergenic
1098228134 12:68345751-68345773 CCTTTGAAGGCCAAGGCTTTGGG + Intergenic
1098414150 12:70214629-70214651 CCCATGCAGGCCCAATCTCTAGG - Intergenic
1099428610 12:82553689-82553711 CACCTGCAGCCCTAGGCTTCAGG - Intergenic
1101167352 12:102052381-102052403 CACCTGCAGGCGAAGCCTTTAGG + Intronic
1101591639 12:106130240-106130262 CGCCTGCAGTCCCAGGACTTGGG - Intronic
1101624809 12:106429225-106429247 TCCCTGCAGCCCCTGCCTTTTGG + Intronic
1102043291 12:109814608-109814630 GCCCTGCTGGCCCAGGCGATGGG - Exonic
1102231886 12:111268348-111268370 CACCTGCAGACCCAGCCATTCGG - Intronic
1102323150 12:111956637-111956659 CACCTGCAGTCCCAGGCACTCGG - Intronic
1103249264 12:119485994-119486016 CCCCTGCAGGCCTGGGCTTTGGG - Intronic
1103436034 12:120926036-120926058 CCCAGGTAGGCCCAGGCTGTAGG - Intergenic
1103507794 12:121453331-121453353 CCCCTGCAGAACCGGGCTGTGGG - Exonic
1106799394 13:33241664-33241686 CGCCTGCAATCCCAGGCATTGGG - Intronic
1111451417 13:88423190-88423212 CCCCTGCAGCCCCAGTGCTTTGG + Intergenic
1113964365 13:114144365-114144387 CGCCTGGAAGCCCAGGCTGTGGG - Intergenic
1113983578 13:114296082-114296104 CCCCTGGAAGCCCTGTCTTTAGG - Intronic
1114835254 14:26196350-26196372 CCCATGCAGGCACAGGCTGAAGG - Intergenic
1116372582 14:44154744-44154766 CCCCTTCAGACCTAAGCTTTGGG + Intergenic
1116432797 14:44866481-44866503 CCCCTACAGACCCAGGCTCCAGG - Intergenic
1117088200 14:52223022-52223044 GACCGGCAGGCCCAGGCTCTGGG - Intergenic
1117759284 14:59010022-59010044 CCCCTTCAGCCCCAGGCTGCAGG + Intergenic
1118520363 14:66576096-66576118 CCCCTGAAGCCCCAGGCTCCAGG - Intronic
1119516860 14:75255035-75255057 TCCCTGCAGGGTCAGGCATTGGG + Intronic
1119605222 14:76010052-76010074 CGCCTGCAATCCCAGCCTTTGGG - Intronic
1119809170 14:77501691-77501713 CACCTGTAATCCCAGGCTTTGGG - Intergenic
1120135720 14:80866158-80866180 CCCCTGTAAGCACAGGCTCTGGG + Intronic
1120237007 14:81903698-81903720 ATCCTGCAGCCCCAGGCTCTGGG - Intergenic
1120601854 14:86520630-86520652 CGCCTGTAATCCCAGGCTTTGGG - Intergenic
1120716289 14:87844468-87844490 CCCCTGCCAGCCCAGGGTTAGGG - Intronic
1120749600 14:88185871-88185893 CCCCTTCAGGCGCAGGTTGTTGG + Exonic
1121302372 14:92881692-92881714 CGCCTGTAGGCCCAGGATTGAGG + Intergenic
1121412893 14:93760109-93760131 CCCCTGGCAGCCCAGGCTGTGGG - Intronic
1121714516 14:96063567-96063589 CCCCTGCAATCCCAGCATTTTGG - Intronic
1121765185 14:96479832-96479854 CCCCTGGAGGCCCAAGGTGTGGG - Intronic
1121775961 14:96591034-96591056 GCCCTGCAGGCCCTGGGTGTGGG + Intergenic
1121913565 14:97815278-97815300 CCCCTGTAATCCCAGACTTTGGG - Intergenic
1122895689 14:104755721-104755743 CCCCTGTAGGGCCAGGCTTTGGG - Exonic
1123077148 14:105673017-105673039 CCGCTGCAGGCCGAGGCTGAGGG + Intergenic
1123783032 15:23645728-23645750 CCCCAGCAGGCCCAGGCATCGGG - Exonic
1124478676 15:30059056-30059078 CGCTTGGAGGCCCCGGCTTTGGG + Intergenic
1124914666 15:33958317-33958339 CGCCTGCAGTCCCAGCCCTTTGG + Intronic
1125581500 15:40789070-40789092 CACCAGCAGGCCCATGTTTTGGG - Intronic
1125791353 15:42368789-42368811 CACCTGCAGTCCCAGCATTTTGG + Intronic
1126377851 15:48013897-48013919 CCACTCCAGGTCCAGCCTTTGGG + Intergenic
1126530931 15:49710657-49710679 CCCCTGTAGCCCCAGGCTCCAGG - Intergenic
1126759150 15:51953493-51953515 CCCCTGTAGTCCCAGCCTTCGGG + Intronic
1126775706 15:52098983-52099005 CCGCGCCAGGCCCCGGCTTTGGG - Intergenic
1126846773 15:52767230-52767252 CCTCTGCAGGCACAGACTATGGG + Intronic
1128284214 15:66422985-66423007 CCACTTGAGGCCCAGACTTTGGG - Intronic
1128336241 15:66787402-66787424 CACCTTCAGGCCCAGGCTCTGGG + Intergenic
1129167501 15:73787079-73787101 GCCCTCCAGTGCCAGGCTTTGGG + Intergenic
1129363932 15:75042988-75043010 CCTCTGCAGGCCAAGGCGCTGGG - Intronic
1129702394 15:77775314-77775336 CCACTGCAGGCCCAAGTTTGGGG + Intronic
1129988152 15:79936751-79936773 CGCCTGCAGTCCCAGCCCTTTGG - Intergenic
1130073899 15:80672265-80672287 TGCCTGCAGTCCCAGGATTTTGG - Intergenic
1130086988 15:80785874-80785896 CCCTTACCTGCCCAGGCTTTGGG + Intronic
1131076598 15:89499223-89499245 CCCCTCCCGGCCCAGGCTTCAGG - Intergenic
1132235614 15:100218131-100218153 CGCCTGCAGTCCCAGCCCTTTGG - Intronic
1132415870 15:101618516-101618538 CCCCAACTGGCCCAGCCTTTTGG - Intergenic
1132588408 16:715954-715976 CCCCCGCAGGCCCACGGTCTCGG + Exonic
1132648408 16:1009680-1009702 CCCAGGCAGCCCCAGGCTCTGGG + Intergenic
1132669100 16:1095425-1095447 CCCCTGCAGGCCCTGCCCTGGGG - Intronic
1132892425 16:2210782-2210804 CCCCTGTAGGCCCAGGTTTGGGG + Exonic
1132935442 16:2478188-2478210 CACCTGCAAGCCCAGCATTTTGG + Intronic
1133040551 16:3058172-3058194 CCCCTGCAGGCCCCTGGTTCTGG + Exonic
1134797686 16:17056849-17056871 CACCTGCAGGCCCAGGCTCCAGG - Intergenic
1135034450 16:19065204-19065226 CCCCTGTAATCCCAGACTTTGGG - Intergenic
1135425913 16:22335805-22335827 CCCCTGCAGCCCCAGGTTCTAGG + Intergenic
1135610678 16:23864329-23864351 CGCCTGCAATCCCAGTCTTTTGG + Intronic
1135934934 16:26771540-26771562 CGCCTGCAGTCCCAGCCATTTGG - Intergenic
1137000085 16:35221958-35221980 CACCTGCAGGCCCTGGCGCTGGG + Intergenic
1137236526 16:46623062-46623084 CCCCTGCAGGGCCTGGACTTGGG - Intergenic
1137253661 16:46758098-46758120 GCACTGCAGCCCCAGGCTTTGGG - Intronic
1138268631 16:55678852-55678874 CCCCAGCAGGCCCAAACCTTGGG - Intronic
1139361455 16:66402494-66402516 CCCCTGCAACCCCATCCTTTTGG - Intronic
1139373969 16:66485405-66485427 CACCTGCATGTCCAGGCTCTTGG + Intronic
1139429943 16:66905602-66905624 TCCCAAGAGGCCCAGGCTTTTGG - Intergenic
1139435589 16:66934836-66934858 CCCCTGCCGGTCCAAGCTGTGGG - Exonic
1141512704 16:84523046-84523068 TGCCTGCAGTCCCAGGCTTGTGG + Intronic
1141615401 16:85207031-85207053 CCACTGCTGGCCCCGGCTCTTGG + Intergenic
1141657484 16:85423849-85423871 CCCCTGCAGCCCCAGCCTCGTGG + Intergenic
1142267659 16:89071899-89071921 CCCCTGCCGGCCCAGGAGGTAGG - Intergenic
1143016460 17:3893308-3893330 CCCCTGCAGGCCCAGGAGAAGGG - Intronic
1144732678 17:17537523-17537545 CCCATGCTGGCCCAGGCCTCAGG + Intronic
1145930069 17:28679006-28679028 CTCCTGCAGGGCCAGCCTTGGGG - Intronic
1146938220 17:36825791-36825813 CCCCTGCTGGCCCAGGATGGGGG - Intergenic
1147175148 17:38650971-38650993 CACCTGCAATCCCAGACTTTGGG - Intergenic
1147504452 17:41001732-41001754 GCCATGCAGTTCCAGGCTTTTGG + Intergenic
1147732806 17:42614432-42614454 CCCCTGCAGGTCCAGGGTGTGGG - Intronic
1147783706 17:42962769-42962791 CACCTGTAGGCCCAGCCTTTGGG + Intronic
1148118458 17:45192619-45192641 CCCCTGTAATCCCAGGATTTTGG + Intergenic
1148506065 17:48127982-48128004 CCCCTGCAGGCCTAGTTTCTAGG - Intergenic
1148960192 17:51386046-51386068 TATCTGCAGGCCCAGGCTTGAGG - Intergenic
1150176782 17:63066052-63066074 ACCTTGCAGGCCCAGGCTACAGG - Intronic
1150540214 17:66088939-66088961 CCCTTGCAGACCTAGGCTTCAGG + Intronic
1151425372 17:74027793-74027815 CCTCTGCCTGCCCAGGCCTTTGG + Intergenic
1151805332 17:76401315-76401337 CCTCTGCGGACCCAGGGTTTGGG - Intronic
1151806926 17:76411492-76411514 TCCATGCAGGCCCCTGCTTTTGG - Intronic
1151955736 17:77379286-77379308 CCCCTGGGGGCTCAGGCTCTCGG - Intronic
1152123659 17:78433758-78433780 CTCCTGCAGGAGCCGGCTTTTGG - Intronic
1152245297 17:79182265-79182287 CCCCTGCAGGCCCAAGCAGAGGG + Intronic
1152276392 17:79360307-79360329 TCCCTGCAGGCCCAGGCTGATGG - Intronic
1152291237 17:79441269-79441291 CCCCTGCAGGCCGAGGCTCCGGG - Intronic
1152404241 17:80087369-80087391 CCGTTGGAGGACCAGGCTTTGGG + Intronic
1152438019 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG + Exonic
1152500893 17:80708415-80708437 GCCCTGCAGGTGCAGGCTCTGGG + Intronic
1152592067 17:81218639-81218661 GCCCTGCTGGCCCAGGCTTTGGG + Intronic
1152758465 17:82096945-82096967 CACCTCCATGCCCCGGCTTTGGG - Intronic
1152804476 17:82348561-82348583 CCCCTGCAGCCCCAGGCCCTGGG - Intergenic
1153957543 18:10110788-10110810 CACCTGCAGTCCCAGGTTCTTGG - Intergenic
1155092587 18:22526178-22526200 CCCCTGAAGCTCCAGGCTTCAGG + Intergenic
1155211662 18:23607311-23607333 TCTCTGCAGGCCCAGGTGTTAGG - Intronic
1155275975 18:24187837-24187859 TCCCTCCTGGCCCAGGCTTCAGG - Intronic
1155864054 18:30942241-30942263 CCCTTGCAGACCTAGGCTTCAGG - Intergenic
1156444953 18:37229613-37229635 CACCTGTAATCCCAGGCTTTGGG + Intronic
1157621426 18:49019244-49019266 CCCCTCCAGGCCTGGGCTCTGGG + Intergenic
1159071413 18:63627156-63627178 CTCCTGCAGACCCAGGCTTCAGG + Intergenic
1159411243 18:68078070-68078092 CTCCTGCAAACCCAGGGTTTTGG + Intergenic
1159696196 18:71559481-71559503 CTCCTGCGTTCCCAGGCTTTTGG + Intergenic
1160452491 18:78974697-78974719 CCCCGGGAGGCCCAGGGGTTGGG - Intergenic
1160518314 18:79490360-79490382 CTGGTGCAGGCCCAGGCTCTGGG + Intronic
1160960656 19:1719195-1719217 CGCCTGCAGGCCCGGGCTGCAGG + Intergenic
1161216021 19:3095381-3095403 CCCCTTCAGGGCCAGACCTTTGG + Intronic
1161507517 19:4651886-4651908 CGCCTGCAGAGCCAGGCTCTTGG - Exonic
1161604091 19:5205006-5205028 CCCCTACAGGACCAGGGCTTGGG + Intronic
1161747692 19:6070975-6070997 CGCCTGCAGTCCCACACTTTGGG - Intronic
1161792462 19:6368570-6368592 CCCATGGAGGCCCAGGAGTTTGG + Exonic
1161944767 19:7428748-7428770 CCCCTGCAGGTCGAACCTTTGGG + Intronic
1162031342 19:7918718-7918740 CCGCGGCAGGCGCGGGCTTTGGG + Intronic
1162317057 19:9945869-9945891 CCCCTGCTGGGCCTGGCTTGGGG - Intergenic
1163573146 19:18094914-18094936 CACCTGCAATCCCAGCCTTTCGG + Intronic
1163798283 19:19349578-19349600 GCCCTGCCTGCCCAGGCTGTGGG - Intronic
1163802465 19:19374767-19374789 CACCTGCAGTCCCAGGTATTCGG + Intergenic
1164126381 19:22322268-22322290 CGCCTGCAGTCCCAGGCACTCGG + Intergenic
1164449791 19:28350752-28350774 CCCCAGCAGACCCAGGCTTCAGG + Intergenic
1164566223 19:29327767-29327789 CACCACCAGGCCCTGGCTTTGGG - Intergenic
1166956367 19:46468151-46468173 CCTCTGCAGGCCCTGGCATTTGG - Exonic
1167095481 19:47373042-47373064 CCCAGGCAGGCCCAGTCTGTGGG - Intronic
1167587311 19:50382401-50382423 CCCCTGCCCTGCCAGGCTTTGGG - Intronic
1168630133 19:57949956-57949978 CTTCTGGAGGCCCAGACTTTGGG - Intergenic
924997622 2:377347-377369 CCCCTGAAGCCCCAAGCTCTAGG + Intergenic
925141042 2:1550102-1550124 CTCCATCAGGCCCTGGCTTTGGG + Intergenic
925569731 2:5296120-5296142 CGCCTGCAGTCCCAGCATTTTGG + Intergenic
926120999 2:10241111-10241133 CCCCTGCAGGCCCAGGGGAAGGG + Intergenic
926217520 2:10914463-10914485 CCCCTGCAGGCCCAGGATGGGGG + Intergenic
927256300 2:21043699-21043721 CCCCTGCAGGCTCAGGATGGGGG - Intronic
927403553 2:22742268-22742290 TCCCTGCAGGCCAGGGCTTCTGG + Intergenic
927775222 2:25897551-25897573 CCCCTGTAGTCCCAGCATTTTGG - Intergenic
927856725 2:26532372-26532394 CCCCAGCAGTACCAGGCTTCAGG - Intronic
928656019 2:33452703-33452725 CCCCTGCAGACACAGGCTTTAGG - Intronic
929261865 2:39874958-39874980 CCCCTGCAGTCCCAGCACTTTGG - Intergenic
929544341 2:42846036-42846058 CCCCTGCAGACCCGGGTTTCAGG + Intergenic
929947548 2:46382101-46382123 CCCCAGGAGGCCCAGGCCTGTGG - Intronic
929991130 2:46787922-46787944 CACCTGCAATCCCAGGATTTTGG + Intergenic
930026836 2:47034256-47034278 CCCCTGCAGGCCTGGCCTCTTGG - Intronic
931451486 2:62370754-62370776 CACCTCCAGGGCTAGGCTTTTGG + Intergenic
932311599 2:70746824-70746846 ACCTGGCAGGCCCAGGCTGTGGG - Intronic
932551274 2:72772316-72772338 CCCCTGCAGGACCAGGCTTAAGG + Intronic
933005044 2:76981616-76981638 CCCCTGTAGTTCCAGGCTTCAGG - Intronic
933769544 2:85734333-85734355 CCCCAGCAGGCCAGGGCCTTTGG + Intergenic
934573486 2:95385874-95385896 CCCCTGCCGGCCTTGGCCTTGGG + Exonic
935111560 2:100099009-100099031 CCCCTCCAGGCCCATGCTGAGGG + Intronic
935197209 2:100824319-100824341 CTCCTGCAGTCCCTGGCTTCTGG + Intronic
935883596 2:107591992-107592014 CCCCTACAGGGCCAGGACTTAGG - Intergenic
936123408 2:109766155-109766177 CCCCTCCAGGCCCATGCTGAGGG - Intergenic
936221277 2:110605309-110605331 CCCCTCCAGGCCCATGCTGAGGG + Intergenic
937738398 2:125319102-125319124 CACCTGCAGGCCTAGCCTTCAGG - Intergenic
937916878 2:127103634-127103656 CCCCTGAAGGCCCACGGCTTGGG - Intronic
938055694 2:128213051-128213073 CACCTGCAGTCCCAGCATTTTGG + Intergenic
938411813 2:131071207-131071229 CCCCAGCAGTCCCAGGATTAAGG + Intronic
938577284 2:132616449-132616471 CCCCTACAGGCTCAGGCTTCTGG - Intronic
938675687 2:133631735-133631757 CCCCTGCAGACCCCTGCATTGGG + Intergenic
939143221 2:138379713-138379735 CCCCAGCAGCCCCAGGCTCTAGG + Intergenic
941221497 2:162787312-162787334 CTCCTGCAGACCCAGGTTCTAGG + Intronic
941451772 2:165668525-165668547 CACCTGCAGTCCCAGGTATTTGG - Intronic
942201177 2:173572973-173572995 CCCCTGGAGGCTCAGGCTGGAGG + Intergenic
943126760 2:183803890-183803912 CCCCTGCAGCCCCAGGCAAAAGG - Intergenic
943203488 2:184860485-184860507 CCCCTGCAGCCCTAGTCATTAGG - Intronic
944393711 2:199246218-199246240 CTCCTGGAGGCCCAGCCTTGGGG - Intergenic
945932181 2:215866161-215866183 CACCTGAAGGGCCAGGCTCTTGG + Intergenic
947248943 2:228079640-228079662 CCCCTGCAGACTCAGGCTCAAGG + Intronic
948845090 2:240679295-240679317 GCCCTGCAGGCCCAGTGTGTGGG + Intronic
948848770 2:240695584-240695606 GCCCTGCAGGCCCAGTGTGTGGG - Intronic
949044911 2:241867969-241867991 CCCCTGTGGACCGAGGCTTTTGG + Intergenic
1168799146 20:633486-633508 TCCCTGCTGGGCCAGGCCTTGGG + Intergenic
1169339752 20:4787327-4787349 CACCCAGAGGCCCAGGCTTTTGG - Intronic
1170749929 20:19136550-19136572 GCCTTGCAGACCCAGCCTTTAGG + Intergenic
1170766210 20:19291748-19291770 CTCCTGCAGGCCCAGGGCTGGGG - Intronic
1170814314 20:19699811-19699833 CCACTGGAGGCTGAGGCTTTTGG + Intronic
1171179828 20:23084388-23084410 CTCCTGCTGGCCCTGGCTCTGGG - Exonic
1171333460 20:24361498-24361520 CTCCTCCAGGCACAGGCCTTAGG - Intergenic
1171936169 20:31277435-31277457 CTCCTGCAGACCCAGGCTCAAGG - Intergenic
1172152725 20:32801708-32801730 CCCCTGTAGTCCCAGCCATTTGG - Intronic
1173453927 20:43189186-43189208 CCCCAGCAGGCCGAGGCTGCCGG - Intronic
1173594272 20:44248363-44248385 CCCCTGCAGGACCTGCCTCTGGG - Intronic
1173662750 20:44745646-44745668 CTTCTGCAGGCCCGGGGTTTGGG + Intergenic
1173720341 20:45252926-45252948 CCTCTGGAGGCCCAGGCATATGG - Intronic
1174035154 20:47664200-47664222 CCCCCCCAGCCCCAGGCTTCAGG + Intronic
1174173191 20:48629540-48629562 TCCCAGCAGCACCAGGCTTTGGG + Exonic
1174366923 20:50062043-50062065 GCCCTGCTGGCCCAGTCTCTGGG + Intergenic
1174658659 20:52192042-52192064 CACCTGCAACCCCAGGCGTTGGG + Intronic
1175503565 20:59466895-59466917 CCCCTGCAGCCCCAGCCGCTTGG - Intergenic
1175895523 20:62334086-62334108 CCCTTGAAGGCCCAGGCCTCAGG - Intronic
1176241602 20:64078186-64078208 CCTCTGCATGCCCAGGCCTCGGG - Intronic
1176285243 21:5015941-5015963 CCCCTGCAGGCTTGGGCTGTGGG + Intergenic
1177941413 21:27416663-27416685 CTCCTGCAGACCCAGGCATCAGG - Intergenic
1179390904 21:40990377-40990399 CCCCTGCAGACTCAGGCTGAAGG - Intergenic
1179618252 21:42595571-42595593 ACCTTGCAGGCCCATGCTGTGGG + Intergenic
1179838382 21:44053091-44053113 CCCCTGAATCCCCAGGCCTTGGG - Intronic
1179871938 21:44247534-44247556 CCCCTGCAGGCTTGGGCTGTGGG - Intronic
1179996376 21:44976262-44976284 CCTCTGCCGGCTCAGGCTCTCGG + Intronic
1180709022 22:17827164-17827186 CGTCTCCAGCCCCAGGCTTTAGG - Intronic
1180939266 22:19646289-19646311 CACCTGCAGTCCCAGCATTTTGG - Intergenic
1181318237 22:21985030-21985052 CTCCTGCTGGCCCAGGCCTCAGG - Intergenic
1182126649 22:27820948-27820970 CCCCTGTGGGACCAGGCATTGGG - Intergenic
1182384346 22:29923462-29923484 CCCCTGCAGTCCCAGCACTTTGG - Intronic
1182736289 22:32533882-32533904 TCCCTGCAGGTACAGGCTGTGGG - Exonic
1182978942 22:34649775-34649797 CCTCTCCTGGCCCAGGCCTTGGG - Intergenic
1183287637 22:36977430-36977452 CCCCAGCAGGCCAAGGCTGTGGG + Intergenic
1183499447 22:38169582-38169604 TCCCTCCAGGCCCAGGATCTGGG - Intronic
1183540513 22:38426918-38426940 CGCCTCCAGGCCCAGGCCTGCGG + Exonic
1184128702 22:42504564-42504586 CCTCTGCAGCCCCAGGCAGTGGG + Intergenic
1184137497 22:42557879-42557901 CCTCTGCAGCCCCAGGCAGTGGG + Intronic
1184232088 22:43163648-43163670 CCCCCGGGGGCCCAGGCTTATGG + Intergenic
1184322668 22:43754394-43754416 CCCCTGCCTGCCCAGGGTTGGGG + Intronic
1184636836 22:45839406-45839428 CCCCTGCAGCCCCAGGCTTCAGG - Intronic
1184682261 22:46078719-46078741 CCCTCCCAGGGCCAGGCTTTTGG + Intronic
1185071404 22:48658749-48658771 CCCCTGCTGGCCCAGACCTAGGG + Intronic
1185330374 22:50249586-50249608 TCCCTGCAGCCCCAGTTTTTGGG - Intronic
949539886 3:5024102-5024124 CGCCTGTAGTCCCAGGATTTTGG - Intergenic
950183179 3:10929135-10929157 CTCCTGGTGGCCCAGGCTCTGGG - Intronic
950413541 3:12854965-12854987 ATCCTGCAGGGCCAGGCTTCTGG - Intronic
950569396 3:13790752-13790774 CCCCTTCAGGCCCAGGGTGGTGG + Intergenic
950615032 3:14151471-14151493 ACCCTGCAGGCCCAGGCAGGGGG + Intronic
950747062 3:15099070-15099092 CCCCTTCAGGCCCGGGCTCTGGG + Exonic
950760645 3:15221707-15221729 CCCCTGCAATCCCAGCATTTTGG + Intronic
951022336 3:17793963-17793985 CTCCTGCAGTCTCAGGCTTCAGG - Intronic
952889019 3:38029074-38029096 TCCAGGCACGCCCAGGCTTTGGG + Intronic
953655605 3:44850999-44851021 CACCTGTAGTCCCAGGATTTTGG + Intronic
954220878 3:49153211-49153233 CACCTGCAGGCGAAGGCTTAGGG + Intergenic
954301963 3:49704987-49705009 CCCATGCAGGCCCTGGCTGTTGG + Exonic
954464278 3:50645626-50645648 CCCCACCTTGCCCAGGCTTTAGG + Intronic
954716861 3:52531327-52531349 CCCCTCAAGGCCCAGGGTTCTGG + Intronic
955733308 3:62010176-62010198 CACCTGAAATCCCAGGCTTTGGG - Intronic
959111125 3:102123792-102123814 CCCCAACAGACCCAGGCTCTAGG - Intronic
960562138 3:119096252-119096274 CCCCTTATGGCCCAGGCTTTTGG + Intronic
960583631 3:119301263-119301285 CTTCAGGAGGCCCAGGCTTTGGG + Intronic
960770912 3:121191411-121191433 CGCCTGCAATCCCAGGCATTCGG + Intronic
961157574 3:124693174-124693196 CCCATGCAGGCCTGGGCTATAGG + Intronic
961629072 3:128283107-128283129 CCCTTTCAGGCACTGGCTTTGGG + Intronic
961658818 3:128457653-128457675 CCCCTGCCTGGCCAGGCCTTAGG + Intergenic
961711054 3:128828490-128828512 GCCATGCAGGTCTAGGCTTTTGG + Intergenic
961749646 3:129087760-129087782 CCCCTGCAGGGCCTGGACTTGGG - Exonic
962230160 3:133658339-133658361 CACCTGCAGTCCCAGTCTCTAGG + Intronic
962827128 3:139108191-139108213 CCCCTCCTGGCCCAGGCTGAAGG - Intronic
963103434 3:141625723-141625745 CACCTCCAGGCCCAGGCCTCAGG + Intergenic
963142670 3:141960543-141960565 GCCCTGCAGGGACAGGGTTTGGG + Intronic
963763185 3:149306615-149306637 ACCCTGGAGGCCAAGGCTTCAGG + Intergenic
964640944 3:158910023-158910045 GCCCTCCAGGCCCAAGCTGTGGG + Intergenic
964720814 3:159765480-159765502 CCCCCGCAGGCACTGACTTTTGG - Intronic
965113949 3:164463455-164463477 AACCTGCAGGCACAGGCTGTGGG + Intergenic
967168557 3:186806114-186806136 ATCTTGCAGGCCCCGGCTTTGGG - Intronic
967636133 3:191804945-191804967 CCCCTGCAGCCCCAGGTTTCAGG + Intergenic
968475146 4:801637-801659 ACCCTGCACGCCCAGGCTGTTGG - Intronic
968573264 4:1353492-1353514 CCCCTGCATCCCCAGGCTCCTGG - Intronic
968672971 4:1862298-1862320 TCGCTGCAGGCACAGGGTTTAGG + Intergenic
968702554 4:2063751-2063773 CCCCTGCAGGCTCCTGCTTCTGG + Exonic
968761401 4:2444237-2444259 ACCCTGCAGGCCCAGGCCATGGG - Intronic
969251076 4:5969278-5969300 TCCTTGGAGGCCCAGGCTTAGGG + Intronic
969453054 4:7285922-7285944 ACACTGCAGCCCCAGGCTGTCGG - Intronic
969563249 4:7962705-7962727 CCTCTGCTGGCTCAGGCTTCTGG + Intergenic
969716347 4:8870158-8870180 CCTCTGCAGGCTCCGGCTCTGGG - Intronic
970206267 4:13658609-13658631 CACCTGTAGGCCCAGCCCTTTGG + Intergenic
970353893 4:15233483-15233505 CCACGGCAGACCCAGGCTCTTGG - Intergenic
970441218 4:16082811-16082833 CCCCTCCAGACACGGGCTTTCGG + Intronic
971715463 4:30169827-30169849 TCTCTGCAGGCCCAGGTTCTGGG + Intergenic
972045680 4:34663153-34663175 ACCCTGCAGACTCAGGCTTCAGG - Intergenic
972357891 4:38298321-38298343 ACCCTGAAGACCCAGGCTCTAGG + Intergenic
973152539 4:46906294-46906316 CCCCTGGAGGCTCAGGCTTCAGG - Intronic
975421170 4:74166686-74166708 TCCTTGCAGACCCAGGCTCTAGG + Intronic
975949320 4:79748934-79748956 CCCCTCCAGCCTCAGGCTTCAGG + Intergenic
975949356 4:79749123-79749145 CCACAGCAGCCCAAGGCTTTGGG + Intergenic
976292721 4:83437486-83437508 CACCTGCAGTTCCAGGCTATGGG + Intronic
977515511 4:98017068-98017090 CCCCTGCAGACTCAGGCTTCAGG - Intronic
979285272 4:118916431-118916453 CCCCTGTAGTCCCAGCATTTTGG - Intronic
982723704 4:158883499-158883521 CGCCTGTAATCCCAGGCTTTTGG - Intronic
983908136 4:173205944-173205966 ATCCTGCAGCCCCAGGCTCTAGG - Intronic
985077077 4:186226598-186226620 CCCCTGCAGACGCAGGCTTAAGG - Intronic
985084623 4:186299608-186299630 TCTCTGCACCCCCAGGCTTTGGG - Intergenic
985119680 4:186627558-186627580 CCCCAGCAGGCCCCAGCTCTGGG + Intronic
985638751 5:1053221-1053243 CTCCTTCAGCCCCAGGCTCTGGG - Intronic
985720620 5:1486786-1486808 CACCTGCAGGCCCGGGTTTCCGG - Intronic
985775206 5:1837720-1837742 CCCCTGCAGGCCCAGGCAGCTGG - Intergenic
989663604 5:43825236-43825258 CCCCTGCAATCCCAGGCACTTGG + Intergenic
992954200 5:81890958-81890980 CACCTGCAGGCCCAGCCTTGTGG - Intergenic
994785440 5:104155346-104155368 CACCTGTAATCCCAGGCTTTAGG - Intergenic
994790960 5:104224536-104224558 CCCCTGCAGATCCAGGCCTCTGG - Intergenic
995185625 5:109267591-109267613 CACCTGCAGACCCAGCCTCTAGG + Intergenic
995827031 5:116312035-116312057 CCCCTGCAGGCCCAGGTACTTGG - Intronic
996304166 5:122027284-122027306 CACCTGCAGTCCCAGCCCTTTGG - Exonic
996352154 5:122556298-122556320 CACCTGCAGTCCCAGGCACTTGG - Intergenic
997535072 5:134614044-134614066 CACCTGTAAGCCCAGACTTTGGG + Intronic
999357986 5:150955287-150955309 GCCCTGCAGCCCCAGGCTCTAGG - Intergenic
999993306 5:157068321-157068343 CACCTGTAGGCCCAGCCCTTTGG + Intergenic
1000469123 5:161617899-161617921 CCCCTGTAATCCCAGTCTTTGGG + Intronic
1001480602 5:172086675-172086697 CCCCTGCTGGCCCAGGCCCCTGG - Intronic
1001582858 5:172811273-172811295 CGCCTGGAATCCCAGGCTTTGGG + Intergenic
1001630048 5:173168263-173168285 CCCGGGAAGGCCCAGGCTGTGGG - Intergenic
1001931615 5:175677247-175677269 CACCTGCAGTCCCAGCATTTTGG - Intronic
1002000061 5:176192329-176192351 GCCCTGCAGGCCCAGGTCCTGGG - Intergenic
1002184373 5:177447285-177447307 CCCCTGCACCCCCGGGCTGTGGG - Intronic
1002322172 5:178382655-178382677 CCCCTCCAGTCCCAGGAGTTGGG + Intronic
1002515394 5:179754332-179754354 CGCCTGCAGTCCTAGCCTTTTGG + Intronic
1002579184 5:180197280-180197302 CCCCTGCCGTCCCAGGGTTCGGG - Intronic
1002680939 5:180963459-180963481 CCCCTGCAGACTCAGGCTCAAGG - Intergenic
1003303330 6:4904519-4904541 CCCCTCCCTGCCCTGGCTTTTGG + Intronic
1003645407 6:7910230-7910252 CCCCTGCAGTCCCCGGCTCCCGG + Intronic
1004676327 6:17846214-17846236 CCCCTGTAGTCCCAGCATTTTGG - Intronic
1004902810 6:20209816-20209838 CCCCTGCAGGCTGAGGCCTTGGG + Intronic
1006139702 6:31920894-31920916 ACCCTGCAGGCCCAGACACTGGG - Intronic
1007107591 6:39294413-39294435 TCTCTGCAGGCCCTGGCTTTGGG - Intergenic
1007476913 6:42125091-42125113 GCCCAGCAGGCCCAGGCTGCTGG + Intronic
1007681493 6:43636642-43636664 CCCAGGTAGGCACAGGCTTTGGG + Exonic
1008634341 6:53394602-53394624 TCCCTGCAGACCCAGGACTTTGG + Intergenic
1011699228 6:89940268-89940290 CCCCTGTAAGCCCAGCATTTTGG - Intronic
1011945118 6:92890879-92890901 CCCCAGCAGCCCCAGGCTTTAGG - Intergenic
1012892535 6:104912914-104912936 CACCTGCAGTCCCAGCATTTTGG + Intergenic
1013003779 6:106051325-106051347 CCCCCGCAGACCCAGTCTTAGGG + Intergenic
1013456154 6:110331396-110331418 CACCTGCAGTCCCAGCCCTTTGG + Intronic
1015459585 6:133473773-133473795 CCCTTGCAGGGCCAGGATTAGGG + Intronic
1015842371 6:137489046-137489068 ACTCTGCAGGCCCGAGCTTTCGG + Intergenic
1015994886 6:138987738-138987760 CCCCTGCCGGCCCAGGTTCCTGG - Exonic
1017275025 6:152556415-152556437 CCCCTTCAGACCGAGGATTTGGG + Intronic
1017900695 6:158716345-158716367 CCCAAATAGGCCCAGGCTTTGGG + Intronic
1018270357 6:162070877-162070899 CCCCTGCTGGCCCAGGGCTTGGG + Intronic
1019022046 6:168927502-168927524 CTCCTGAAAGCCTAGGCTTTGGG + Intergenic
1019461541 7:1161520-1161542 CACCTGCAGTCCCAGCCTCTTGG + Intergenic
1019526129 7:1481272-1481294 CCCCAGCCCGGCCAGGCTTTTGG - Intronic
1019548346 7:1589462-1589484 CCCCTGCACCCACAGCCTTTTGG + Intergenic
1019946036 7:4330118-4330140 CACCTGCAGTCCCAGCATTTTGG - Intergenic
1019989923 7:4683456-4683478 GCCCTGCGAGCCCAGGCTTGTGG - Intronic
1020127049 7:5538959-5538981 GGCCTGCAGGCCTAGGCTGTGGG + Intronic
1020138979 7:5602295-5602317 CTCCTGCAATCCCAGCCTTTTGG - Intronic
1020481568 7:8668808-8668830 CCCCTGCAGACCCAGGCTCCAGG - Intronic
1021278032 7:18680158-18680180 CCACTGCAGTTCTAGGCTTTTGG - Intronic
1021302845 7:18993539-18993561 CCCCTGTAGTCCCAGCATTTTGG + Intronic
1021466603 7:20951337-20951359 CACCTGCAGTCCCAGCTTTTTGG + Intergenic
1021912133 7:25396822-25396844 CCCATGCAGGCCCTGCCTCTGGG - Intergenic
1022288026 7:28974170-28974192 CCCCAGGAGGTCCAGACTTTAGG - Intergenic
1024009657 7:45256948-45256970 CCCCTGAGGACCCAAGCTTTAGG + Intergenic
1024704105 7:51938618-51938640 CCCCTGAAGTCCCAGGCCATAGG - Intergenic
1026513731 7:71049272-71049294 TCCCTGCAGCCCCAGGCTCCAGG + Intergenic
1026994593 7:74607047-74607069 TCCCTGGAGGCCTGGGCTTTGGG + Intergenic
1026999659 7:74643614-74643636 CCCCTGCAGCCCCAGGCCCTCGG - Intergenic
1027254780 7:76424211-76424233 CCCCTGCTGGCCCTGCCCTTAGG - Intronic
1027471596 7:78581182-78581204 GAGCTGCAGGCCCAGGCTTGGGG + Intronic
1027624439 7:80528995-80529017 CCCCTGTAAACCCAGGCTTCAGG + Intronic
1027980800 7:85219130-85219152 CCTCTGTATGCCCAGGCTTGTGG + Intergenic
1029711449 7:102302239-102302261 TCCCTGCAGGCCTCGGCTCTGGG - Intronic
1030056398 7:105587206-105587228 CCCCTATCTGCCCAGGCTTTTGG + Intronic
1032263531 7:130354853-130354875 CGCCTGCAGTCCCAGCCATTCGG - Intronic
1032355600 7:131207703-131207725 CCTCTGTGGGCCCAGGCTTCTGG - Intronic
1033368512 7:140689338-140689360 CAGCTGCAGGCCCCAGCTTTGGG - Intronic
1033616704 7:143023375-143023397 CCCCAGCATGCCCAGGATGTGGG + Intergenic
1033728476 7:144147367-144147389 CTCCAGCAGACCCAGGGTTTAGG + Intergenic
1034338977 7:150340514-150340536 CACCTGCAGGCCCCGGCGCTGGG + Exonic
1034559046 7:151867974-151867996 CCCCTCCAGGACCAGGCCTTTGG + Intronic
1034583943 7:152072057-152072079 CCCCTGTAATCCCAGGATTTTGG + Intronic
1035585671 8:771449-771471 CTAGTGCAGGCCCAGGATTTTGG - Intergenic
1035816561 8:2547396-2547418 CCCCTGTAATCCCAGCCTTTTGG - Intergenic
1036191175 8:6671550-6671572 CCCCTTCAGACCCTGGCTGTGGG - Intergenic
1036644015 8:10601091-10601113 GCCCTGCAGGCCCAGGCATCTGG + Intergenic
1037440812 8:18913922-18913944 CCCCTGCAGATCCATGCTCTGGG + Intronic
1037539042 8:19854626-19854648 GAACTGCAGGCTCAGGCTTTTGG + Intergenic
1037885692 8:22595018-22595040 CCCCTGCCAGCCTAGGATTTTGG + Intronic
1037963194 8:23115155-23115177 CCCCAGCAGGCCCAGGCTTTGGG + Intronic
1038332941 8:26623866-26623888 CCCCTGAAAGCTCAAGCTTTGGG - Intronic
1038382805 8:27112803-27112825 CCCCAGCAAGCCCAGGCTGCAGG + Intergenic
1039067025 8:33617719-33617741 ACCCTGCAGACCCAGGCTTTAGG - Intergenic
1039855193 8:41406063-41406085 CGCCTGTAATCCCAGGCTTTGGG - Intergenic
1040395207 8:46992225-46992247 CCCCTGTAAGCCCAGCATTTTGG - Intergenic
1043993817 8:86788366-86788388 CACCTGTAGTCCCAGGCATTTGG - Intergenic
1045291222 8:100834395-100834417 CCCCTGCAGTCCCAGCCACTTGG + Intergenic
1046735941 8:117777233-117777255 CGCCTGCAGTCCCAGGCACTGGG - Intergenic
1047274965 8:123398762-123398784 CACCTGTAATCCCAGGCTTTGGG - Intronic
1047762118 8:127962098-127962120 CCCCTGCAGGCCCAGCTACTTGG - Intergenic
1048982324 8:139709424-139709446 CCTCTGCAGGGCCAGGAGTTGGG + Intergenic
1049475440 8:142795032-142795054 CTCCTGCAGGCAGAGGCTGTGGG + Intergenic
1049507012 8:143008245-143008267 CACCGGCAGGCCCAGGCCTGTGG + Intergenic
1049696248 8:143985602-143985624 CCCCTCCAGGCCCAGATTCTGGG + Exonic
1049786569 8:144453799-144453821 CCCCTACAGGTCCAGAGTTTGGG + Intronic
1049833989 8:144721283-144721305 CCTATCCAGGCCCAGGCTTGTGG - Exonic
1049932686 9:471640-471662 CCCCTGCAATCCCAGGGTTCTGG + Intronic
1050728258 9:8676832-8676854 CGCCTGCAGTCCCAGCCCTTTGG - Intronic
1050987382 9:12100954-12100976 CCCCTACATGTCCAGGGTTTGGG - Intergenic
1052016289 9:23472105-23472127 CCCATGCAGGACCAGCTTTTTGG - Intergenic
1052072536 9:24100158-24100180 CCCCCACAGACCCAGGTTTTAGG + Intergenic
1052606862 9:30715264-30715286 CCCCTGTGGCCCCAGGCTTTGGG - Intergenic
1055591482 9:77819405-77819427 CCACAGCAGGCCAAGCCTTTAGG + Intronic
1056921015 9:90789393-90789415 CCCCAGCAGGGGCAGGCCTTGGG + Intergenic
1057636624 9:96775318-96775340 CCCCTGCAATCCCAGCATTTTGG - Intronic
1058013411 9:100003721-100003743 CCCCTGCAGACTCAGGCTCAAGG - Intronic
1058133414 9:101278841-101278863 CCTCAGCAGCCCCAGGTTTTGGG + Intronic
1058375337 9:104316185-104316207 CGCCTGCAGTCCCAGGCACTGGG - Intergenic
1059139210 9:111836036-111836058 CACCTGCAGTCCCAGGTATTCGG - Intergenic
1061097252 9:128465613-128465635 CTCCTGTAGGCCCAGCCATTTGG + Intronic
1061386112 9:130290219-130290241 CCCCTGTAGGGCCAGGCCTGGGG - Intronic
1061698287 9:132394765-132394787 CGCCTGCAGTCCCAGCCTCTTGG + Intronic
1061922770 9:133791246-133791268 CCTCTGCAGGGCCAGACTCTGGG + Intronic
1062614776 9:137391383-137391405 CCTCAGCAGGCCCAAGCTGTAGG + Intronic
1203441772 Un_GL000219v1:16015-16037 CACCTGCAGGCCCCGGCGCTGGG + Intergenic
1203512582 Un_KI270741v1:134924-134946 CACCTGCAGGCCCCGGCGCTGGG + Intergenic
1185895630 X:3856130-3856152 CCACTGCAGGCAGAGGCATTTGG + Intergenic
1185900749 X:3894554-3894576 CCACTGCAGGCAGAGGCATTTGG + Intergenic
1185905865 X:3932993-3933015 CCACTGCAGGCAGAGGCATTTGG + Intergenic
1187228602 X:17398785-17398807 CCTCTTGAGGCCCAGGCTTAGGG + Intronic
1188771827 X:34162733-34162755 CCCCTGTGGGCCCAGACTTCAGG - Intergenic
1189532604 X:41901951-41901973 CCCCTGCAGACCCAGTCTTCAGG - Intronic
1189551775 X:42101097-42101119 CCCCTGGAGTTCCAGGCATTGGG + Intergenic
1189892025 X:45612791-45612813 CCCCTGCAGACTCAGGCTTCAGG + Intergenic
1190954214 X:55175631-55175653 CCACTGCAGGCCCAACCTTCTGG - Intronic
1191112940 X:56821913-56821935 ATCCTGCAGACCCAGGCTCTAGG + Intergenic
1191197504 X:57740736-57740758 CCCCTGTAGCACCAGGCTCTAGG - Intergenic
1191700673 X:64038568-64038590 CAGCTTCAGGCCTAGGCTTTTGG + Intergenic
1191807078 X:65147467-65147489 CCCCTATAGACCCAGGCTTCAGG - Intergenic
1191910426 X:66143841-66143863 CCCCTGCAGACCCAGGATCTGGG - Intergenic
1192382752 X:70635633-70635655 CCCCCGTAGCCCCAGGCTTCAGG + Intronic
1192382785 X:70635773-70635795 CCCCTGCAGCCCCAGGATCCAGG + Intronic
1192771369 X:74195476-74195498 CCCCTGAAGCCCCAGGCTTCAGG - Intergenic
1192788199 X:74354711-74354733 CTCCTGAAGCCCCAGGCTTCAGG + Intergenic
1192805441 X:74504728-74504750 CGCCTGCAGTCCCAGCATTTTGG + Intronic
1193023665 X:76821198-76821220 CCCCTGCAGACACAGGCTTTAGG - Intergenic
1193994911 X:88353259-88353281 CAGCTGCAGACCCAGACTTTAGG + Intergenic
1194916850 X:99717929-99717951 CCCCTGTAGACTCAGGCTTCAGG + Intergenic
1195135915 X:101906992-101907014 CCCCTGCAGACTCAGGCTCCAGG + Intronic
1195816518 X:108894573-108894595 CCCCTGCAGACTCAGGCTCATGG + Intergenic
1197043746 X:121970930-121970952 CCCCTGTAGACTCAGGCTTCAGG + Intergenic
1197122940 X:122913718-122913740 CCCCTGTTGACCTAGGCTTTAGG - Intergenic
1197846733 X:130811080-130811102 CCCCTGCAGACTCAGGCTCTAGG + Intronic
1198594906 X:138225741-138225763 CCCCTCCTGACCCAGGCTATAGG - Intergenic
1199021651 X:142885223-142885245 TCCCTGCATTCTCAGGCTTTGGG + Intergenic
1199106057 X:143870049-143870071 CTCCTGCAGGCCCAGTCTTATGG + Intergenic
1201013058 Y:9568810-9568832 TCGCTGCAGGCCCATGCTATTGG - Intergenic