ID: 1152438022

View in Genome Browser
Species Human (GRCh38)
Location 17:80288075-80288097
Sequence GCAGGCCCAGGCTTTGGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 491}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152438008_1152438022 13 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG 0: 1
1: 1
2: 3
3: 47
4: 491
1152438006_1152438022 30 Left 1152438006 17:80288022-80288044 CCACTGGAGGGTGACGGCCTCTC 0: 1
1: 0
2: 0
3: 16
4: 119
Right 1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG 0: 1
1: 1
2: 3
3: 47
4: 491
1152438013_1152438022 -1 Left 1152438013 17:80288053-80288075 CCGAGGTTGGCGACAGCCCCCTG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG 0: 1
1: 1
2: 3
3: 47
4: 491
1152438010_1152438022 8 Left 1152438010 17:80288044-80288066 CCGCGCCCACCGAGGTTGGCGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG 0: 1
1: 1
2: 3
3: 47
4: 491
1152438012_1152438022 2 Left 1152438012 17:80288050-80288072 CCACCGAGGTTGGCGACAGCCCC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG 0: 1
1: 1
2: 3
3: 47
4: 491
1152438011_1152438022 3 Left 1152438011 17:80288049-80288071 CCCACCGAGGTTGGCGACAGCCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG 0: 1
1: 1
2: 3
3: 47
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152438022 Original CRISPR GCAGGCCCAGGCTTTGGGAG AGG Exonic
900180345 1:1308458-1308480 GCGGGGCCGGGCTTAGGGAGCGG - Intronic
900435686 1:2629524-2629546 GCAGGCCCAGGGCAGGGGAGAGG + Intronic
900581894 1:3413512-3413534 GCAGGGCTAGGCTTGGGGAGGGG + Intronic
900692226 1:3987731-3987753 GGTGGCCCAGGCTTGGGGACAGG + Intergenic
900692302 1:3988003-3988025 GGTGGCCCAGGCTTGGGGATAGG + Intergenic
900692316 1:3988045-3988067 GGTGGCCCAGGCTTGGGGATGGG + Intergenic
901018346 1:6244019-6244041 GGAAGCCTAGGCTATGGGAGGGG + Intergenic
901061885 1:6475391-6475413 GAAGGCCCAGGCTCGGGGAAGGG + Intronic
901202487 1:7474638-7474660 CCTGGCTCAGGCTTTGGGAGGGG - Intronic
903067829 1:20710700-20710722 TCAGGCCCCTGCTGTGGGAGAGG + Intronic
903646410 1:24898743-24898765 GCAGGGCAAAGCTTTGGGAGTGG + Intergenic
903770285 1:25759471-25759493 GGAAGACAAGGCTTTGGGAGTGG - Intronic
903847232 1:26285663-26285685 AGAGTCCCAGGCCTTGGGAGAGG + Intronic
904009673 1:27382640-27382662 GGAGCTCGAGGCTTTGGGAGGGG - Exonic
904357242 1:29948309-29948331 CCAGGCCAAGGCTCTGGCAGTGG - Intergenic
905561643 1:38931943-38931965 GCTGGCCCAGACTTAAGGAGAGG - Intronic
906731545 1:48085921-48085943 ACTGGCTCAGGCTTTGCGAGAGG - Intergenic
907191851 1:52655985-52656007 GCAGGACCTGGCTTTGTGAAAGG + Intronic
907237762 1:53063204-53063226 GCAGCCGCAGCCTTTTGGAGAGG + Intronic
907320470 1:53599070-53599092 GCAGCCCCAGGCAGTGGGTGAGG + Intronic
907498207 1:54859324-54859346 GAAGGTCAAGGATTTGGGAGTGG - Intronic
908179956 1:61593784-61593806 CAGGGCCCAGGCTGTGGGAGGGG - Intergenic
910569642 1:88684815-88684837 GCAGGCCAGGGCTTTGGCGGGGG - Intronic
912261310 1:108113735-108113757 GCAGGACCAGGATTAGGGTGAGG + Intergenic
912562732 1:110561963-110561985 CCAGTCCCAGGCTTGGAGAGTGG + Intergenic
912651205 1:111441246-111441268 GCAGGTCCAGGGGCTGGGAGAGG + Exonic
914429573 1:147608622-147608644 GCAAGTCCAGGTATTGGGAGTGG + Intronic
915135488 1:153728464-153728486 GCAGGCGCGGCCTTTTGGAGAGG + Exonic
915311803 1:155008897-155008919 GGAGGGCCAGGCTTGGGGGGAGG - Intronic
915593099 1:156881646-156881668 GCCGGCCCAGGGGCTGGGAGTGG + Intronic
915895609 1:159808928-159808950 GCAGGCCCAGGACTCAGGAGGGG - Intronic
915920677 1:159973292-159973314 GCAGGCCCAGGGCTCAGGAGGGG + Intergenic
916442038 1:164836654-164836676 GCAGGCCCAGGCTTGGGGGTGGG - Intronic
916576055 1:166067491-166067513 TCAGGCCCAGGCATTTTGAGGGG + Intronic
917417760 1:174828494-174828516 GAAGGCAGAGGCTTTGGGAGTGG + Intronic
917558913 1:176123908-176123930 GCAGGCCTGGGGTTTGGGAGTGG - Intronic
917792240 1:178506369-178506391 GCAGGCCCAGGCTCCGGGCCAGG - Intergenic
920041894 1:203103445-203103467 CCACGCACAGGCTTTGGGATGGG - Intronic
920176884 1:204107638-204107660 GCAGGCCTGTGCTTGGGGAGGGG + Intronic
920206101 1:204293066-204293088 GCAAGCCCACACTGTGGGAGTGG + Intronic
920232623 1:204480668-204480690 GCAGGGCCAGGCTGTGTGGGTGG + Intronic
921430332 1:215058030-215058052 GCAGCCCCAGGAATAGGGAGTGG + Intronic
922721256 1:227901350-227901372 GCTGGCCAAGGGCTTGGGAGAGG - Intergenic
922797700 1:228349138-228349160 GCAGGGGCAGGTTTAGGGAGAGG + Intronic
1063208303 10:3855611-3855633 GGAGGTTCAGGCTTTGGTAGGGG - Intergenic
1063300937 10:4848373-4848395 TCACGCCCAGGCGTTGGTAGAGG + Intergenic
1063447358 10:6127712-6127734 CCAGGGCCAGTCTCTGGGAGAGG + Intergenic
1063918821 10:10911623-10911645 CCAGGCCCAGGCTTGCGGAGAGG - Intergenic
1065149409 10:22806734-22806756 GCAGGCCCAGGCTGGAGGATGGG - Intergenic
1066517690 10:36182291-36182313 GCAAGCACAGCCTCTGGGAGAGG + Intergenic
1067051969 10:43026784-43026806 GCAGACCCAGGCGGTGGGGGAGG - Intergenic
1067226851 10:44382328-44382350 GCAGGCCCCGGCCCTGGGGGTGG - Intronic
1067469682 10:46527541-46527563 GCAAGCCCAAGCCTTGGGACTGG + Intergenic
1067733008 10:48826772-48826794 GAAGGCCGAGGCATTCGGAGAGG - Exonic
1067763996 10:49071557-49071579 GCAGTGCCAGGCTTGGGGTGAGG + Intronic
1068522583 10:58093971-58093993 CCAGGCCCAGGCTGTGGGGCCGG + Intergenic
1068643495 10:59438250-59438272 ACAGCCCCAAGCTGTGGGAGGGG - Intergenic
1068692659 10:59932825-59932847 GCAGGCCTATTCTTAGGGAGTGG - Intergenic
1069631140 10:69897610-69897632 CCAGGCCCCGGCAGTGGGAGCGG + Intronic
1069658032 10:70104953-70104975 GCAGGCCCACCCTGTGGCAGGGG + Intronic
1069756310 10:70776207-70776229 GCAGGCAGAGGCCTGGGGAGAGG - Intronic
1070321875 10:75360510-75360532 GCAGGGCCAGGAATAGGGAGAGG - Intergenic
1070506598 10:77118739-77118761 GCATGCCCAGGGGTTGAGAGGGG - Intronic
1074163417 10:110853309-110853331 GCAGAACCAGGCTCTGGGTGAGG - Intergenic
1074350263 10:112729942-112729964 GCATGCCCAGCCTTTGGCTGTGG - Intronic
1074844635 10:117386750-117386772 GCAGGACCAGGATTAGGGTGAGG - Intergenic
1075105643 10:119538464-119538486 GGGGACCCAGGCTTTGGGACAGG + Intronic
1075419006 10:122287059-122287081 CCAGGCTCAGGCTCAGGGAGGGG - Intronic
1075721501 10:124590240-124590262 GCAGGCACTGGCTTTGGTTGAGG + Intronic
1076266042 10:129110620-129110642 GCAGGCAGAGGCTCTGGAAGTGG + Intergenic
1076612699 10:131736610-131736632 GCAGGCCCGGGCTCCAGGAGAGG + Intergenic
1076819184 10:132930338-132930360 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819222 10:132930487-132930509 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819231 10:132930515-132930537 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819241 10:132930546-132930568 GAAGGCCCAGGCTCTGTGTGCGG - Intronic
1076819256 10:132930604-132930626 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819274 10:132930662-132930684 GAAGGCCCAGGCTCTGCGTGGGG - Intronic
1076819299 10:132930749-132930771 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819309 10:132930780-132930802 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819319 10:132930811-132930833 GAAGGCCCAGGCTCTGCGTGGGG - Intronic
1076819329 10:132930842-132930864 GAAGGCCCAGGCTCTGTGTGAGG - Intronic
1076819337 10:132930873-132930895 GAAGGCCCAGGCTCTGCGTGGGG - Intronic
1076819347 10:132930904-132930926 GAAGGCCCAGGCTCTGTGTGAGG - Intronic
1076819367 10:132930986-132931008 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819384 10:132931044-132931066 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819402 10:132931102-132931124 GAAGGCCCAGGCTCTGCGTGGGG - Intronic
1076819427 10:132931189-132931211 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819437 10:132931220-132931242 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819447 10:132931251-132931273 GAAGGCCCAGGCTCTGCGTGGGG - Intronic
1076819457 10:132931282-132931304 GAAGGCCCAGGCTCTGCGTGGGG - Intronic
1076819467 10:132931313-132931335 GAAGGCCCAGGCTCTGCGTGAGG - Intronic
1076819483 10:132931372-132931394 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819509 10:132931461-132931483 GAAGGCCCAGGCTCTGTGTGAGG - Intronic
1076819539 10:132931577-132931599 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819561 10:132931659-132931681 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819569 10:132931687-132931709 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819587 10:132931745-132931767 GAAGGCCCAGGCTCTGCGTGGGG - Intronic
1076819602 10:132931801-132931823 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819610 10:132931829-132931851 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819618 10:132931859-132931881 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819681 10:132932090-132932112 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819690 10:132932118-132932140 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819715 10:132932230-132932252 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819724 10:132932258-132932280 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819822 10:132932633-132932655 GAAGGCCCAGGCTCTGTGTGGGG - Intronic
1077155537 11:1089341-1089363 GCAGGGCCAACCTTGGGGAGAGG - Intergenic
1077266220 11:1651993-1652015 ACAGGCCGGGCCTTTGGGAGGGG - Intergenic
1077718131 11:4601307-4601329 GCATGCCCATGCTATGGGAAGGG + Intronic
1078147352 11:8730797-8730819 GGATGCCCAGGCTGTGGGCGCGG + Exonic
1079136453 11:17778466-17778488 GCAGGACATGGATTTGGGAGGGG - Intronic
1081729629 11:45361160-45361182 GCAGGCCCAGGGATTAGGATGGG + Intergenic
1081773671 11:45664403-45664425 GCAGGCCCGGGGTGGGGGAGGGG + Intronic
1081811098 11:45914498-45914520 CCAGGCCCAGGCTGGGGCAGGGG + Intronic
1082046396 11:47732548-47732570 GCAGGACCAGCCTTTAGGAGTGG + Exonic
1083855935 11:65393142-65393164 GGAGGCCCAGGCTCTGCCAGTGG + Intronic
1084173313 11:67410749-67410771 GCAGGCCCAGGCTCCAGGGGTGG + Intronic
1084312305 11:68324237-68324259 GCAGGCCATGGCTCTGGTAGTGG + Intronic
1084466888 11:69328491-69328513 GCGGGCCCAGGCTTTACAAGAGG + Intronic
1084591679 11:70094146-70094168 GCAGGGTCAGGCCCTGGGAGTGG - Intronic
1084600419 11:70142292-70142314 TCAGGCCCAGCCCCTGGGAGGGG - Intronic
1084646101 11:70459451-70459473 GTAGGCCCAAGCTTTGGGAAAGG + Intergenic
1084655267 11:70511503-70511525 GCAGGTCCAGGTTTTTTGAGGGG - Intronic
1084656986 11:70525440-70525462 GCAGGCCCAGGGATGGGCAGGGG + Intronic
1086655602 11:89350155-89350177 GGATGCCCTGGCTTTGGCAGTGG + Intronic
1089262278 11:117231646-117231668 GGAGGCCTAGCCGTTGGGAGAGG - Intronic
1089611618 11:119672524-119672546 ACAGGCCCAGGCTGTGGCTGTGG - Intronic
1090078029 11:123591684-123591706 CCAGGCCCCGCCTTTGGGGGTGG + Intronic
1090082357 11:123622468-123622490 GCAGACCCAGGCCTGGGGTGGGG + Intronic
1090434395 11:126674819-126674841 GCTGGCCCAGGCTGAGGGACTGG - Intronic
1090746679 11:129710870-129710892 GCAAGCCAAGGCTGAGGGAGGGG + Intergenic
1091216897 11:133907670-133907692 CCAGGACCAGACTTTGGCAGAGG + Intergenic
1091809075 12:3379902-3379924 GCTTGCTCAGGCATTGGGAGGGG - Intergenic
1092233232 12:6789479-6789501 GCCGGCCCAGGCCTAGGGTGTGG + Exonic
1092489582 12:8933071-8933093 CCAGGCACAGGCTTTGGGGTTGG + Exonic
1092524450 12:9301259-9301281 GCAGGCCCTGGCCTGGGGAGGGG - Intergenic
1092542814 12:9430553-9430575 GCAGGCCCTGGCCCGGGGAGGGG + Intergenic
1094510203 12:31091884-31091906 GCAGGCCCTGGCCCGGGGAGGGG - Intronic
1096101271 12:48971757-48971779 GAAGCCCCAGGCTCGGGGAGGGG - Exonic
1096946353 12:55413101-55413123 CCAGGCACAGGCTTTGGGGTTGG - Intergenic
1097144294 12:56929439-56929461 GCATGCGAAAGCTTTGGGAGAGG - Exonic
1097191261 12:57220662-57220684 GCAGGATCAGGCTGTGGGAGGGG - Intronic
1097246877 12:57611767-57611789 CCCGGTCCAGGCTGTGGGAGGGG - Intronic
1099460116 12:82911194-82911216 ACAGCCCCAGGGTTTGGGTGTGG + Intronic
1101315942 12:103628956-103628978 GCAGGGCCAGGATTAGGGTGAGG - Intronic
1101373121 12:104148056-104148078 GCGGGCCAAGAATTTGGGAGTGG - Intergenic
1101396965 12:104356850-104356872 GCAGGGCCAGGCTTAGGGTGAGG - Intergenic
1101409182 12:104455297-104455319 GCATGTCCAGGCTTTGGGGCAGG + Intronic
1101737004 12:107470716-107470738 CCAGAGCCAGGCATTGGGAGAGG - Intronic
1102049562 12:109852798-109852820 GCAGGCCAGGGTTCTGGGAGGGG + Intronic
1102074340 12:110048183-110048205 TCTGCCCCAGGCTTTTGGAGAGG + Intronic
1102315839 12:111886698-111886720 GCAGGGCCAGGCTTTGCAAGTGG + Intronic
1102731018 12:115109835-115109857 GGGGACCCAGGCTGTGGGAGTGG - Intergenic
1103510732 12:121471876-121471898 GTAATCCCAGGCTTTGGGCGTGG + Intronic
1104494077 12:129220292-129220314 GCTGGCTCAGACTGTGGGAGAGG - Intronic
1108458771 13:50644025-50644047 ACAGGAGCAGGTTTTGGGAGTGG - Intronic
1109301305 13:60592823-60592845 GCCGGCCCAGTCCTTGGGTGTGG - Intergenic
1111531408 13:89541841-89541863 CCAGTCACAGACTTTGGGAGGGG + Intergenic
1111889463 13:94063644-94063666 GAAGGCTCGGGCTTTGAGAGAGG - Intronic
1112327329 13:98450699-98450721 CCAGGCCCAGCCTTTGAGACGGG - Intronic
1112897897 13:104323656-104323678 GCATGCCTAGGCTGTTGGAGTGG + Intergenic
1113297040 13:108970510-108970532 GCAGGCCTTGCCTGTGGGAGAGG - Intronic
1115210637 14:30964538-30964560 GCAGCCCAAGGCTTTGTGATGGG + Intronic
1115241098 14:31251710-31251732 GCAGGCCCAGGGTGTGGCAGTGG + Intergenic
1115462048 14:33672473-33672495 GCAGGCACATGTTTTGGAAGAGG + Intronic
1118373465 14:65157133-65157155 GCACTCCCAGGGTTTGGGAGAGG + Intergenic
1118443875 14:65834910-65834932 GCAGGCCCAGGGTGAGGGTGAGG + Intergenic
1118810095 14:69266967-69266989 GCAGGCCTCGGTCTTGGGAGAGG - Intronic
1118813620 14:69293196-69293218 TAAGGCCCAGGCTTTGGGGCAGG - Intronic
1119544938 14:75464772-75464794 GAAGGGGCAGGCCTTGGGAGGGG + Intronic
1119703343 14:76769510-76769532 GGTGCCCTAGGCTTTGGGAGTGG - Intronic
1121400718 14:93674597-93674619 GTAGGCCCAGACTCTGGGACTGG - Intronic
1121410606 14:93746053-93746075 GAGGGCCTAGGCTTTGGGAGAGG + Intronic
1121632550 14:95431876-95431898 GAAGCCCCAGGCTTGGGGGGAGG - Intronic
1121908887 14:97771116-97771138 TCAGAACCAGGCTTGGGGAGGGG + Intergenic
1122114863 14:99522619-99522641 GCTGGCCCAGGCCCTGTGAGTGG - Intronic
1122131737 14:99607995-99608017 GCATGCTCAGGCACTGGGAGTGG + Intergenic
1122133317 14:99618729-99618751 ACCGGCCTAGGCATTGGGAGGGG - Intergenic
1122411669 14:101528924-101528946 GCAGGTCTAGGCCTTGGGGGTGG - Intergenic
1122543196 14:102509173-102509195 GGAGGCCCAGGCTTGGGGAAGGG - Intronic
1122621056 14:103057748-103057770 GCAGGGCCGGGCCTGGGGAGCGG + Intergenic
1122623504 14:103072839-103072861 GGAGGCCCACTCTCTGGGAGAGG + Intergenic
1122774241 14:104110216-104110238 AGAGTCCCAGGCTTGGGGAGTGG + Intronic
1123051737 14:105547319-105547341 GCAGGCCGAGGCTGAGGGGGTGG + Intergenic
1123077151 14:105673022-105673044 GCAGGCCGAGGCTGAGGGGGTGG + Intergenic
1123711566 15:22991523-22991545 GCTGGCGGAGGCTTGGGGAGAGG + Intronic
1124693995 15:31848197-31848219 GCAGGGAAAGGCTTTGGGAAGGG + Intronic
1125502408 15:40247889-40247911 GCATGCCCAGGGTCGGGGAGGGG + Intronic
1125606016 15:40940486-40940508 GCCGGCTCAGGCTGTGGGAACGG - Intergenic
1126458125 15:48886814-48886836 GCAGACCCTGGCCTTGGGAGAGG + Intronic
1128509539 15:68304881-68304903 TCAGGCCCAGGAGGTGGGAGTGG - Intronic
1128603654 15:69018247-69018269 GCAGGGCCAGGCCTGGGGACCGG + Intronic
1129232132 15:74202819-74202841 GCAGGCTGAGGCTGGGGGAGGGG - Exonic
1129604272 15:77017192-77017214 ACATTCCCAGGCTTGGGGAGTGG - Intronic
1129773251 15:78216333-78216355 CTGGGCCCAGGCTTGGGGAGGGG + Intronic
1130627081 15:85526702-85526724 GCAGGGCCAGGCTGGGGGATGGG - Intronic
1131367590 15:91853498-91853520 CCAGGCCCAGGCCTTGGGGCTGG + Intergenic
1131594468 15:93782846-93782868 GAAGGCACTGGCTTTGGGATTGG + Intergenic
1132325243 15:100963546-100963568 CCAGGCCAAGGATTAGGGAGTGG - Intronic
1132603853 16:785565-785587 GCAGGGCCAGGTTTTGGGATAGG - Exonic
1132752438 16:1464991-1465013 GCTGGACCTGGCTTTGGGACAGG - Intronic
1133072663 16:3256834-3256856 CGAGGTCCAGGGTTTGGGAGGGG - Intergenic
1133512041 16:6469004-6469026 GAAGCCCCAGGCATTGGAAGTGG + Intronic
1133701795 16:8315970-8315992 TCAGGCACAGCTTTTGGGAGGGG + Intergenic
1133734089 16:8600824-8600846 GCAGGCCTGGGCTGGGGGAGTGG - Intergenic
1134223966 16:12377359-12377381 GCAGACCCAGGTTGTGGCAGAGG + Intronic
1135955980 16:26956567-26956589 GAGGGAGCAGGCTTTGGGAGTGG - Intergenic
1136092221 16:27928692-27928714 GCAGGCCCAGGCCTCGGGAGAGG + Intronic
1136382368 16:29901482-29901504 GGTGGCCCAGGCCCTGGGAGAGG + Exonic
1136478323 16:30526619-30526641 GGAGGCCGAGACCTTGGGAGGGG - Intronic
1137666544 16:50253009-50253031 TCTGCCCCAGGCTTTGGGTGTGG + Intronic
1139521061 16:67483024-67483046 GGAGGCTCAGGCCTTGGCAGAGG - Exonic
1139545700 16:67648595-67648617 GCAGGGCCAGGATCTGGGGGAGG - Intronic
1139633282 16:68243510-68243532 GGAGGCAGGGGCTTTGGGAGTGG + Intergenic
1140412672 16:74750614-74750636 GCATGGCCAGGCATGGGGAGAGG - Intronic
1140469760 16:75207358-75207380 CCAGGCCCAGGCTTGGGCAGGGG + Intergenic
1140479562 16:75255232-75255254 GGAGGCCGAGGCTTCAGGAGGGG - Intronic
1141628196 16:85272551-85272573 TCAGGCCCAGGCAGTGGGAGGGG + Intergenic
1142185917 16:88694668-88694690 GGTGGCCCAGGGTTTGGGAGCGG + Intergenic
1142196059 16:88739835-88739857 CCAGGGCCAGGCTGTGGGTGGGG - Intronic
1142327344 16:89424498-89424520 CCAAGCCCAGTCTTTGGGTGTGG + Intronic
1142885544 17:2910194-2910216 CCAGGCCCTGGCTTAGGGTGGGG + Intronic
1143153145 17:4819343-4819365 GCAGGCCAGTGCTTTGGTAGAGG + Intronic
1143765210 17:9133263-9133285 GCAGCTCCAGGCTTCCGGAGAGG + Intronic
1145902280 17:28496771-28496793 CCAGCCCCAGGCTATGTGAGAGG + Intronic
1145999293 17:29121772-29121794 GCAGGCCCATCCTCTGGCAGCGG - Intronic
1145999948 17:29125077-29125099 GGGGGCCCAGGCCTTGGGTGTGG - Intronic
1146176361 17:30668369-30668391 GCAGGCCGGGGGGTTGGGAGTGG + Intergenic
1146349821 17:32084483-32084505 GCAGGCCGGGGGGTTGGGAGTGG + Intergenic
1146728024 17:35171296-35171318 GAAGGCACAGGGTTGGGGAGAGG - Intronic
1147257628 17:39191630-39191652 CCAGGCCCAGGAGCTGGGAGGGG - Intronic
1147263612 17:39222775-39222797 CCAGGCCCTGTCTCTGGGAGGGG - Intronic
1148029265 17:44608546-44608568 GCTGGCCCAGGCCTTGGGGGAGG - Intergenic
1148105012 17:45114410-45114432 ACAGGCCGGGGCTTTGGGTGAGG - Intronic
1151344232 17:73491980-73492002 GCTGGCCCAGATTTCGGGAGTGG - Intronic
1151372323 17:73656119-73656141 GGAGGCCCAGGCTGTAGGCGGGG - Intergenic
1151419427 17:73987525-73987547 GCAGGCCCTGTCTGCGGGAGGGG - Intergenic
1152438022 17:80288075-80288097 GCAGGCCCAGGCTTTGGGAGAGG + Exonic
1152524436 17:80879437-80879459 CCAGGCCCGGGATGTGGGAGTGG - Intronic
1152599066 17:81252432-81252454 ACAGGCCCAGGCCTTGGAGGAGG - Exonic
1152744523 17:82032672-82032694 GCAGGGTCAGGGCTTGGGAGGGG - Intronic
1152795872 17:82305922-82305944 GCAGCCCCAGGAGCTGGGAGAGG + Intergenic
1152942081 17:83178113-83178135 TCAGGGCCATGCTTTCGGAGGGG - Intergenic
1153985450 18:10346981-10347003 GGAGGCCCAGGCTGTGGCAGGGG + Intergenic
1154176444 18:12089162-12089184 GCAGGGCCAGGGTCTGGGACAGG - Intergenic
1155570147 18:27184581-27184603 TCAGGCGCAGGCTGCGGGAGAGG - Intronic
1156538081 18:37883048-37883070 GCAGGGCCAGGCCTTGGGTGAGG + Intergenic
1157445002 18:47737964-47737986 GCAGACACAGGGGTTGGGAGAGG + Intergenic
1157620512 18:49014571-49014593 ACAGGCCCAGGCCTAGGGAAGGG - Intergenic
1157984164 18:52418560-52418582 GCAGGCCCAGGTTTTGGTTAGGG + Intronic
1159054110 18:63448165-63448187 GCAGGCCCAGGATGTGTAAGAGG - Intergenic
1159101715 18:63965824-63965846 GCATCCCCAGGCTTCTGGAGAGG + Intronic
1160518315 18:79490365-79490387 GCAGGCCCAGGCTCTGGGTCAGG + Intronic
1160707221 19:535312-535334 CCTGGCCCAGGCCGTGGGAGGGG - Intronic
1160749101 19:725670-725692 GCAAGCCCAGGCTTGGGAGGTGG + Intronic
1160899248 19:1419027-1419049 GGAGGGCCAGGCAGTGGGAGGGG - Intronic
1161030506 19:2055987-2056009 ACAGGCCCAGGCTGGGGGCGCGG + Intergenic
1161170674 19:2810941-2810963 GCAGGCCCAGGGTCGGGGACGGG + Intronic
1161283887 19:3459175-3459197 GCCCACCCAGGCTTTGGGGGAGG - Intronic
1161298575 19:3532100-3532122 GGAAGCCCAGGCTCTGGGCGGGG - Intronic
1161303720 19:3555881-3555903 TCAGGCCCAGGGTCCGGGAGGGG + Intronic
1161393775 19:4034255-4034277 GCAGGCCCTGCCTGTGGGGGTGG + Intronic
1161529148 19:4776704-4776726 GAAGCCTCAGGCTTGGGGAGGGG + Intergenic
1161794382 19:6378098-6378120 GAAGGCCCAGGCAGTGGGGGTGG + Intronic
1161809643 19:6464568-6464590 AGAGGCCCAGGCGTTGGGATCGG - Intronic
1161979404 19:7622733-7622755 ACAGGCCCAGGCTGTGGGGTGGG - Intronic
1162050075 19:8027665-8027687 GGGGGCTCAGGCTTGGGGAGGGG + Intronic
1162737442 19:12754476-12754498 GGGGGCCCAGGTTGTGGGAGAGG - Intronic
1162982464 19:14248528-14248550 GCAGGCCGGGGGGTTGGGAGTGG - Intergenic
1163054025 19:14705285-14705307 GGAGGCCCAGGCTGTGGGCTTGG + Intronic
1163398206 19:17076213-17076235 AGAGGCCCAGGCTGGGGGAGTGG + Intronic
1163861956 19:19747446-19747468 GCAGGCAGAGGCTCTGGGACGGG + Intergenic
1165157315 19:33796353-33796375 GAAGGCGCGGGCTTCGGGAGAGG + Intronic
1165159808 19:33809454-33809476 GGTGGACCAGGCTGTGGGAGTGG + Intronic
1165394810 19:35558327-35558349 GCGGGCCCAGGCCGTGGGCGGGG + Intronic
1165471758 19:36008339-36008361 GCAGGCCCAGACCCTGGGACAGG - Exonic
1165699501 19:37926589-37926611 GGTGGCTCAGGCTTGGGGAGGGG + Intronic
1166373465 19:42314702-42314724 GCAGGCTCAGCCTGGGGGAGTGG + Intronic
1166960831 19:46495039-46495061 GCAGGCCCAGGATTCTGGGGAGG - Exonic
1166966643 19:46533236-46533258 GGAGGCCTGGGCTCTGGGAGGGG - Intronic
1167079982 19:47271890-47271912 GCTGGGGCAGGCTCTGGGAGTGG - Exonic
1167234093 19:48303438-48303460 CCAGGCCCAGGAGTTAGGAGGGG + Intronic
1167483598 19:49747352-49747374 GCAGTCCCAGGATTTGTGGGAGG - Intronic
1168684779 19:58341919-58341941 GCAGGGCCAGGCTTTGGGTCAGG - Exonic
925988016 2:9231577-9231599 GCAGGCGCAGGCTAGGGGTGTGG - Intronic
926143890 2:10385209-10385231 CCAGGCCCAGGGGCTGGGAGGGG - Intronic
926679713 2:15654151-15654173 GCAGGCCCCGGATTGAGGAGGGG - Intergenic
927240881 2:20918725-20918747 GCTGGACCTGGCTTTGGAAGGGG + Intergenic
927533944 2:23837265-23837287 GCAGGCGCAGGAGTGGGGAGAGG + Intronic
927652159 2:24919648-24919670 GCAGGGCCAGGCTTCCGGGGGGG - Exonic
927856722 2:26532367-26532389 GCAGTACCAGGCTTCAGGAGAGG - Intronic
928200243 2:29243279-29243301 GCAGGGCCAGGACTGGGGAGAGG - Intronic
928256733 2:29729239-29729261 GCTGGCCCTGGCCATGGGAGAGG - Intronic
929561710 2:42960449-42960471 GCAGGCCCTGTGTCTGGGAGCGG - Intergenic
929578489 2:43067660-43067682 GCTGGCCCAGGTGTTGGGGGAGG - Intergenic
930024719 2:47023103-47023125 GGAGGCCCAAGCCTTGAGAGAGG - Intronic
930712099 2:54558894-54558916 ACAGGCCCGGCCTTTGGGAGGGG - Intronic
932316782 2:70790141-70790163 GCAGGACCCGGGTCTGGGAGGGG - Intronic
933328112 2:80863923-80863945 CCAGGCACAGGCTGTGGGATGGG + Intergenic
934560073 2:95308587-95308609 CCAGGCCCATGCCTCGGGAGAGG + Intronic
934713140 2:96528430-96528452 GTGGGCCCAGGCTGGGGGAGTGG - Intergenic
934925520 2:98379550-98379572 GCAGGGCCGGGCTCCGGGAGAGG + Intronic
935666408 2:105516723-105516745 GCAGGGCCGGGCTTAGGAAGGGG + Intergenic
936450584 2:112631078-112631100 GCTGGACCAGGCTTGGGCAGAGG - Intergenic
937264037 2:120604940-120604962 GCAGGGCCAGGGTCTGGGAGGGG + Intergenic
938055617 2:128212505-128212527 GCTTGCCCAGTCTTTGGGAAAGG - Intergenic
941029247 2:160493212-160493234 GCAGGGTCAGGCCTGGGGAGGGG - Intronic
943682605 2:190783993-190784015 GCAGGCCCAGAATTTGAGATAGG - Intergenic
944393707 2:199246213-199246235 GGAGGCCCAGCCTTGGGGTGGGG - Intergenic
946422286 2:219571559-219571581 AGAGGCCCAAGCTGTGGGAGGGG - Intronic
947434828 2:230064353-230064375 GCAGGCTCAGACATTGGGAAGGG - Intronic
948277335 2:236719226-236719248 GCAGGCCCAGGCCATGCCAGAGG - Intergenic
948377347 2:237530150-237530172 GTAGGCCAAGGCCTTGGGAGAGG - Intronic
948782383 2:240329727-240329749 GCAGGCCCAGCCTTGGGCATGGG + Intergenic
948790432 2:240373988-240374010 TGAGGTCCAGGGTTTGGGAGGGG - Intergenic
948883053 2:240870114-240870136 TCAGGGCCAGGTTGTGGGAGGGG - Intronic
1170573149 20:17643714-17643736 GCAGTGACAGGGTTTGGGAGAGG + Intronic
1171312104 20:24152913-24152935 GCAGGACCAGGCTCTGGGTGGGG - Intergenic
1171421551 20:25021039-25021061 GCTGGCCCTGGCTTTGAGAAAGG + Intronic
1172842721 20:37911712-37911734 GCAGGCACAGGGTGGGGGAGAGG - Intronic
1172873024 20:38147503-38147525 GCAGGGCCAGGCTCAGGGAGGGG - Intronic
1173469193 20:43309480-43309502 GCTGGGCCTGGCTTTGGGACAGG - Intergenic
1173558135 20:43982565-43982587 GCAGGCCATGGCATTGGCAGGGG + Intronic
1173803645 20:45910656-45910678 GCAACCCCAGGGTGTGGGAGGGG - Intronic
1173955629 20:47030370-47030392 GCAGGTTCAGGCATGGGGAGAGG + Intronic
1174035160 20:47664205-47664227 CCAGCCCCAGGCTTCAGGAGTGG + Intronic
1174303650 20:49600198-49600220 GCAGGGCCAGGCATTAGGTGAGG + Intergenic
1174363241 20:50041267-50041289 GAGGGCTCAGGCTTTGTGAGTGG - Intergenic
1174406628 20:50307037-50307059 GCAGGCTCAGGAGCTGGGAGTGG + Intergenic
1175253324 20:57622804-57622826 GCAGGACAAGGCAGTGGGAGGGG - Intergenic
1175482033 20:59318589-59318611 GAAGGCCCAGGCCTTGGTGGAGG + Intronic
1175504019 20:59469463-59469485 GCAGGCCCAGGCTGAGGGGCAGG + Intergenic
1175798900 20:61789706-61789728 GCAGGCCCAGAGTTAGGCAGGGG + Intronic
1175830590 20:61963299-61963321 GCAGGCCCCGGCGGTGGGTGTGG - Intronic
1175968024 20:62669335-62669357 GCAGTCCCAGGAGGTGGGAGAGG - Intronic
1176858124 21:13986877-13986899 GCAGGGCCAGGGTCTGGGACAGG - Intergenic
1176866451 21:14057274-14057296 GCAGGGCCAGGGTCTGGGACAGG + Intergenic
1177507850 21:22040866-22040888 CCAGGCTCGGGCTCTGGGAGAGG + Intergenic
1178022989 21:28431207-28431229 GAATGACCAAGCTTTGGGAGAGG - Intergenic
1178817368 21:35944081-35944103 GCAGAGCCAGGCTTTAAGAGAGG - Intronic
1179013460 21:37574460-37574482 GCAAGGCCAGGCTGCGGGAGGGG + Intergenic
1179714066 21:43278846-43278868 GCAGGGCCAGGCTCTGGGGCCGG - Intergenic
1179845168 21:44107159-44107181 GAAGGCCCCCGCCTTGGGAGGGG + Intergenic
1179882824 21:44300522-44300544 GAAGGGCCAGGCTCTGGGGGTGG - Intronic
1180855264 22:19041365-19041387 GCAGGCCCAGCCTGGGGGTGGGG - Intronic
1181181221 22:21069892-21069914 GCAGGCCCAGGCCTTGGTGATGG - Intergenic
1181265387 22:21628201-21628223 GCAGGCCTAGCCTGTGGCAGCGG - Exonic
1182355020 22:29719041-29719063 GCAGGCCCTGGGGCTGGGAGTGG - Intergenic
1182473230 22:30561357-30561379 GCAGGCCCCTGCTTTGGGCCTGG - Intronic
1183289314 22:36989761-36989783 CCAAGCCCAGACTTTGTGAGAGG - Intergenic
1183739707 22:39662881-39662903 GCAGGGCCAGGCCTGGGGTGAGG + Intronic
1184179091 22:42807295-42807317 GCAGGACCTGGCCTTGGCAGTGG - Intronic
1184279638 22:43429674-43429696 GCAGCCCCATGCTTGTGGAGGGG - Intronic
1184399965 22:44267984-44268006 GGCTGCCCTGGCTTTGGGAGTGG + Intronic
1184643699 22:45885231-45885253 GGCAACCCAGGCTTTGGGAGGGG - Intergenic
1184691267 22:46118378-46118400 GGATGCCCAGGATTTGAGAGGGG - Intergenic
1184975102 22:48056012-48056034 ACAGGCCCACACTTTGGGAAAGG + Intergenic
1184991170 22:48170924-48170946 GTAGGCGCTGGGTTTGGGAGGGG + Intergenic
1185073663 22:48670885-48670907 ACTGTCCCAGGCTTTGGGAACGG - Intronic
950079035 3:10208109-10208131 GCAGGCACAGACTGTGGGTGAGG + Intronic
950100819 3:10355629-10355651 GCAGGCACAGACTCTGGGAAAGG - Intronic
950143469 3:10631555-10631577 TGAGGTCCAGGCTTTGGGAAGGG + Intronic
950690680 3:14653674-14653696 GAAGGCCAAGGCATAGGGAGTGG - Intronic
952710802 3:36430176-36430198 GCAGGTACAGGCTTTGGCATAGG - Intronic
952948793 3:38500881-38500903 GCAAGCACAGCCTTGGGGAGAGG - Intronic
953343149 3:42152629-42152651 GCAGCCTCAGGCATGGGGAGGGG + Intronic
953644590 3:44742333-44742355 GCAGGCCCAGGAGTGGGGAAAGG + Intronic
954635369 3:52068237-52068259 TCTGGCCCAGGCTTGGGGAGGGG - Intergenic
954698717 3:52440895-52440917 GCAGGCCTAGGGCTCGGGAGTGG - Intronic
954953315 3:54493979-54494001 CCAGGCCCAGGCTCAGGAAGTGG - Intronic
955239368 3:57165456-57165478 GGAGGGCCAGGCTGTGGGGGCGG - Intronic
955782699 3:62502816-62502838 GGAGGCCCAGGATGTGGCAGGGG + Intronic
957078539 3:75619326-75619348 GGTGACCCAGGCTCTGGGAGGGG + Intergenic
960275652 3:115726527-115726549 GCAGGGCCAGGATTAGGGTGAGG - Intergenic
961140488 3:124551709-124551731 GCTGGCCCAGGGTTGGGGAATGG - Intronic
961523716 3:127483475-127483497 GCAGGCCCAGGCCTTTGCATCGG + Intergenic
961824073 3:129589687-129589709 GCAGGCCTGGGCTTGGGGATGGG - Intronic
961987635 3:131154472-131154494 GCAGGGCCAGGATTAGGGTGAGG + Intronic
963231212 3:142910413-142910435 GCAGGGCCAGGCAGAGGGAGAGG - Intergenic
967837237 3:193974950-193974972 GCAGGGAGGGGCTTTGGGAGTGG - Intergenic
968520813 4:1033950-1033972 CCAGGCCCAGGCTCGGGGAGGGG + Intergenic
968643644 4:1727796-1727818 GCAAGCCCAGCCTTTGGGAGTGG + Exonic
968905421 4:3448495-3448517 GGAGACCCAGGCTCTGAGAGGGG + Intronic
969104039 4:4791552-4791574 CCAGGCCCAGAGTTTGGGACCGG + Intergenic
969449442 4:7264725-7264747 GCAGACCCAGGCATGGTGAGGGG - Intronic
969664603 4:8549847-8549869 GTAGGCCCAGGGTCTAGGAGTGG + Intergenic
972746617 4:41939304-41939326 CCTGGCCCAGGCTTTGTTAGAGG + Exonic
974055841 4:56982230-56982252 GGAGGCAGTGGCTTTGGGAGGGG - Intronic
974234273 4:59160869-59160891 CCAGGCAGGGGCTTTGGGAGAGG - Intergenic
976292725 4:83437491-83437513 GCAGTTCCAGGCTATGGGGGAGG + Intronic
978127162 4:105147823-105147845 GCAGGCGCAGGCCCGGGGAGGGG + Intronic
981544552 4:145880820-145880842 GCATGCCCAGGCGTGGGGAGTGG + Intronic
981562145 4:146059619-146059641 GCTGGACCAGGGTTTGTGAGGGG - Intergenic
985084620 4:186299603-186299625 GCACCCCCAGGCTTTGGGGGTGG - Intergenic
985641269 5:1064517-1064539 GAAGGCCCTGGCCCTGGGAGCGG - Intronic
985732395 5:1556578-1556600 GCAGGACCAGGCGTCAGGAGGGG - Intergenic
986214474 5:5706469-5706491 GCAGACCCAGGCATTGGCATTGG + Intergenic
986295170 5:6431610-6431632 GCAGACCCTGACTTTGGGAAAGG - Intergenic
986872327 5:12064138-12064160 GCAGCCCCAGTCTTTGGCAAGGG + Intergenic
987050197 5:14142863-14142885 GCTGGCCCTGGCTCGGGGAGGGG - Intergenic
988520866 5:31944684-31944706 GGAAGCTCAGGCTCTGGGAGAGG + Intronic
990440019 5:55834950-55834972 GCAGGAGCAGGCTTGGGCAGAGG + Intergenic
990517826 5:56546965-56546987 GAAGGCCCAGGCAGTAGGAGAGG - Intronic
992933814 5:81680066-81680088 GCAGGGCCAGGTGTTGGGAACGG - Intronic
993327584 5:86561001-86561023 GCAGGCCCAAGCTGGGGGAAAGG + Intergenic
997402514 5:133613151-133613173 GGAGCCCCAGGCTTGGGGATGGG - Intergenic
997523251 5:134536753-134536775 GGAGGCCCAGGCTAAGGAAGAGG + Intronic
998153672 5:139771897-139771919 GCAGGCCCTGCCCTTGGAAGGGG - Intergenic
998159254 5:139803832-139803854 GCTGGCCTGGGCTTAGGGAGGGG + Intronic
998174701 5:139894647-139894669 GCAAGCCCAGGCATTGGGCTGGG - Intronic
998374793 5:141683071-141683093 GCAGGACCAGTGTTTGGGTGTGG + Intergenic
998394065 5:141806852-141806874 GCAGGCACAGGTCTTGGCAGAGG + Intergenic
999173918 5:149618342-149618364 GCAGGGCCTGGCCTTGGGGGTGG - Intronic
999993157 5:157067176-157067198 GCAGGTGCAGGCTATGGGGGAGG + Intergenic
1000664206 5:163974165-163974187 GCTGACCCAGGCTTTGGGCTAGG + Intergenic
1001129130 5:169048922-169048944 CCAGGCCAGAGCTTTGGGAGAGG + Intronic
1001287668 5:170435594-170435616 GAAGGCACAGGCTCTGGAAGAGG + Intronic
1001420889 5:171586494-171586516 GCAGTCCCAGGGAGTGGGAGCGG - Intergenic
1001630044 5:173168258-173168280 GAAGGCCCAGGCTGTGGGGTGGG - Intergenic
1001671442 5:173477491-173477513 GCTGGCCCTGGCGTGGGGAGCGG + Intergenic
1002280498 5:178127343-178127365 GCAGGCCAAGGCTCCCGGAGAGG + Intergenic
1002600130 5:180349588-180349610 GCAGCCCCAGGAGCTGGGAGAGG + Intronic
1002854832 6:1027416-1027438 AGAGTCCCAGGCTTTGGGAATGG + Intergenic
1003272891 6:4623118-4623140 GCAGGCCCAAGCTAATGGAGGGG + Intergenic
1003479380 6:6517205-6517227 GCAGGCAGAGGATTTGGCAGAGG - Intergenic
1005252128 6:23959319-23959341 GTATGCTCAGGCTTTGGGATAGG - Intergenic
1005498650 6:26411325-26411347 GCAAGGCCAGGCTTTGCAAGGGG - Intronic
1006450287 6:34102029-34102051 TCAGGGCCATGCTTTGGGGGTGG - Intronic
1007107590 6:39294408-39294430 GCAGGCCCTGGCTTTGGGAGTGG - Intergenic
1007476916 6:42125096-42125118 GCAGGCCCAGGCTGCTGGACAGG + Intronic
1007539355 6:42626859-42626881 GCAGTCCCAGGGTGTTGGAGAGG - Intronic
1007663824 6:43502877-43502899 GCAAGCCCAGGCTGTGGGAGTGG + Intronic
1007699860 6:43760097-43760119 CCAGGCACCCGCTTTGGGAGAGG - Intergenic
1007808565 6:44470020-44470042 GCAGCCACAGCCTTTGGGTGTGG + Intergenic
1008137668 6:47795371-47795393 GCTGGCCCAGGCCTCGGTAGGGG + Exonic
1015459587 6:133473778-133473800 GCAGGGCCAGGATTAGGGTGAGG + Intronic
1015786539 6:136924387-136924409 GGAGGCCCAGCCTCGGGGAGAGG + Exonic
1016891792 6:149014650-149014672 GCAGGCCCAGGTTTCTGGCGGGG - Intronic
1016936457 6:149451842-149451864 ATAGGGCCAGGCTTAGGGAGCGG + Intronic
1017651799 6:156590476-156590498 GCGGACCCAGGCTTTGGGTTGGG - Intergenic
1017778582 6:157698815-157698837 GCAGGCAAAGGCTTGGGAAGTGG + Intergenic
1017781676 6:157720361-157720383 GCAGCCCATGGCTTTGGGAGAGG + Intronic
1017900698 6:158716350-158716372 ATAGGCCCAGGCTTTGGGATGGG + Intronic
1017926301 6:158914257-158914279 GCAGGCCAAGGCTATGGTGGGGG - Intergenic
1019445032 7:1066719-1066741 GGAGGCTCAGGCTTAGGGATGGG - Intronic
1019602199 7:1890306-1890328 GCAGTACCAGGCTGTGGGTGAGG - Intronic
1019698307 7:2460217-2460239 GCGGGCCCTGGCCTTGGAAGAGG - Intergenic
1019746068 7:2700959-2700981 GACGGCCCAGGCTCTGGGACTGG + Intronic
1019925975 7:4191971-4191993 GCAGGGCGAGGGTTTGAGAGAGG - Intronic
1021112870 7:16715166-16715188 GCAGGACCAGGCTTTGGCACAGG + Intergenic
1021524142 7:21567846-21567868 GCTAGCACAGGCTTTGGTAGTGG + Intronic
1023728004 7:43164066-43164088 GGAGGCCCAGGCTTGGGTGGAGG + Intronic
1023986396 7:45099655-45099677 GGAGGCGCTGGCTCTGGGAGAGG - Intergenic
1024064190 7:45719051-45719073 ACAGGCCCCGGCCTTGGGAGAGG + Exonic
1024287801 7:47774369-47774391 GCAGCCCCAGGCCTTCGGGGAGG + Intronic
1024666019 7:51548121-51548143 GCAGGAACAGCCTTTGGGAGCGG + Intergenic
1024972077 7:55079685-55079707 GCAGGCCCGGGCCTAGGGTGGGG - Intronic
1027057007 7:75056636-75056658 TCTGGCCCAGGCTAAGGGAGGGG + Intronic
1027471599 7:78581187-78581209 GCAGGCCCAGGCTTGGGGGAGGG + Intronic
1028774152 7:94658479-94658501 GCAGAGGCAGGCTTAGGGAGGGG - Intronic
1029123938 7:98284877-98284899 GGAGGCCCAGGCCTTGGGCAGGG - Intronic
1029484293 7:100829667-100829689 GCAGGGCAGGGGTTTGGGAGAGG - Intronic
1032198971 7:129805628-129805650 ACCAGCCCAGGCTGTGGGAGTGG + Intergenic
1032442167 7:131950212-131950234 GCAGGAAGAGGCTGTGGGAGAGG + Intergenic
1032885823 7:136137079-136137101 GCAGGCCGAGGCCTGGGGATGGG + Intergenic
1033216221 7:139495542-139495564 CCAGGCACAGGCTCTAGGAGAGG - Intergenic
1033646503 7:143308879-143308901 GCAGCCCCCAGCTCTGGGAGGGG - Intergenic
1036191172 8:6671545-6671567 TCAGACCCTGGCTGTGGGAGAGG - Intergenic
1036635442 8:10547285-10547307 GGAGGCCCGGTCTTTGGGTGAGG - Intronic
1037646000 8:20793335-20793357 GGAGGCCCAGAGTGTGGGAGAGG - Intergenic
1038047444 8:23777693-23777715 GAAGGCCCAGGGTTTGGGATGGG + Intergenic
1039907543 8:41797783-41797805 GCCGGCCGAGGCCTGGGGAGCGG - Intronic
1040308233 8:46223337-46223359 GTAGCCCCAGGCTTTGGAAAAGG + Intergenic
1040328924 8:46376110-46376132 AAAGACCCAGGGTTTGGGAGAGG + Intergenic
1040676559 8:49757508-49757530 CCAGCCCCAGGCTTTTGGAAAGG + Intergenic
1041053719 8:53961395-53961417 GCAGGGCCAGGCTTGGGGTATGG - Intergenic
1041413222 8:57579306-57579328 GCAGGGCCAGCCTCTGGGACAGG + Intergenic
1042641642 8:70941989-70942011 GAAGTCCAAGGCTTTGGGAGAGG - Intergenic
1043103091 8:76071663-76071685 GCATGCCAAGGCTTTGGCATTGG + Intergenic
1046089155 8:109478480-109478502 GCAGGGACAGCCTTTGGGTGGGG + Intronic
1047561544 8:125992228-125992250 GCAGGCTCTGTCATTGGGAGTGG + Intergenic
1048296603 8:133219296-133219318 GCAAGCCTGGGCTGTGGGAGAGG - Intronic
1048469672 8:134695639-134695661 GATGACCCAGGCTTGGGGAGTGG - Intronic
1048590345 8:135815508-135815530 GGAGGCCCAGGCTGTGGGGTGGG - Intergenic
1049171910 8:141166824-141166846 GCAGGGCCAGGGATGGGGAGGGG + Intronic
1049310652 8:141931990-141932012 GCTGGCCTAGGATCTGGGAGGGG - Intergenic
1049337320 8:142093432-142093454 GCAGGGGCGGGCTCTGGGAGGGG - Intergenic
1049341137 8:142113254-142113276 GCAGCCCCAGACATTGGGTGAGG + Intergenic
1049347519 8:142146699-142146721 GAGGGCCCAGCCTTGGGGAGGGG + Intergenic
1049408056 8:142460443-142460465 CCCCGCCCAGGCCTTGGGAGAGG - Intronic
1049624694 8:143614757-143614779 GCAGGGCCTGGCTGTGGGTGGGG - Intronic
1049632190 8:143664835-143664857 GCAGGCCCAGGCTGGGTGACAGG - Intergenic
1049714382 8:144082964-144082986 TCAGGCCCAGGCTTAGGGCTCGG + Intronic
1050106528 9:2171920-2171942 CCATGCCCAGGCTTTTTGAGGGG + Intronic
1053526974 9:38840347-38840369 AGAGGCCCAGTCTTGGGGAGTGG - Intergenic
1054199201 9:62064778-62064800 AGAGGCCCAGTCTTGGGGAGTGG - Intergenic
1054639155 9:67523579-67523601 AGAGGCCCAGTCTTGGGGAGTGG + Intergenic
1055074311 9:72197975-72197997 GCAGGGCCAGGATTAGGGTGAGG + Intronic
1056589190 9:87951877-87951899 CCAGGCAAAGGCTTTAGGAGGGG + Intergenic
1056813385 9:89781792-89781814 AGAGGCCTGGGCTTTGGGAGAGG + Intergenic
1057724222 9:97556846-97556868 GAAGGTCCAGGGCTTGGGAGCGG + Intronic
1057870247 9:98711208-98711230 GGATGCCCAGGCATTAGGAGTGG - Intergenic
1059249928 9:112879448-112879470 GCAGTCCCAGGCCCTGTGAGGGG - Exonic
1059651366 9:116319019-116319041 GGAGGCCAAGGCTTTGGGGTGGG - Intronic
1060295000 9:122337448-122337470 GATTGCTCAGGCTTTGGGAGAGG + Intergenic
1060549709 9:124479146-124479168 GAGGGCCCAGACTCTGGGAGTGG + Intergenic
1061009828 9:127948339-127948361 GCTGGCACAGGCCTAGGGAGCGG - Intronic
1061052797 9:128205959-128205981 GCAGGCCCAGGGCAGGGGAGGGG + Intronic
1061102723 9:128504553-128504575 GCAGCCCCGGGGATTGGGAGCGG + Intergenic
1061799842 9:133107719-133107741 GCAGGCCTGGCCTGTGGGAGCGG - Intronic
1061822172 9:133234876-133234898 GGAGGCCCAGGGCTTGGCAGGGG + Intergenic
1061958668 9:133977002-133977024 GCAGTCCCTGGCTGTAGGAGAGG - Intronic
1062091923 9:134682827-134682849 AAATGCCCAGCCTTTGGGAGCGG + Intronic
1062164212 9:135098555-135098577 ACACGCACAGGCTTAGGGAGTGG + Intronic
1062261800 9:135666611-135666633 GGAGGCTCAGGCTCTGGGAAGGG - Intergenic
1062402311 9:136378033-136378055 TCAGGCCCAGGCTGGGGTAGGGG + Exonic
1062406092 9:136397426-136397448 GCAGGCCCTGGGTCTGGGAGAGG + Intronic
1062443505 9:136583846-136583868 GAGGGCCCTGGCATTGGGAGTGG + Intergenic
1062448738 9:136606730-136606752 GGAGGCCCAGGCAGTGGGAAGGG + Intergenic
1062466655 9:136684612-136684634 GCAGGCCTGAGCTCTGGGAGGGG - Intronic
1062597415 9:137305541-137305563 CCAGGCCCAGGCTTTGGTGGGGG - Intergenic
1062634828 9:137485187-137485209 CCAGGCCCAGGCCCAGGGAGTGG + Intronic
1185868897 X:3646821-3646843 GCCAGCCCAGGCCCTGGGAGGGG + Intronic
1187127429 X:16467189-16467211 GCTGGCCCAGGCTTTGGCCCAGG + Intergenic
1189303841 X:39972098-39972120 GCATGCCCAGAAGTTGGGAGAGG - Intergenic
1189364999 X:40381207-40381229 TCAGGGCCAGGGTATGGGAGAGG - Intergenic
1190266074 X:48827627-48827649 GCTGCGCCAGGCTTTCGGAGGGG + Intergenic
1192148773 X:68699054-68699076 ACAGACACAGGCTTGGGGAGGGG - Intronic
1192315212 X:70045863-70045885 GCAGGGCCAGGGATAGGGAGAGG + Intronic
1192358262 X:70423208-70423230 GCAGCTGCAGGCCTTGGGAGAGG + Exonic
1193341614 X:80355312-80355334 CCAGGCAGAGGCTCTGGGAGAGG + Intronic
1195829474 X:109040141-109040163 GGAGGCCCTGTCTCTGGGAGAGG + Intergenic
1196195897 X:112838383-112838405 GAAGGCGCAGGCCCTGGGAGAGG + Intronic
1197676325 X:129334744-129334766 GCAGCCCGAGGCTAGGGGAGGGG - Intergenic
1197693187 X:129523632-129523654 GCCGGCCCGGGCTCTGGGTGGGG - Intergenic
1199635637 X:149809116-149809138 GCATGAAGAGGCTTTGGGAGAGG + Intergenic
1199643704 X:149885193-149885215 GCATGAAGAGGCTTTGGGAGAGG + Exonic
1199895193 X:152120254-152120276 GCAGGCCCAGGTTCTGTGAGGGG - Intergenic
1199996281 X:153028620-153028642 TCAGGCCCTGCATTTGGGAGTGG + Intergenic
1200054941 X:153455404-153455426 GCAGGACCAGGGGCTGGGAGGGG - Intronic
1200123020 X:153800185-153800207 CCACCCCCAGGCCTTGGGAGGGG + Intergenic
1200132938 X:153861366-153861388 GAAGGCCCGGGCTCTGGGAAGGG + Intergenic
1200277763 X:154750830-154750852 GCAGTCCCGGGCGCTGGGAGCGG + Intronic
1200795326 Y:7336248-7336270 GCCAGCCCAGGCCCTGGGAGGGG - Intergenic