ID: 1152438026

View in Genome Browser
Species Human (GRCh38)
Location 17:80288084-80288106
Sequence GGCTTTGGGAGAGGCAGGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1073
Summary {0: 1, 1: 0, 2: 13, 3: 160, 4: 899}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152438016_1152438026 -8 Left 1152438016 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 66
4: 433
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438013_1152438026 8 Left 1152438013 17:80288053-80288075 CCGAGGTTGGCGACAGCCCCCTG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438010_1152438026 17 Left 1152438010 17:80288044-80288066 CCGCGCCCACCGAGGTTGGCGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438018_1152438026 -9 Left 1152438018 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 2
2: 7
3: 75
4: 410
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438020_1152438026 -10 Left 1152438020 17:80288071-80288093 CCCTGCAGGCCCAGGCTTTGGGA 0: 1
1: 1
2: 4
3: 31
4: 344
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438012_1152438026 11 Left 1152438012 17:80288050-80288072 CCACCGAGGTTGGCGACAGCCCC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438008_1152438026 22 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899
1152438011_1152438026 12 Left 1152438011 17:80288049-80288071 CCCACCGAGGTTGGCGACAGCCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG 0: 1
1: 0
2: 13
3: 160
4: 899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152438026 Original CRISPR GGCTTTGGGAGAGGCAGGAG TGG Exonic
900338832 1:2178195-2178217 GGTGTGGGGAGAGGCTGGAGTGG - Intronic
900428955 1:2593045-2593067 GGCTGCAGGAGGGGCAGGAGCGG - Intronic
900795906 1:4708320-4708342 GGCTGTGGGGCAGGCAGAAGTGG - Intronic
901300455 1:8196573-8196595 GGCTGAGGGAGAGGGAGAAGAGG - Intergenic
901777343 1:11569500-11569522 GACTCTGGGAGTGGCATGAGTGG + Intergenic
901840156 1:11949268-11949290 GGATGTGGGAGGGGCAGGAAGGG + Intronic
902179270 1:14675552-14675574 GGAGTGGGGAGAGGCAGGTGGGG - Intronic
902374999 1:16026435-16026457 GGGTTGGGGAGATGGAGGAGGGG + Intronic
902379967 1:16048235-16048257 GGGCTTGGGAGATGGAGGAGGGG + Intronic
902531454 1:17093474-17093496 GGCTGAGGGTGAGGCAGGTGTGG - Intronic
902651216 1:17838857-17838879 GGGACTGGGAGAGGCAGGAATGG - Intergenic
902818238 1:18928174-18928196 GGGCTTGGGGCAGGCAGGAGGGG - Intronic
902986390 1:20156934-20156956 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
903177551 1:21590040-21590062 GCCTTGGGGAGACCCAGGAGGGG - Intergenic
904019733 1:27453927-27453949 GGCTTTGGGAGAGTATGCAGGGG - Intronic
904225087 1:29010400-29010422 GGATTAGGAAGAGGCAAGAGAGG + Intronic
904281561 1:29424080-29424102 GCATATGGGAGAGGCAGGAAGGG + Intergenic
904281676 1:29424943-29424965 GGGTTTGGGGTGGGCAGGAGTGG - Intergenic
904310608 1:29627079-29627101 GGCTTTGGGTCAGACAGAAGTGG - Intergenic
904453454 1:30631935-30631957 GGCTTAGGGAGAGGAAGGGGTGG + Intergenic
904677132 1:32205493-32205515 GGCTGTGGGAGGGGCAGTCGGGG + Intergenic
904850484 1:33455555-33455577 GGCTGATGGAGAGGGAGGAGAGG - Intergenic
905011165 1:34747952-34747974 GGGTTGGGGAGGGGCAGGAAAGG - Intronic
905014372 1:34767181-34767203 AGCTTAGGAAGAGGAAGGAGAGG - Intronic
905224305 1:36469102-36469124 AGCCTTGGGAGAGAGAGGAGAGG + Intronic
905295913 1:36954305-36954327 GGCTCCAGGAGAGGCAGCAGGGG - Intronic
905527493 1:38649998-38650020 GGCTTGGGGAGAGGCAGGCAGGG - Intergenic
905694998 1:39967556-39967578 GGTTCTGGGAAGGGCAGGAGGGG + Intronic
905905577 1:41616085-41616107 GGCTTTGGGAGTGGAGGGAGAGG - Intronic
906187391 1:43871896-43871918 GGGTTTGTGGGAGGGAGGAGGGG + Intronic
906344261 1:45005451-45005473 GGCTTTGGGATGGGGAGGAGTGG + Intronic
906381619 1:45335904-45335926 GGCTTTGGGAGAGTCTGGGGTGG - Intronic
906472414 1:46142229-46142251 GGCATTTGGATAGACAGGAGAGG - Intronic
906575400 1:46884966-46884988 AGCTTTGGCTGAGGCAGAAGAGG - Intergenic
906596576 1:47082929-47082951 AGCTTTGGCTGAGGCAGAAGAGG + Intronic
906634693 1:47401289-47401311 GGCTTTGGAAGAGGTTAGAGAGG - Intergenic
907217463 1:52877227-52877249 GGCTTTAGGAAGGGTAGGAGAGG - Intronic
908077928 1:60541513-60541535 GGCTATGGGAGAAGCGGGAATGG + Intergenic
909177526 1:72380005-72380027 AGATTTCGGAGAGGCAGGGGTGG - Intergenic
910263819 1:85317042-85317064 TGGTTTGGGAGAGGCAGGGAAGG - Intergenic
910842191 1:91571302-91571324 AGCTTAGGGAAAGGCAGAAGTGG - Intergenic
910904749 1:92163519-92163541 GGTTTGGGGACAGGAAGGAGAGG + Intergenic
911531827 1:99052091-99052113 GGCTTTGGGAGGGGCTGGCAGGG + Intergenic
911893427 1:103401070-103401092 AGATTTGGGAGAGGCCAGAGTGG - Intergenic
911973597 1:104465251-104465273 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
912446569 1:109740828-109740850 GGCTGAGGGAGAGACAGGACTGG - Intronic
912554780 1:110508164-110508186 GGCCTTGTCACAGGCAGGAGGGG + Intergenic
913129515 1:115827242-115827264 GGGGTTGGGGGAGGCCGGAGGGG - Intergenic
913139651 1:115928190-115928212 GGTTGTGGGAGCTGCAGGAGTGG - Intergenic
913231898 1:116746877-116746899 AGGTTTAGGAGAGGGAGGAGGGG - Intergenic
913307564 1:117448774-117448796 GAATTTGGGAGTGGGAGGAGTGG + Intronic
913661667 1:121010463-121010485 GGGGTTGGGAGAGGCATGTGAGG + Intergenic
914013038 1:143793643-143793665 GGGGTTGGGAGAGGCATGTGAGG + Intergenic
914164787 1:145167542-145167564 GGGGTTGGGAGAGGCATGTGAGG - Intergenic
914651663 1:149702252-149702274 GGGGTTGGGAGAGGCATGTGAGG + Intergenic
914680024 1:149932613-149932635 GTCTGTGGGAGAGGTGGGAGAGG + Intronic
915081490 1:153355644-153355666 TGCTTTGTCAGAGGCAGCAGAGG + Intergenic
915466044 1:156098666-156098688 GGCTTGTGGAGAGGATGGAGGGG + Intronic
915523799 1:156464131-156464153 GGGGTGGGGAGAGGCAGCAGAGG + Exonic
916560443 1:165930177-165930199 GGGTTGGGGAGGGGCATGAGAGG + Intergenic
916599150 1:166275805-166275827 GGCTGTGGTAGAGACAGAAGTGG - Intergenic
917143502 1:171862568-171862590 GGCCTAGGGAGAGGAAGGAATGG + Intronic
917583915 1:176405709-176405731 GCCTTTGGAAGAGGCAGGAAAGG - Intergenic
917802259 1:178581480-178581502 GGCCTTGGGTGAGGCTGCAGGGG - Intergenic
918113241 1:181476400-181476422 GGTTCTTGGAGAGGCAGGATTGG + Intronic
918230668 1:182528329-182528351 AGATTTGGGAGGGGCCGGAGTGG - Intronic
918402540 1:184177995-184178017 GGCTGTGGGAGAAGCAGGTTTGG - Intergenic
918464250 1:184805818-184805840 GGACTTGGGAGAGAAAGGAGTGG + Intronic
918647425 1:186919869-186919891 GGCTTAGGGACAGGCAGGAGGGG + Intronic
919407335 1:197201342-197201364 AGCTCTGGGAGGGGAAGGAGCGG - Intergenic
919830618 1:201538401-201538423 GGACTTGGGAGTGGGAGGAGGGG - Intergenic
919895460 1:202007221-202007243 GGGTTTGGGAGTGGGATGAGGGG + Intergenic
919920657 1:202164706-202164728 GGCTGTGGGAGAGCAGGGAGGGG + Intergenic
920433844 1:205935837-205935859 AGCTTTGGGAGAAGCAGAGGAGG + Exonic
920513804 1:206569333-206569355 GGTTTTGGGAGGGGAAGAAGAGG + Intronic
920668895 1:207987880-207987902 TGCTGTAGTAGAGGCAGGAGAGG - Intergenic
921329393 1:214020386-214020408 GGTTTTGGGAGAGGGTAGAGTGG - Intronic
921747179 1:218752149-218752171 GGCTTGGGAACAGGTAGGAGGGG + Intergenic
922505519 1:226123382-226123404 GGCTTGGGGAGGGCCTGGAGAGG - Intergenic
922767440 1:228163278-228163300 GGCTCTGGCAGAGGAAGGGGTGG + Intergenic
922909662 1:229205001-229205023 CCTTTTGGGAGAGGAAGGAGTGG + Intergenic
923199078 1:231694351-231694373 GGCACTGTGAGAGCCAGGAGGGG - Exonic
924069689 1:240263454-240263476 AGCTATGGAAGAGGTAGGAGTGG + Intronic
924934780 1:248758634-248758656 ACCTCTGGGAGAGGGAGGAGTGG - Intergenic
1062848977 10:728843-728865 GGCTTGGGGAGGGTCAGGAAGGG - Intergenic
1062861297 10:812459-812481 GGCCTTGGCAGAGGCAGGTGTGG - Exonic
1063609054 10:7547741-7547763 GTGTATGGGAGAGGGAGGAGTGG - Intergenic
1063714711 10:8515126-8515148 GGATATGGTGGAGGCAGGAGTGG + Intergenic
1063848576 10:10160167-10160189 GGCTGTGGGAGGGGAAGAAGAGG + Intergenic
1063963288 10:11325021-11325043 GGGTGGGGGAGAGTCAGGAGAGG + Intronic
1063979882 10:11444649-11444671 GGCTGGGGGTGAGGCTGGAGCGG - Intergenic
1064220622 10:13437468-13437490 GCATCAGGGAGAGGCAGGAGGGG + Intergenic
1064277904 10:13924022-13924044 GGCTAGGGGAGAGGCAGTGGAGG + Intronic
1064369756 10:14741097-14741119 GGCTTTGGGAGTCAGAGGAGTGG + Intronic
1064395778 10:14981006-14981028 GGCTTGGGAACAGGCAGGAGGGG + Intronic
1064397474 10:14993193-14993215 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1064488524 10:15823777-15823799 GGCGGTGGGAGAAGCATGAGGGG - Intronic
1064902582 10:20311315-20311337 AGATTTGGGAGAGGCTGGGGTGG - Intergenic
1065684374 10:28269175-28269197 ACCTTTGGGAGAGGCAGGTGAGG + Intronic
1065727305 10:28678042-28678064 GGCTTTGTTAGCGGCAGGCGAGG + Intronic
1065918005 10:30368322-30368344 GGCTACGGGAGTGGGAGGAGAGG - Intronic
1066289432 10:34000222-34000244 AGCTCTGTGGGAGGCAGGAGTGG - Intergenic
1066390176 10:34972026-34972048 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1067430559 10:46240799-46240821 GGCTGTGGCAGTGGCAGCAGTGG - Intergenic
1067468026 10:46515866-46515888 TGCTTGGGGAGAGGGAGGATTGG - Intergenic
1067701408 10:48575806-48575828 GGCCTTGGAAGAAGCAGGGGAGG - Intronic
1068059719 10:52051979-52052001 AGCTTTGGGACAAGCGGGAGAGG - Intronic
1068063847 10:52103399-52103421 GGCTGAGGGGGAGGAAGGAGAGG - Intronic
1068292680 10:55024781-55024803 GGCAGTGGGAATGGCAGGAGGGG - Intronic
1069275093 10:66580723-66580745 TGCTTTGGCAGAGGAAGAAGAGG + Intronic
1069638036 10:69937525-69937547 GGCATTTGTAGAGGAAGGAGGGG - Intronic
1069739755 10:70679830-70679852 GGCTTTGGGAGGGGCAGGGGAGG + Intronic
1069853662 10:71426489-71426511 GACTTCAGGTGAGGCAGGAGGGG + Intronic
1069955089 10:72044987-72045009 AGCTGTGGGTGAGGCAGGACCGG + Intergenic
1070345927 10:75541880-75541902 GGCTTGGGGAGAGAGAGGTGGGG - Intronic
1070733787 10:78849872-78849894 GGGTGTGGGAGAGGATGGAGAGG - Intergenic
1071282002 10:84111694-84111716 GGCTTAGGGACAGGCAGGAGGGG - Intergenic
1071294805 10:84211782-84211804 GTCTGTGGCAGAGGCAGGAGGGG + Intronic
1071522834 10:86341552-86341574 AGCTCTGGGAGCCGCAGGAGAGG - Intronic
1071859437 10:89657044-89657066 AGATTTGGGAGGGGCAGGGGTGG + Intergenic
1071999287 10:91178330-91178352 GCCTTTGGGAGTGACTGGAGAGG + Intronic
1072706770 10:97686824-97686846 GGCTGTGGAAGAGGTTGGAGTGG - Exonic
1072739657 10:97901756-97901778 TCCTTTGCGGGAGGCAGGAGAGG - Intronic
1072894197 10:99351623-99351645 GGCTTTATCACAGGCAGGAGAGG - Intronic
1072994269 10:100229473-100229495 GGCCCTGGGAGATGCGGGAGCGG - Exonic
1073105544 10:101030497-101030519 GGCCTAGGGTGAGACAGGAGGGG - Intronic
1073332000 10:102676195-102676217 GGCTGGGGCAGAGGCAGGGGTGG + Exonic
1073435594 10:103513884-103513906 GGCTGTGGGAGAGGAGGAAGGGG + Intronic
1073633957 10:105178135-105178157 GGCTCTGGTGGAGGCAGGAATGG + Exonic
1074022277 10:109596470-109596492 AGATTTGGGAGGGGCAGGAGTGG - Intergenic
1074106684 10:110394165-110394187 TGCATTGGGACAGGCAGGAGTGG - Intergenic
1074110963 10:110422675-110422697 AGCTTGGGGAAGGGCAGGAGAGG + Intergenic
1074210991 10:111335021-111335043 GGCTCTGGGAGAGGCAGAGAAGG - Intergenic
1074262990 10:111872479-111872501 GTCTTAGGGAGAAGCAGTAGGGG + Intergenic
1074383230 10:112996917-112996939 GGCTTGGGGAGAGAGAGGAAAGG + Intronic
1074826957 10:117221553-117221575 GGCTTTCAGAGAGCCAGGTGGGG - Intergenic
1075015701 10:118908694-118908716 GACTTTGGGGAAGCCAGGAGAGG + Intergenic
1075161648 10:120029609-120029631 GGAGGTGGGAGAGGGAGGAGAGG + Intergenic
1075207836 10:120462236-120462258 GGGTGTGGGAGTGGCAGGAAGGG + Intronic
1075320595 10:121488917-121488939 AGCTTCAGGAGAGGCAAGAGTGG - Intronic
1075488567 10:122847375-122847397 GGCTGTGGATGAGGCAGGACTGG + Intronic
1075923933 10:126235581-126235603 GGCTGTTGGAAAGGCAGCAGCGG + Intronic
1076175270 10:128363347-128363369 GTCTTTGTAAGAGGAAGGAGAGG + Intergenic
1076761357 10:132607506-132607528 GGCTTTGGCTCAGGCAGGGGCGG + Intronic
1076770336 10:132659391-132659413 AGCTCTGGGTGAGGCGGGAGTGG + Intronic
1076827061 10:132974448-132974470 GAGTTGGGGAGAGGCAGGTGCGG - Intergenic
1076839863 10:133040632-133040654 GGCTGTGGGCGGGGCAGGGGCGG + Intergenic
1076945053 10:133640827-133640849 GGCTCGGGGAGGGGGAGGAGCGG - Intergenic
1077025744 11:439160-439182 GGCTGTGGGACAGGAAGGATGGG - Intronic
1077060856 11:617324-617346 GGCTGGGGGAGAGGGTGGAGGGG + Exonic
1077077689 11:708821-708843 GGCCTGGGGTGGGGCAGGAGTGG + Intronic
1077159938 11:1108055-1108077 GGCTGGGTGAGAGGGAGGAGGGG + Intergenic
1077321896 11:1946531-1946553 GGCCTTGCCAGAGGCTGGAGGGG + Intergenic
1077322345 11:1947898-1947920 GGCTTTGGGGCAGGCAGGGCGGG + Intronic
1077392416 11:2306275-2306297 AGCTAGGGGAGAGGCCGGAGGGG - Intronic
1077589258 11:3479049-3479071 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1077730494 11:4724167-4724189 GGACATGGTAGAGGCAGGAGTGG + Intronic
1077766529 11:5164752-5164774 GGCTAAGGGAGAGGGAGGAATGG + Intronic
1077781396 11:5333768-5333790 TTCTTTGGAAGAGGCAGGAGAGG - Intronic
1077836177 11:5929787-5929809 GGACTTGGGAGGGGCAGGTGAGG - Intronic
1078061347 11:8047127-8047149 GCAGTGGGGAGAGGCAGGAGAGG - Intronic
1078516365 11:12026127-12026149 AACCTTGGGAGAGGCAAGAGGGG - Intergenic
1079142612 11:17822584-17822606 GAGTTTCAGAGAGGCAGGAGTGG + Intronic
1079279320 11:19073443-19073465 GGCTCTGGGTGAGGTAGGTGGGG - Intergenic
1079450990 11:20599592-20599614 GGGTTTGGCTCAGGCAGGAGAGG - Exonic
1079506272 11:21155811-21155833 GAGTTGGGGAGAGGGAGGAGAGG + Intronic
1079604393 11:22346432-22346454 GGAGTTGGAAGAGTCAGGAGGGG + Intronic
1079910889 11:26307903-26307925 GACTTTGTGAGATGAAGGAGAGG - Intergenic
1080169821 11:29287239-29287261 GTCTTGGGGAGAGGGAGAAGTGG + Intergenic
1080225005 11:29950335-29950357 GGTGTTGGGGGAGGCAGGAAAGG - Intergenic
1080415312 11:32064727-32064749 GGCTTTGTGTTAGGCAGGAGAGG + Intronic
1081616588 11:44594953-44594975 GGCTTTGGGTGATCTAGGAGAGG - Intronic
1081628281 11:44668967-44668989 AGCAGTGAGAGAGGCAGGAGAGG - Intergenic
1081640527 11:44750308-44750330 GGCTATGAGGAAGGCAGGAGAGG - Intronic
1081999057 11:47383017-47383039 TACTTTGGGAGGGGGAGGAGTGG - Intergenic
1082637903 11:55619274-55619296 GGGGTAGGGGGAGGCAGGAGGGG - Intergenic
1083197437 11:61096984-61097006 GGTTTAGGGACAGGTAGGAGGGG - Intergenic
1083281398 11:61629234-61629256 GGCATTGAGCGGGGCAGGAGAGG + Intergenic
1083460378 11:62807135-62807157 TCCTTTGGGAGAGGCTGGAGAGG + Exonic
1083591496 11:63897971-63897993 GGATTTGGTAGACGCAGCAGAGG + Intronic
1083636217 11:64122422-64122444 GGCTTTGGGAGAGTCAGGTTGGG - Intronic
1084203369 11:67576944-67576966 GGGTCTGGGACAGGCAGGACTGG + Intergenic
1084227960 11:67729169-67729191 GGCTTTGGAACAGGCAGGAGGGG + Intergenic
1084244952 11:67850681-67850703 GGCTTGGGAACAGGCAAGAGGGG + Intergenic
1084261364 11:67980852-67980874 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1084270556 11:68027086-68027108 GGCTGTGGGAGCAGCAGGTGGGG - Intronic
1084424770 11:69078670-69078692 AGCGCTGGGCGAGGCAGGAGGGG - Intronic
1084488210 11:69463475-69463497 GATTTTGGGAGAGGGAGGAAGGG - Intergenic
1084599531 11:70136608-70136630 GGCCCAGGGAGAGTCAGGAGAGG + Intronic
1084617763 11:70247775-70247797 GGCTCTGGGAGGGGAAGGAGAGG - Intergenic
1084807268 11:71587696-71587718 GGCTTGGGAACAGGCAGGAGGGG - Intronic
1084827739 11:71743896-71743918 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1084838589 11:71826240-71826262 GGCTTTAGAACAGGAAGGAGAGG - Intergenic
1084847199 11:71910161-71910183 GGCTTGGGAACAGGCAGGAGGGG - Intronic
1084934703 11:72580719-72580741 GGCTCTGAGATAGGGAGGAGGGG - Intronic
1084956461 11:72694131-72694153 TGGATTGGGAGAGGGAGGAGGGG - Intronic
1084958295 11:72703077-72703099 GGCCTAGGAAGAGGCAGGGGAGG + Exonic
1085204584 11:74723183-74723205 GGCTTTGGGACAGACTGGATAGG + Intronic
1086421731 11:86644201-86644223 GGGTCACGGAGAGGCAGGAGCGG - Intronic
1087007159 11:93481819-93481841 GAATTTGGGAGAGACAGCAGCGG - Intronic
1088060547 11:105644236-105644258 GGCTTTGGGACAGCAAAGAGGGG - Intronic
1088469188 11:110175985-110176007 AGCAGTGGGAGAGGCGGGAGTGG + Intronic
1088932667 11:114367709-114367731 GCCTGTGGTAGAGGCAGGAGGGG - Intergenic
1089055888 11:115584501-115584523 GGCTTTGGGAGAGACGGTTGGGG + Intergenic
1089177073 11:116556780-116556802 GGATTTGGGAGAGTCGGGTGAGG + Intergenic
1089203300 11:116738708-116738730 GGTTTTGGGAGAGGAGGTAGAGG - Intergenic
1089220984 11:116871404-116871426 GGCTGTAGATGAGGCAGGAGAGG + Intronic
1089378596 11:118012058-118012080 GGCTTTGGGAAAGGGAGCACAGG + Intergenic
1089646566 11:119884258-119884280 GGATTGGGGAGAGAGAGGAGAGG - Intergenic
1089940513 11:122411573-122411595 GGTTTTGGGAGAGGGAGAAGAGG - Intergenic
1089943223 11:122440954-122440976 GGCTGAGGAAGAGCCAGGAGGGG - Intergenic
1090035506 11:123246279-123246301 GGCTTTGGGAGTGGGATGGGAGG + Intergenic
1090461135 11:126892432-126892454 GGCCCTGGGAGAGGCACAAGTGG + Intronic
1090877792 11:130806388-130806410 GCCTTTGGGAGATTCAGGATGGG + Intergenic
1090978889 11:131699409-131699431 TGCTATGATAGAGGCAGGAGTGG + Intronic
1091353284 11:134914684-134914706 GGCTCTGGGTGAGTCAGGTGAGG + Intergenic
1202804912 11_KI270721v1_random:1844-1866 GGCCTTGCCAGAGGCTGGAGGGG + Intergenic
1202805363 11_KI270721v1_random:3211-3233 GGCTTTGGGGCAGGCAGGGCGGG + Intergenic
1091389742 12:118788-118810 GGCTATGTGAGAGCCAGGAGAGG - Intronic
1092400099 12:8167853-8167875 GGCTTTAGAACAGGAAGGAGAGG + Intronic
1092415523 12:8287812-8287834 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1092432642 12:8421420-8421442 GGCTTGGAAACAGGCAGGAGGGG + Intergenic
1093289075 12:17300106-17300128 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1094025593 12:25958070-25958092 GGCAATGACAGAGGCAGGAGAGG - Intergenic
1094295715 12:28902083-28902105 AGATTTGGGAGAGGCCGGGGTGG + Intergenic
1094321910 12:29193399-29193421 GGGTTAGGGAGAGGGAGGAATGG - Intronic
1094648239 12:32348672-32348694 GGTTTGGGCAGAGTCAGGAGAGG - Intronic
1095812302 12:46383654-46383676 GGTTCGGGGAGAGGGAGGAGGGG + Intergenic
1096010815 12:48212866-48212888 GGCTTTGGCAGACGCTGGTGAGG - Intergenic
1096104272 12:48987306-48987328 GGCTATGGGAGACGCCGGTGGGG - Intergenic
1096180946 12:49550030-49550052 GGGGTTGGGAGTGGCAGAAGAGG - Intronic
1096504637 12:52084979-52085001 GGATGAGGGAGAGGGAGGAGGGG + Intergenic
1096509241 12:52118377-52118399 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1096516131 12:52156594-52156616 CGCTTGGGGAGAGGTAGGATTGG + Intergenic
1096627606 12:52904976-52904998 GGACATGGTAGAGGCAGGAGTGG + Exonic
1096863796 12:54549469-54549491 TCCTTTGGGAGGGGGAGGAGTGG + Exonic
1096867456 12:54573260-54573282 GGATGTGGCAGGGGCAGGAGGGG + Intronic
1097165895 12:57086660-57086682 GGAGTTGGGGGTGGCAGGAGTGG + Intronic
1097190414 12:57216855-57216877 GGCTGCGGGAGCGGCGGGAGCGG - Exonic
1097282231 12:57852248-57852270 GGCTCTGTGAGAGGCATTAGGGG - Intergenic
1097509351 12:60517669-60517691 GGATGTGGGAAAGGCGGGAGGGG - Intergenic
1098748407 12:74267555-74267577 GGCTTAGGGACAGGCAGGAGGGG - Intergenic
1098773249 12:74581776-74581798 GTTTTTGGAAGAGGGAGGAGGGG - Intergenic
1099088740 12:78279032-78279054 AGATTTGGGAGAGCCAGGGGTGG + Intergenic
1100098987 12:91079323-91079345 GGGACTGGGTGAGGCAGGAGGGG + Intergenic
1101029476 12:100645373-100645395 GGCTTAGGGACAGGCAGGAGGGG + Intergenic
1101236454 12:102794782-102794804 GGCTTGGTGAGAGGTAGCAGAGG - Intergenic
1101430104 12:104619648-104619670 AGCACTGGGAGAGGCTGGAGTGG + Intronic
1101598130 12:106185265-106185287 GGCCTGGGGCTAGGCAGGAGTGG + Intergenic
1102033560 12:109758568-109758590 GGTGTGGGGAGGGGCAGGAGTGG - Intronic
1102212836 12:111139326-111139348 GGGTTTGGGAGAGAAAGGAGAGG + Intronic
1102803953 12:115762947-115762969 GGCGTTGGGTAAGGCTGGAGAGG - Intergenic
1103904999 12:124322580-124322602 GGCTTTGGGGGAGTGTGGAGGGG + Intergenic
1104101434 12:125616369-125616391 GGTTATAGGAGAGGCAGAAGAGG + Intronic
1104292671 12:127484063-127484085 GGCTTGGGAACAGGTAGGAGGGG - Intergenic
1104323503 12:127774065-127774087 TGCTCTGGTAGAGGCATGAGAGG - Intergenic
1104376785 12:128270049-128270071 GACTTGGGCCGAGGCAGGAGAGG + Intronic
1104648510 12:130514166-130514188 TGCTTTGAGAGAGGCAGCAGGGG - Intronic
1104709396 12:130974838-130974860 GGCTCTGGAAGAAGCAGGGGTGG - Intronic
1104759547 12:131288758-131288780 GCCCTGGGGAGAGGGAGGAGGGG + Intergenic
1104765257 12:131326051-131326073 GACCATGGGAGATGCAGGAGGGG - Intergenic
1104821166 12:131678454-131678476 GCCCTGGGGAGAGGGAGGAGGGG - Intergenic
1104959098 12:132479774-132479796 GGCCCAGGGAGAGGCAGGGGTGG - Intergenic
1105290215 13:19048656-19048678 GTCTCAGAGAGAGGCAGGAGTGG + Intergenic
1106247953 13:27964864-27964886 GGCTCTCTGAGAGGCAGGTGGGG - Exonic
1106505147 13:30364678-30364700 GGCTTTGGGAGAGCATGCAGAGG - Intergenic
1106633480 13:31502434-31502456 TACGTTGGGAGAGGCAGGAGAGG + Intergenic
1107544419 13:41422983-41423005 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1107560378 13:41552385-41552407 GGCACTGGGACAGGCTGGAGTGG - Intergenic
1107832004 13:44382838-44382860 GGCATTGGGAGAGGCAGATAAGG + Intronic
1107905121 13:45054527-45054549 GGGTTTGGAAGAAGCAGGTGCGG - Intergenic
1108431977 13:50362455-50362477 GGGTTTGGGGGAGGGAGGAGGGG - Intronic
1108556440 13:51598067-51598089 TGCTTTGGCAGGGGCAGGTGTGG + Intronic
1108721968 13:53141495-53141517 GTGTTTGGAAGAGGCAGCAGAGG - Intergenic
1109802783 13:67400436-67400458 GGCTTGGGGGAAGGCAGGAAAGG - Intergenic
1111218708 13:85178011-85178033 AGATTTGGGAGGGGCAGGGGTGG - Intergenic
1111798270 13:92951244-92951266 TGCTTTGTGAGTGGCAAGAGGGG + Intergenic
1111949543 13:94699908-94699930 GGGTTTGGGAGAGAGAGGGGTGG + Intergenic
1113040175 13:106096207-106096229 GTCTTTGGGACAGGCAGTGGAGG - Intergenic
1113243743 13:108370375-108370397 GGTATTGGGAGAGGCAGAAGTGG - Intergenic
1113401695 13:110000214-110000236 CGTTTTGGGAGAGGCGGCAGAGG + Intergenic
1113425370 13:110203432-110203454 AGCGCTGGGAGAGGAAGGAGAGG - Intronic
1113438729 13:110311991-110312013 GGCTTTGGTACAGGGAGGAGAGG + Intronic
1113780486 13:112973991-112974013 GGCAGTGGAAGAGTCAGGAGCGG - Intronic
1113817031 13:113179544-113179566 GCCTTTGTGACAGGCAGAAGTGG + Intronic
1113987033 13:114325455-114325477 TGCTTCTGGAGAAGCAGGAGGGG - Exonic
1113988865 13:114342527-114342549 GGCTCTAGGAGATGCAGAAGGGG + Intergenic
1114552071 14:23538542-23538564 GGTCTTGGGGGTGGCAGGAGGGG - Intronic
1115309845 14:31968103-31968125 GGCTTTGTCTGAGGCATGAGAGG + Intergenic
1116296973 14:43123653-43123675 GGGTAAGGGAGAGGCAGTAGGGG + Intergenic
1116574653 14:46557589-46557611 GCCCTTGGGTGGGGCAGGAGGGG + Intergenic
1116867135 14:50040145-50040167 GGCTGCGGCAGAGGGAGGAGAGG - Intergenic
1117038552 14:51750267-51750289 AGCTTGGGAACAGGCAGGAGGGG - Intergenic
1117369459 14:55063123-55063145 GGCTTGGGGAGGAGGAGGAGCGG - Exonic
1117708160 14:58494950-58494972 GGCTTTGTGAGAGGAATGAATGG - Intronic
1118822714 14:69355548-69355570 GGCTTTGGGAGAGGTAGGTTTGG - Exonic
1118867953 14:69718099-69718121 TGCATTGGAAGTGGCAGGAGAGG + Intergenic
1118974442 14:70664872-70664894 GACTTTGGGGGAGGCAAGGGAGG - Intronic
1119172658 14:72546690-72546712 GGGTCTGGGGAAGGCAGGAGAGG - Intronic
1119208684 14:72813178-72813200 GGTTTTGAGAGAGTCAGGAGAGG + Intronic
1119567965 14:75645012-75645034 GGCTTTGGAGGAGGCGGGCGTGG + Intronic
1119706958 14:76788974-76788996 GGCCCTGGGAGAGGCAGAAGGGG - Exonic
1119738782 14:77000494-77000516 GACTGAGGGACAGGCAGGAGAGG - Intergenic
1119777763 14:77259099-77259121 GGCAATGGGTGAGGCAGGTGTGG - Exonic
1121426924 14:93859037-93859059 GGCTTGGAGCGAGGCGGGAGTGG + Intergenic
1122126302 14:99580361-99580383 TGCAGTGGGGGAGGCAGGAGGGG + Intronic
1122794297 14:104198265-104198287 GCCTTTGGGAGAGGCATCTGTGG + Intergenic
1122923943 14:104891319-104891341 GGCTGTGGGGCAGGCAGGGGGGG + Intronic
1202918404 14_KI270723v1_random:6145-6167 GGCTCAGGGAGGGGGAGGAGCGG - Intergenic
1202926222 14_KI270724v1_random:28426-28448 GGCTCGGGGAGGGGGAGGAGCGG + Intergenic
1123473058 15:20568989-20569011 GGCTTCAGGAGCAGCAGGAGAGG + Intergenic
1123473063 15:20569010-20569032 GGCTTCGGGAGCAGGAGGAGAGG + Intergenic
1123644943 15:22431343-22431365 GGCTTCGGGAGCAGGAGGAGAGG - Intergenic
1123644948 15:22431364-22431386 GGCTTCAGGAGCAGCAGGAGAGG - Intergenic
1123733354 15:23163979-23164001 GGCTTCGGGAGCAGGAGGAGAGG + Intergenic
1123733357 15:23164000-23164022 GGCTTCAGGAGCAGCAGGAGAGG + Intergenic
1123751487 15:23361371-23361393 GGCTTCGGGAGCAGCAGGAGAGG + Exonic
1123762121 15:23441239-23441261 GGCTACGGGAGAAGGAGGAGAGG - Exonic
1123800110 15:23810566-23810588 GGCTAAGTGAGAGGCAGGAAAGG + Intergenic
1124177689 15:27441673-27441695 GGGATTGGGGGAGGCAGGACAGG + Intronic
1124283857 15:28385275-28385297 GGCTTCGGGAGCAGGAGGAGAGG + Exonic
1124283860 15:28385296-28385318 GGCTTCAGGAGCAGCAGGAGAGG + Exonic
1124298837 15:28526318-28526340 GGCTTCAGGAGCAGCAGGAGAGG - Exonic
1124298840 15:28526339-28526361 GGCTTCGGGAGCAGGAGGAGAGG - Exonic
1124458425 15:29866455-29866477 GGCTTTGGCAGATGCAGGGAAGG + Intronic
1124631450 15:31339859-31339881 TGCTGTGGGAGATGCAGCAGCGG + Intronic
1124791562 15:32731847-32731869 GACTCTGGGAGAGGCTGGTGTGG + Exonic
1124959306 15:34382860-34382882 GGCTTCAGGAGCAGCAGGAGAGG - Exonic
1124975932 15:34529081-34529103 GGCTTCAGGAGCAGCAGGAGAGG - Exonic
1125487622 15:40123346-40123368 GGATATGGGGGAGGAAGGAGCGG - Intergenic
1125675850 15:41502283-41502305 GGCGGTGGGAGAGGGCGGAGGGG - Intronic
1126476199 15:49067929-49067951 GGGCTTGGGAGAGACAGGAATGG - Intergenic
1127049073 15:55061282-55061304 GGCTTTGAGTTAGGCAGGATAGG - Intergenic
1127691571 15:61402376-61402398 TGGATTGGGAGAGACAGGAGTGG + Intergenic
1128719052 15:69932599-69932621 GGATTGGGCAGAGGGAGGAGAGG + Intergenic
1128762009 15:70223502-70223524 GGCCTGAGGGGAGGCAGGAGGGG - Intergenic
1129038006 15:72662648-72662670 GGCTGTGGAAGAAGGAGGAGAGG + Exonic
1129106704 15:73314432-73314454 GGGTTCGGGAGTGGGAGGAGGGG + Intergenic
1129211883 15:74074583-74074605 GGCTGTGGAAGAAGGAGGAGAGG - Exonic
1129227763 15:74179870-74179892 GGCTATGGGAGAGCCAGCAGGGG - Intronic
1129398520 15:75266501-75266523 GGCTGTGGAAGAAGGAGGAGAGG + Exonic
1129402128 15:75290777-75290799 GGCTGTGGAAGAAGGAGGAGAGG + Exonic
1129475675 15:75783237-75783259 GGCTGTGGGAGAAGGAGGAGAGG + Intergenic
1129731322 15:77934307-77934329 GTGCTTGGGGGAGGCAGGAGAGG - Intergenic
1129758462 15:78112719-78112741 GGCTTTGGGGGTGGCAGGGCCGG - Intronic
1129789574 15:78331709-78331731 TGCTGGGGGAGAGGAAGGAGTGG + Intergenic
1130515785 15:84624874-84624896 GGGATTGGGTGAGGCAGGATAGG - Intronic
1130872284 15:87980994-87981016 GGCTATGGGAGAAGCAGGAGAGG - Intronic
1130995708 15:88902806-88902828 GGAATTGAGGGAGGCAGGAGTGG + Intronic
1131195651 15:90352546-90352568 GGCTGTGGGAGAGGTAGCTGTGG + Intronic
1131542767 15:93288730-93288752 GGGTTTGGGAAAGGAAGGAAAGG - Intergenic
1131559093 15:93424058-93424080 GGCTTTGTAAGAGGCAGGCAAGG + Intergenic
1131593883 15:93776747-93776769 GGGGTTGGGGGAGGCAGGAGGGG + Intergenic
1131670767 15:94617306-94617328 GGCTTGGAGAGAGGAAGGAGGGG - Intergenic
1132145888 15:99429733-99429755 GGCTTTGGTGGGGACAGGAGGGG + Intergenic
1132155368 15:99492234-99492256 GCCTTTGGTTGGGGCAGGAGGGG + Intergenic
1132167690 15:99611998-99612020 GGACTAGGGAGAGGAAGGAGTGG + Intronic
1132206942 15:99992859-99992881 GCCTGTGGGAGAAGCAGGGGAGG + Intronic
1132295078 15:100728781-100728803 TGCTTTGTGATAGGCAGGTGTGG + Intergenic
1132374152 15:101317598-101317620 GGCTTTGGGAGAGGCGGGAATGG - Intronic
1132393330 15:101454605-101454627 GGCTGTGGGGGAGGGAGGAGTGG + Intronic
1132400027 15:101499406-101499428 GGCTCTGGGAGAGGCTGCAGTGG - Intronic
1132626930 16:895627-895649 GGGAGTGGGAGAGCCAGGAGAGG + Intronic
1132668951 16:1094932-1094954 GGCTGGGGGAGAGGAAAGAGGGG + Exonic
1133392817 16:5422977-5422999 GGAGTGGGGAGAGGGAGGAGGGG + Intergenic
1133479489 16:6156265-6156287 AGCTGTGGGGGAAGCAGGAGAGG - Intronic
1133978841 16:10619039-10619061 GGCCTTGGCAGAGGGAGGAGGGG + Intergenic
1134150110 16:11798333-11798355 GGCTGTAGGAGAGACAAGAGGGG + Intergenic
1134251670 16:12578468-12578490 GTCCTTGGAAGAGTCAGGAGAGG + Intergenic
1134366755 16:13585957-13585979 GACATTGGTGGAGGCAGGAGAGG - Intergenic
1135681471 16:24460873-24460895 TGCTTTGGGGGAGGCAAGTGAGG + Intergenic
1136069877 16:27781321-27781343 GGCTCTGGCAGGGGCTGGAGAGG - Intergenic
1136108875 16:28052190-28052212 GGCTAAGAGAGGGGCAGGAGTGG + Intronic
1136367253 16:29814474-29814496 GGGCTTGGGACAGGCAGGGGAGG + Exonic
1136425202 16:30165544-30165566 GGTTTTTGGAGAGGCGGGGGGGG - Intergenic
1136576472 16:31128155-31128177 GGGGTTGGGAGAGGCCGGGGAGG + Intronic
1137543150 16:49378312-49378334 GGCCCTGGGAGAGGTCGGAGGGG - Intronic
1138531663 16:57637785-57637807 GGCCATGGGAAAGGCAGCAGGGG - Intronic
1138540414 16:57684272-57684294 GCCTTGGGGAGAGAGAGGAGGGG + Intronic
1138706937 16:58924793-58924815 GGCTGTTGGGGAGGCAGAAGTGG - Intergenic
1138872576 16:60909771-60909793 GGCTCTGGGAGAGTAAGAAGGGG + Intergenic
1139178737 16:64720878-64720900 GGTTTTTGGAGAGGCTGGAGAGG + Intergenic
1139363296 16:66416914-66416936 GACTTTGGGAGAGGGAGGAATGG + Intergenic
1139389929 16:66600991-66601013 GTCCATGGGAGAGGCAGGGGAGG + Intergenic
1140412892 16:74752210-74752232 GGCTTGGGGGGAGTCAAGAGTGG - Intronic
1140511078 16:75508910-75508932 TGATTTGGGAGTGGCAGGTGAGG - Intergenic
1141281277 16:82631768-82631790 AGCTTGGGGGAAGGCAGGAGAGG + Intronic
1141667772 16:85474703-85474725 GGAGTGGGGAGAGGGAGGAGGGG - Intergenic
1141745592 16:85923971-85923993 AGCTCGGGGAGAGGCGGGAGAGG + Intergenic
1141841391 16:86576438-86576460 GGCTGTGGGATAGGAAGGTGGGG + Intronic
1141934586 16:87228798-87228820 GGCTGTGGCTGTGGCAGGAGTGG - Intronic
1142239966 16:88940656-88940678 GGCCCTGGGAGAGGCAGAGGTGG - Intronic
1142717655 17:1755714-1755736 GGATTTGGGGGAAGCAGGTGGGG + Intergenic
1142950833 17:3478755-3478777 AAATTTGGGAGAGGCAGGATGGG - Intronic
1142951716 17:3486911-3486933 GGCTATGGCAGAGTCAGGGGTGG + Intronic
1143078781 17:4366370-4366392 GGCTCTGGGGGCGGCTGGAGCGG + Exonic
1143403559 17:6661070-6661092 GCTGTAGGGAGAGGCAGGAGTGG + Intergenic
1143861118 17:9891442-9891464 GGATAAGGGTGAGGCAGGAGAGG + Exonic
1143871023 17:9957398-9957420 GGCTTCGGGTGTGGCCGGAGGGG - Intronic
1144022137 17:11246941-11246963 AGCTTGGGGAGGGGCAGGAAGGG - Intronic
1144224499 17:13131820-13131842 GCATTTGGGAGGGACAGGAGGGG - Intergenic
1144782179 17:17813808-17813830 AGCTCTGGGAGGGGCAGGATGGG + Intronic
1144968092 17:19090254-19090276 TGCCCTGGGAGAGGCAGCAGCGG + Intergenic
1144979825 17:19161809-19161831 TGCCCTGGGAGAGGCAGCAGCGG - Intergenic
1144988397 17:19216423-19216445 TGCCCTGGGAGAGGCAGCAGCGG + Intronic
1145232731 17:21186405-21186427 GGCTTGGGGACAGGGAAGAGTGG - Intronic
1146550309 17:33775099-33775121 GGGCTTGGGAGAGACAGGAGAGG + Intronic
1146803372 17:35844941-35844963 GGCTATGGAGGAGACAGGAGTGG + Exonic
1146911290 17:36649949-36649971 GGCTGGGGGAGGGGAAGGAGGGG + Intergenic
1147227146 17:38988101-38988123 GGACTGGGGAGAGGCAGGATTGG - Intergenic
1147450172 17:40499563-40499585 GGCGTTGGGGGAGGCAGGAGAGG - Intronic
1147620170 17:41861215-41861237 GGTTATGGGAGAGCCAGGAGAGG - Intronic
1147716233 17:42510594-42510616 GGCTGGAGCAGAGGCAGGAGTGG + Intronic
1147721005 17:42539327-42539349 GCCCTTGGGAGTGGCAGCAGGGG + Intronic
1147746655 17:42698954-42698976 GGATGGGGGAGAGGCAGGACTGG - Exonic
1147968700 17:44207908-44207930 GGCTCTGGGGGAGACAGAAGCGG + Exonic
1148777883 17:50105745-50105767 GGCTTTGGGAGGAGCAGGGAGGG + Intronic
1148903189 17:50894028-50894050 GGAATTGGGAGAGCCAGGACAGG - Intergenic
1148935826 17:51164152-51164174 GGCTTCGGTAGAGGCAATAGAGG + Intronic
1149379090 17:56074827-56074849 TGCTTTAGGAGAGTCAGGAAAGG + Intergenic
1149537077 17:57441330-57441352 GGATTTAGGAGAGGCAAGAGGGG - Intronic
1149558395 17:57590735-57590757 GGCTTTAGGAGAGGCGGGGCAGG + Intronic
1149986704 17:61353035-61353057 GGGGTGGGGAGAGGGAGGAGAGG + Intronic
1149999685 17:61425948-61425970 GGGTTAGGGAGAGGAAGGATGGG + Intergenic
1150947796 17:69765913-69765935 GGATTGTGGAGGGGCAGGAGGGG - Intergenic
1151183856 17:72349472-72349494 GGCTCTGGAAGATGGAGGAGTGG + Intergenic
1151185264 17:72359527-72359549 GCCTTTAAGTGAGGCAGGAGAGG + Intergenic
1151288884 17:73134139-73134161 GGCTGTGGGAGTGGCAAGAAGGG - Intergenic
1151495097 17:74454125-74454147 GGCTTGGGGTGGGGCACGAGAGG - Intergenic
1151951121 17:77354666-77354688 AGCTTTGGGAGAAGCAGCTGAGG + Intronic
1152114458 17:78376933-78376955 GGCATTCTGAAAGGCAGGAGAGG - Intergenic
1152196221 17:78919949-78919971 GGCAGTGGCAGGGGCAGGAGGGG - Intronic
1152257548 17:79248957-79248979 GGCTTGGCGAGTGGCAGGCGGGG - Intronic
1152438026 17:80288084-80288106 GGCTTTGGGAGAGGCAGGAGTGG + Exonic
1152495347 17:80667230-80667252 GGGTCTTGGAGAGGCTGGAGGGG + Intronic
1152518265 17:80838715-80838737 AGCCTGGGCAGAGGCAGGAGGGG + Intronic
1152675155 17:81636539-81636561 GGCTCTGAGAGGGGCAGGACTGG + Intronic
1152749015 17:82054061-82054083 GGCTTGGCGAGAGGAAGCAGAGG + Intronic
1153365216 18:4248142-4248164 GGCTTTTGGAGAGGCAGCAAGGG - Intronic
1155901806 18:31400022-31400044 GGCATAGGGAGAGTCAGAAGAGG + Intronic
1156472301 18:37384860-37384882 GGCTCTGGGACAGGCAGGACTGG - Intronic
1157177886 18:45467775-45467797 GTCTGTGGGAGAGGGTGGAGTGG - Intronic
1157413352 18:47482135-47482157 GGCTTTGGGAGGGGAGGGAAAGG - Intergenic
1157446878 18:47752934-47752956 GGCTTTGGCACAGCCAGGTGGGG + Intergenic
1157498086 18:48170733-48170755 GGCTCTGGGAGAGGCACCTGCGG - Intronic
1157681495 18:49610978-49611000 TGCTTTGGGAAAGACAGGAGAGG + Intergenic
1158139708 18:54242754-54242776 GGCTGTGGGAGCAGCAGTAGTGG - Intergenic
1158292004 18:55953643-55953665 GGCTTAGGGACAGGCAGGATGGG - Intergenic
1159341659 18:67141611-67141633 TGCTTTGGGAGAGGCACCACTGG + Intergenic
1159607495 18:70490216-70490238 GGCTGTGGGACATGGAGGAGGGG + Intergenic
1160067445 18:75589019-75589041 CGCTTTGAGGGAGGCAGGCGGGG + Intergenic
1160668208 19:343563-343585 GGCGTTGTGGGAGGCAGGACTGG - Intronic
1160689496 19:454876-454898 AGCACTGGGAGAGGCAGGACGGG - Intronic
1160728244 19:628109-628131 AACGCTGGGAGAGGCAGGAGGGG + Intronic
1160931928 19:1574921-1574943 GGCCCTGGGTGTGGCAGGAGAGG + Intronic
1160973165 19:1779000-1779022 GGCATGCGGGGAGGCAGGAGAGG - Exonic
1161015166 19:1979731-1979753 GGCTGTGGGTGAGGGAGCAGGGG - Exonic
1161028205 19:2046328-2046350 GGCATTGGGGGAGCCGGGAGCGG - Intronic
1161072601 19:2270192-2270214 GGATTTGGGAGGCGCAGGATGGG + Intronic
1161166546 19:2790974-2790996 GGCTCTGGGAGAGGCTGGAGAGG - Intronic
1161284897 19:3463910-3463932 GGCTGGTGGAGAGGCTGGAGGGG - Intronic
1161317146 19:3622611-3622633 GGAGCTGGGAGAGGCAGGAGGGG + Intronic
1161567440 19:5011577-5011599 GGCCGTGGGAGAGGCAGGCAGGG + Intronic
1161648709 19:5470804-5470826 GGGTTGGGGACAGGAAGGAGGGG + Intergenic
1161684805 19:5697488-5697510 GGCTGAGGCAGAGGGAGGAGGGG + Intronic
1161889731 19:7026145-7026167 GCCTTTGTGGGAGGCAGGATGGG - Intergenic
1161891721 19:7044601-7044623 GCCTTTGTGGGAGGCAGGATGGG + Intergenic
1162139346 19:8576698-8576720 GGCTGCAGCAGAGGCAGGAGAGG - Intronic
1162564076 19:11435541-11435563 CATGTTGGGAGAGGCAGGAGTGG - Intronic
1162955729 19:14096922-14096944 GGGTTTGGGAGAGGAAGCATGGG + Intronic
1163095663 19:15055317-15055339 GGAGTTGGGAGTGGCAGGAGAGG - Intronic
1163328930 19:16623729-16623751 GGCTCCGGAAGAGGCACGAGGGG - Intronic
1163487138 19:17594671-17594693 GGCTAAGGGAGATGGAGGAGTGG - Intergenic
1163688504 19:18725657-18725679 GGCTCAGGAAGAGGGAGGAGGGG - Intronic
1163722563 19:18905174-18905196 GGCTTTGGAAACGGCAGCAGGGG + Intronic
1163943435 19:20515343-20515365 GGCTTAGGGACTGGCAGGAGGGG + Intergenic
1163966599 19:20752310-20752332 GGCTTGGGAACAGGCAGGAGGGG + Intronic
1164480818 19:28609773-28609795 GGCTTGGGAACAGGTAGGAGGGG - Intergenic
1164596043 19:29531084-29531106 GCCATTGGCAGAGGCAGGGGTGG + Intronic
1164621751 19:29700119-29700141 GGCTGTGGGAGGGGCTGCAGTGG + Intronic
1165037878 19:33047634-33047656 GGCTTGGGCAGAGGTCGGAGAGG - Intronic
1165157320 19:33796362-33796384 GGCTTCGGGAGAGGCGGGTGGGG + Intronic
1165257292 19:34586419-34586441 GGATTAAGGAGATGCAGGAGAGG - Intergenic
1165305527 19:35000558-35000580 GGCTTGGGGAGGGGGCGGAGCGG + Intronic
1165851500 19:38852352-38852374 AGTTTTGGGAGAGGGAGGGGCGG + Intergenic
1166276867 19:41760165-41760187 GGGATTGGGAGAGGCAGAATGGG - Intronic
1166328894 19:42067537-42067559 AGCTAGGAGAGAGGCAGGAGTGG + Intronic
1166471612 19:43083529-43083551 GGCTTGTTGAGACGCAGGAGGGG + Intronic
1166485230 19:43206479-43206501 GGCTTGTTGAGACGCAGGAGGGG + Intronic
1167158984 19:47755541-47755563 GGTTCTGGGAGAGGCTGGGGAGG + Intronic
1167250528 19:48396439-48396461 GGGTCTGGGAGAGGCAGAGGAGG + Intronic
1167464965 19:49645825-49645847 GGGGTTGGGGGAGGCAGGAGAGG + Intronic
1167674764 19:50877401-50877423 GGCTCTGGGGCAGGGAGGAGGGG + Intronic
1167744077 19:51340723-51340745 GGCTCTGGGAGAGGGAGAATGGG + Exonic
1167777651 19:51571394-51571416 GGCTTTGGGGGAGTGATGAGGGG + Exonic
1167942381 19:52958175-52958197 GGCGTGGGAACAGGCAGGAGGGG - Intronic
925295239 2:2772159-2772181 GGCTATGGCAGAGGCAGGGCTGG - Intergenic
925321529 2:2973834-2973856 GGGTTTGGGAGCTGAAGGAGGGG + Intergenic
925441569 2:3891499-3891521 GACTCTGGGAGTGGCATGAGAGG - Intergenic
925494738 2:4434752-4434774 AGATTTGGGAGAGGCTGGGGCGG - Intergenic
925995243 2:9287486-9287508 GGTTTCGGAAGGGGCAGGAGAGG + Intronic
926148204 2:10409749-10409771 GGCTCAGGAAGAGGCTGGAGAGG - Intronic
926308550 2:11657895-11657917 GGCTTGGCCAGAGGCAGGAGGGG + Intergenic
926484468 2:13437790-13437812 GATTTGGGGAGAGCCAGGAGTGG - Intergenic
926577854 2:14601834-14601856 GAGAGTGGGAGAGGCAGGAGAGG + Intergenic
927151356 2:20198303-20198325 GGTGTTGGGAGAGGGAGGAAGGG + Intergenic
927291656 2:21410479-21410501 GGATTTGAGAGAGGCAGGCCTGG - Intergenic
927430322 2:23021764-23021786 AGCTCTGGCAGAGGCAGGACGGG + Intergenic
927811210 2:26181252-26181274 GACTTAGGGAGAGGGAGGACAGG - Intronic
927859645 2:26552655-26552677 TGCTCTGGGGGAGGGAGGAGGGG + Intronic
928103754 2:28454234-28454256 GGCTGGGTGAGAAGCAGGAGAGG - Intergenic
928609423 2:32977162-32977184 GGCTTTGGGGGTGGGTGGAGTGG + Intronic
929269740 2:39960213-39960235 GGATTTGGAAGAGGCATGATTGG - Intergenic
930362296 2:50397023-50397045 ATCTTCGGGAGAGTCAGGAGTGG - Intronic
930518302 2:52434001-52434023 GACTTGGGAACAGGCAGGAGGGG - Intergenic
931254323 2:60556745-60556767 GGCTGGGGGAGGGGCGGGAGCGG - Intergenic
931570901 2:63668267-63668289 GGCTTGGGGAGTGGTGGGAGAGG - Intronic
931698618 2:64890736-64890758 GACTTGGGAACAGGCAGGAGGGG + Intergenic
932349686 2:71022074-71022096 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
932590555 2:73064137-73064159 GGCCTTGGGAGCAGCAGCAGAGG + Intronic
933244147 2:79956166-79956188 TGCTTTGGATGAGTCAGGAGTGG - Intronic
933686055 2:85141967-85141989 GGCTTTATGAGAGGATGGAGAGG - Intronic
933934547 2:87191477-87191499 AGGTTTGGGGGAGGCAGCAGAGG - Intergenic
933943660 2:87266184-87266206 GGCTGTGGGAGAGGAGGGTGGGG + Intergenic
934671134 2:96213631-96213653 GCTTCTGGGAGAGCCAGGAGGGG - Intergenic
934854288 2:97719279-97719301 GGCTCTGGGAGAGGTGGGTGTGG + Intronic
934892692 2:98084672-98084694 AGCCTTGGGAGAGGTAGGTGGGG - Intergenic
934934022 2:98451611-98451633 GGCTATGGGAGGGGCAGGAAAGG - Intronic
936336560 2:111595395-111595417 GGCTGTGGGAGAGGAGGGTGGGG - Intergenic
936358596 2:111774419-111774441 AGGTTTGGGGGAGGCAGCAGAGG + Intronic
936504914 2:113098478-113098500 TGCTTTGGTGGAGGCAGCAGGGG + Intergenic
936508128 2:113124403-113124425 GGCTTAGGGAGAGGAAGAAAGGG - Intronic
936701114 2:115012437-115012459 TGCTTTGGTGGAGGCAGCAGGGG - Intronic
936837613 2:116727039-116727061 GGAAATGGGAGAGGCAAGAGGGG + Intergenic
937219927 2:120336907-120336929 GGCTCTGAAGGAGGCAGGAGAGG - Intergenic
937276046 2:120685032-120685054 GGCTGGGGGAGAGGCTGCAGGGG + Intergenic
937276070 2:120685122-120685144 GGCTGGGGGAGAGGCTGCAGTGG + Intergenic
937276089 2:120685182-120685204 GGCTAGGGGAGAGGCTGCAGGGG + Intergenic
937276099 2:120685212-120685234 GGCTGGGGGAGAGGCTGCAGGGG + Intergenic
937365349 2:121257266-121257288 AGCTGTAGGGGAGGCAGGAGGGG - Intronic
937376091 2:121336713-121336735 GGCCTTGCGGGAGGCAGGAATGG + Intergenic
937519593 2:122696077-122696099 GGGGTTGGGGGAGGCGGGAGGGG - Intergenic
938133919 2:128738284-128738306 GGCTCTGAAAGAGGCAGCAGTGG - Intergenic
938305958 2:130254053-130254075 GGCCCTGTGTGAGGCAGGAGAGG + Intergenic
938379328 2:130827759-130827781 GGCTTGGGGAGAGGTGGGAGAGG + Intergenic
938796065 2:134719011-134719033 GGCTCTGGCGGGGGCAGGAGCGG + Intergenic
939045009 2:137239665-137239687 GGAGTTGGGAGAGGAAGTAGTGG - Intronic
939799687 2:146694249-146694271 GTCTTTGGGATAGGAAGGACAGG + Intergenic
940214050 2:151286530-151286552 TGCTTTGGGAGAGACAGAGGAGG - Intronic
940239785 2:151550465-151550487 GTGTTTGGAAGGGGCAGGAGAGG - Intronic
940871949 2:158867856-158867878 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
940874169 2:158883871-158883893 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
940904143 2:159153649-159153671 GGTCTTTGAAGAGGCAGGAGTGG + Intronic
941005666 2:160244590-160244612 AGAATTAGGAGAGGCAGGAGAGG - Intronic
941220696 2:162776587-162776609 TGCATTGGGAGAGGGAAGAGAGG + Intronic
941646098 2:168042982-168043004 GTATTTGGTAGGGGCAGGAGGGG + Intronic
941846991 2:170143011-170143033 GGCTTTGTGAGAGGTGGGAGTGG + Intergenic
941930110 2:170929998-170930020 AGGTTTGGGAGGGTCAGGAGTGG - Intronic
942875358 2:180789395-180789417 GGATTTGGGTGAGTCAGGAGTGG - Intergenic
943309405 2:186308047-186308069 GGTTATGGGAGAGGGAGAAGAGG + Intergenic
943674894 2:190707071-190707093 GGCTGTAGTAGAGGGAGGAGAGG + Intergenic
943731309 2:191306145-191306167 GGCTGTGGGGGAGTCACGAGTGG + Intronic
944609009 2:201380979-201381001 GATTTAGGGAGAGGCTGGAGGGG + Exonic
944770195 2:202906375-202906397 GGCTTGGGGTGGGGGAGGAGGGG - Intronic
944772716 2:202930839-202930861 GGCTAAGGGAGAGGAAGAAGAGG - Intronic
944835934 2:203579875-203579897 GGTTATGGGAGAGGGAGAAGAGG + Intergenic
945934313 2:215887409-215887431 GGGTTTGGGAGAGTCAGGTAAGG + Intergenic
946164330 2:217854744-217854766 GCCATGGGAAGAGGCAGGAGAGG + Intronic
946200224 2:218067303-218067325 GGCTCCAGGAGAGCCAGGAGAGG + Intronic
946801768 2:223425001-223425023 GGATTTGGGAGGGGTGGGAGGGG - Intergenic
946858028 2:223972650-223972672 GGCTTTGGGAGGCCCAAGAGTGG - Intergenic
946947965 2:224842218-224842240 GTCTATGGAAGAAGCAGGAGTGG - Intronic
947594756 2:231404008-231404030 GGCTCGGGAACAGGCAGGAGGGG - Intergenic
947636306 2:231682338-231682360 GGATTAGGAAGAGGCAGGGGTGG - Intergenic
947750612 2:232530159-232530181 GGCTTGGGGAGGGGGAGCAGGGG - Intronic
948088121 2:235267508-235267530 GGCCTTGGCTGTGGCAGGAGAGG - Intergenic
948176603 2:235948428-235948450 GACTTTGGGAGATGGAGGTGGGG - Intronic
948259172 2:236590286-236590308 GGGAGTGGGTGAGGCAGGAGAGG - Intergenic
948465211 2:238148824-238148846 GGCTGGGTGAGAGGCAGGTGTGG + Intronic
948591442 2:239053309-239053331 GGCTTTGGCACTGGAAGGAGGGG + Intronic
948754087 2:240149222-240149244 TGTCTTGGGAGAGGCAGGAAGGG - Intergenic
948878731 2:240844571-240844593 GGTTTTGGGAGGGGGAGAAGAGG + Intergenic
949026299 2:241767973-241767995 GGCCTTGGCAGCAGCAGGAGTGG - Exonic
1169208601 20:3753639-3753661 GGACTAGGGAGGGGCAGGAGAGG + Exonic
1169210875 20:3765725-3765747 TGCTTTGGGAGTGGGAGAAGGGG - Intronic
1169321287 20:4635201-4635223 GGGTTTGGAGAAGGCAGGAGTGG - Intergenic
1169347202 20:4838231-4838253 GGCTTTGAGAGAGGCTGATGGGG + Intergenic
1169428263 20:5512798-5512820 AGTATTGGGAGAGGCAGCAGGGG + Intergenic
1170357367 20:15507318-15507340 GGAATTGGGAGAAGCAGGAAGGG - Intronic
1170744773 20:19089780-19089802 GGCTTTGAGAATGGAAGGAGAGG + Intergenic
1170866291 20:20160929-20160951 GGCTTTCGGAGATCCAGGTGGGG + Intronic
1170871729 20:20212483-20212505 GGCTCTTGGTGAGGCAGGGGTGG - Intronic
1171020423 20:21579749-21579771 GTGATTGGGAGAGGCAGGAGTGG + Intergenic
1171408314 20:24928745-24928767 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1172049009 20:32102009-32102031 TGCTTTGGGAGACCGAGGAGCGG + Intergenic
1172599043 20:36171025-36171047 GGCCATCGGAGAGGGAGGAGTGG + Intronic
1172913894 20:38429685-38429707 GGGTTTGGAAGAGACAGGAGTGG + Intergenic
1172919800 20:38472035-38472057 GGTATTGAGAGAGGGAGGAGGGG - Intergenic
1173209536 20:41021437-41021459 GGCTTGTGGAGAGGGAGGATGGG + Intergenic
1173704649 20:45100943-45100965 GGCTTTGGGACAGACACGCGAGG - Exonic
1173736114 20:45362918-45362940 GGCTAGGGGAGAGGCAAGTGGGG - Intronic
1174288834 20:49492342-49492364 GGCTTGGGGAGGGGGAGGTGGGG + Intergenic
1174449650 20:50611339-50611361 GCCGTTGGCAGAGGAAGGAGTGG - Intronic
1175371562 20:58496196-58496218 AGCTGTGGGAGAGGCTGGGGAGG + Intronic
1175481034 20:59311126-59311148 GGATTAGGGTGAGGCAGGTGAGG - Intronic
1175525633 20:59631518-59631540 GGCCTTGACAGAGGCAGGAGGGG + Intronic
1175578167 20:60078369-60078391 GGCCATGGGAGAGGCAGCAAAGG - Intergenic
1175825890 20:61936399-61936421 GGGTGTGGGAGAGGGGGGAGGGG - Intronic
1175915541 20:62424153-62424175 GGGTCTGGGAGTGGGAGGAGTGG - Intronic
1175954125 20:62599627-62599649 GGCTGTGGGGGATGGAGGAGGGG - Intergenic
1176030758 20:63010048-63010070 GTCTCTGGGAGAGGCAGGGTGGG - Intergenic
1176060489 20:63170369-63170391 GGCTTTGGCTGAGGGAGGGGAGG - Intergenic
1176100676 20:63363077-63363099 GGCTTGGGAAGAGCAAGGAGAGG - Intronic
1176222397 20:63975830-63975852 GGCCTGGGGAGAGGAAAGAGGGG + Exonic
1176291916 21:5050341-5050363 GGCCATGGGAGAGCAAGGAGTGG - Intergenic
1176388360 21:6150977-6150999 GGCTTTGGGGCAGGCAGGCCTGG + Intergenic
1177074109 21:16550341-16550363 GGCGAGGGCAGAGGCAGGAGAGG + Intergenic
1177166619 21:17612075-17612097 GGTTTTGAGAGAGGTAGGTGAGG + Intronic
1178108768 21:29349982-29350004 GGCCTTTGGAGAGGCTGGTGGGG - Intronic
1178392644 21:32211917-32211939 GGCCTGGGGAGAGGCCTGAGAGG - Intergenic
1178824510 21:36004738-36004760 GGCAGTGGGGGAGGCAGCAGTGG + Intergenic
1179735112 21:43387271-43387293 GGCTTTGGGGCAGGCAGGCCTGG - Intergenic
1179865341 21:44213300-44213322 GGCCATGGGAGAGCAAGGAGTGG + Intergenic
1179900573 21:44391412-44391434 TGCTGTGGAACAGGCAGGAGGGG - Exonic
1179988206 21:44932610-44932632 GGCTGCGGGAGCGGGAGGAGCGG + Intergenic
1180252382 21:46597881-46597903 GGGCCTGGGAGAGGCCGGAGGGG - Intergenic
1180635061 22:17257466-17257488 GCCTCTGGGGGAGGCGGGAGAGG + Intergenic
1180920562 22:19519574-19519596 GGCTCTGGGAGATGCAGGGCTGG - Intronic
1181171538 22:21012808-21012830 GGCTCTGGGAGAGGTGGGGGTGG - Intronic
1181235207 22:21444347-21444369 GCCTTGGGGAGAGGCAGGGCTGG + Intronic
1181315843 22:21970517-21970539 GGGTCTGGCAGGGGCAGGAGAGG - Intronic
1181737263 22:24891926-24891948 GGTTTAGGGAGGGGCAGGAAGGG + Intronic
1182422095 22:30253706-30253728 GGCTGGGGGAGGGGAAGGAGAGG - Intergenic
1182575677 22:31271327-31271349 GGCATTGGAAGAAGCAGGAAGGG - Intronic
1182609547 22:31535617-31535639 GGCTGAGGCAGAGGCAGGAGAGG - Intronic
1182711606 22:32326744-32326766 GGTTTTGGGAGAGGGAGATGAGG + Intergenic
1183367600 22:37415417-37415439 GGCCCTGGGGCAGGCAGGAGAGG + Intronic
1183452585 22:37905305-37905327 ATCTGTGGGAGAGTCAGGAGGGG + Intergenic
1183476870 22:38040400-38040422 GGTGGTGGGAGAGGCAGCAGGGG + Intronic
1183485466 22:38085792-38085814 GGCATGGGGAGAGGGAGGGGAGG - Intronic
1183644372 22:39115093-39115115 GGCTATGGGAAAGGGAGAAGAGG + Intergenic
1183716803 22:39537944-39537966 GGCTTTGGGAGAGGAGGGCGTGG + Intergenic
1183808721 22:40236258-40236280 GGGGTAGGGTGAGGCAGGAGTGG - Intronic
1184137930 22:42560387-42560409 GGATGAGGGTGAGGCAGGAGGGG - Intronic
1184247734 22:43244259-43244281 AGCTTTCGGGGAGGCAGGTGGGG - Intronic
1184412021 22:44331295-44331317 CGCTTTGGGAGAGGCGGGTAAGG - Intergenic
1184421431 22:44384851-44384873 GCCTCAGGTAGAGGCAGGAGGGG + Intergenic
1184428567 22:44427766-44427788 GGCTTTGCCAGCGGCAGAAGGGG - Intergenic
1185130818 22:49037593-49037615 GGATTGGGGAGCGGGAGGAGGGG + Intergenic
1185148746 22:49152675-49152697 GCCTGTGGGGGAGGGAGGAGGGG - Intergenic
1185222700 22:49636915-49636937 GGCCTCAGGTGAGGCAGGAGTGG - Intronic
1185344851 22:50306735-50306757 GGCTGTGGCAGAGTCAGGACAGG - Intronic
1185384944 22:50527282-50527304 GGCTTTGGGGGAGGCAGAGGAGG + Exonic
949157863 3:849609-849631 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
949882807 3:8675037-8675059 GGCTTGGGAACAAGCAGGAGGGG - Intronic
950233416 3:11296517-11296539 GGCTTTGAAAGAGGCAGGCAGGG - Intronic
950252409 3:11477150-11477172 GGCTCTGGATGAAGCAGGAGAGG + Intronic
950386522 3:12664381-12664403 GGCTTTCGGCCAGCCAGGAGTGG + Intergenic
950511368 3:13430096-13430118 TGCTTTGGGACAGACAGGAGTGG - Intergenic
950564756 3:13761957-13761979 GTGTTTGGAAGAGGAAGGAGAGG - Intergenic
951126915 3:18995540-18995562 GGCTGTGGGAAAGGCATGATTGG - Intergenic
951723246 3:25724790-25724812 GGCTTTTGGAGAGGAGGAAGAGG - Intronic
951773934 3:26287702-26287724 GGTTATGGGAGAGGGAGAAGAGG + Intergenic
952005587 3:28838810-28838832 GGCTGGGTGAGAGGCAAGAGAGG + Intergenic
952196363 3:31079631-31079653 GGCTTCTGGATAGGAAGGAGTGG - Intergenic
952397923 3:32937580-32937602 GGCTGGGGGAGAGGGATGAGGGG + Intergenic
952752605 3:36837406-36837428 GGCATTGAGAGGGGTAGGAGTGG - Intronic
952755092 3:36858860-36858882 GTCTTCAGGAGAGCCAGGAGAGG - Exonic
952846419 3:37691349-37691371 GGAGTTGGGTGAGGCAGGTGTGG + Intronic
953266618 3:41395611-41395633 GGCACTGGGAGAAGGAGGAGTGG + Intronic
953275199 3:41489018-41489040 GGGTTTGGAGGAGGCAGAAGGGG - Intronic
953351482 3:42219609-42219631 GGCTTTGGGGTGGGCAGGGGTGG + Intronic
953430910 3:42839733-42839755 TGAGATGGGAGAGGCAGGAGAGG + Intronic
953501777 3:43443443-43443465 TGCTTTGGGAGAGACAGTATGGG + Intronic
954199360 3:49014985-49015007 GGCTGTGGGAGAGGCTGGGCTGG + Exonic
954213638 3:49112142-49112164 GGCTCTGGGGGAGGCAGGGCTGG - Intronic
954300799 3:49699779-49699801 GGCATTGGGAGGGGCATGGGAGG + Intronic
954715258 3:52523733-52523755 GGCTGTGGGGGTGCCAGGAGGGG - Exonic
956478370 3:69647735-69647757 GACAATGGGAGGGGCAGGAGTGG - Intergenic
956647283 3:71468669-71468691 GGATTTGGGAAAGGCTGTAGAGG - Intronic
956725693 3:72154900-72154922 GGCATGGAGAGAAGCAGGAGAGG - Intergenic
956740436 3:72271453-72271475 GGCGTTGGGTCAGGCAGAAGCGG - Intergenic
957022270 3:75139443-75139465 GGCTTGGGAACAGGTAGGAGGGG - Intergenic
957044644 3:75364235-75364257 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
957076430 3:75606422-75606444 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
957083106 3:75655568-75655590 GGCTGGGGGAGGGGGAGGAGGGG + Intergenic
957340279 3:78886845-78886867 GACTTTGGGAGAGACACGAATGG + Intronic
957406053 3:79776133-79776155 GGCTTAGGGACAGGCAGGAGGGG - Intergenic
960439033 3:117664192-117664214 GGCTCTGGGAAAGGCAGAACTGG - Intergenic
960937628 3:122913158-122913180 GGCTGGGAGAGAGGAAGGAGGGG + Intronic
960950126 3:122993780-122993802 AGCTGTGGGGGAGGCAGGAGCGG - Intronic
961272010 3:125696526-125696548 GGCTTGGGAACAAGCAGGAGGGG - Intergenic
961277783 3:125741390-125741412 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
961342497 3:126237858-126237880 AGATTTGGGAGAGGCCGGAGTGG - Intergenic
961363125 3:126380502-126380524 GGCTTTGGGAGAAACATGGGGGG - Intergenic
961416650 3:126763802-126763824 GGCTATGGGAGAGGAAGTTGAGG + Intronic
961799014 3:129430127-129430149 GCCTTGGGGAGAGGGAGGTGTGG + Intergenic
961876635 3:130028272-130028294 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
961893067 3:130146424-130146446 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
962182032 3:133216590-133216612 GGCTTGGGGAGAGGGAGTTGGGG - Intronic
962500041 3:135981985-135982007 GGAGTTTGGAGAGGCAAGAGTGG + Intronic
963162528 3:142166136-142166158 TGCTTTGGGAGACTGAGGAGGGG + Intronic
964522634 3:157584727-157584749 GGCTTATGGACAGGCAGGAGGGG + Intronic
964920411 3:161889436-161889458 GGCATTGGACGAGGTAGGAGAGG - Intergenic
965274623 3:166665055-166665077 GGCTTGGGTAGGGGCAGCAGAGG + Intergenic
966917885 3:184594753-184594775 GGGGATGGGAGGGGCAGGAGAGG + Intronic
968826944 4:2905612-2905634 GGCTTTGGGATAGAAAGCAGGGG - Intronic
968859480 4:3155013-3155035 GGCAGTGGCAGGGGCAGGAGAGG + Intronic
968916352 4:3498610-3498632 GGTGGTGGGAGAGGCAGGTGGGG - Intronic
968981680 4:3853556-3853578 GGCTCAGGGACAGGCAGAAGTGG + Intergenic
968988901 4:3895476-3895498 GGCTTGGGAACAGGCACGAGGGG + Intergenic
969019885 4:4132717-4132739 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
969025500 4:4169067-4169089 GGCTTGGTAACAGGCAGGAGGGG + Intergenic
969057380 4:4410185-4410207 TGCGGTGGGACAGGCAGGAGAGG - Intronic
969115377 4:4867617-4867639 CGCTGTGGGGGAGGCAGGCGGGG - Intergenic
969437315 4:7195464-7195486 GTGTGTGAGAGAGGCAGGAGTGG - Intronic
969625572 4:8303420-8303442 GGCTGGGGGAGAGGAAGCAGGGG + Intronic
969692367 4:8710675-8710697 GGCAAGGGGTGAGGCAGGAGGGG - Intergenic
969729227 4:8944044-8944066 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
969733968 4:8974696-8974718 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
969749691 4:9100717-9100739 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
969788813 4:9477985-9478007 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
969793556 4:9508753-9508775 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
969826450 4:9762117-9762139 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
970362395 4:15322895-15322917 AGCTATGGGAAAGGCAGTAGAGG - Intergenic
970408101 4:15782869-15782891 GACTGTGTGACAGGCAGGAGAGG - Intronic
970444845 4:16115023-16115045 TGGTCTGCGAGAGGCAGGAGTGG + Intergenic
970861309 4:20705876-20705898 GGATTTGGGAGAGGCAGTGGAGG + Intronic
971224458 4:24738099-24738121 AGATTTGGGAGAGGCTGGGGTGG + Intergenic
971231008 4:24800168-24800190 GGCTCTGGGAGCGCCAGGCGCGG + Exonic
971481605 4:27119675-27119697 CCCTCTGGGAGAGGCTGGAGGGG - Intergenic
971564921 4:28126031-28126053 GGTTTTGGGGGAGGCAGGTAAGG + Intergenic
972077259 4:35103763-35103785 GGCTTGGGGACAGGTAGGAGGGG - Intergenic
973575374 4:52282720-52282742 GGAAGTGGGAGAGACAGGAGAGG - Intergenic
975485745 4:74933041-74933063 GGGTTTGGCAGCGGCAGGCGCGG + Intergenic
975633139 4:76421459-76421481 GGCTGTGGGAGAAGCGGCAGAGG - Intronic
976172856 4:82322666-82322688 GGCCTGGGGAGGAGCAGGAGAGG - Intergenic
976364328 4:84215985-84216007 GGCTTTGGAGTGGGCAGGAGAGG - Intergenic
976489399 4:85651140-85651162 GGACGGGGGAGAGGCAGGAGAGG + Intronic
976826701 4:89268520-89268542 GGATTTGGGAGGGGTAGCAGAGG - Intronic
976970239 4:91094514-91094536 GGCTTGGGGACAGGTAGGAGGGG + Intronic
977234875 4:94495936-94495958 GTCCTTGGGAGAGGGAAGAGAGG + Intronic
977357728 4:95968374-95968396 GTCTTTGGGAGAGGTGGGAAAGG - Intergenic
977535242 4:98249769-98249791 AACTTTTGGAGAGGCAGGAGTGG - Intergenic
977935467 4:102797945-102797967 GACTTAGGTAGAGGCAGAAGGGG + Intronic
978370731 4:108027389-108027411 GGCTTTGGGAGAGACAGATTTGG - Intronic
978852515 4:113355550-113355572 GTCTTTGGGAGAGCCTAGAGTGG - Exonic
978916142 4:114127820-114127842 TGCTTTGGTGGAGGCAGCAGGGG - Intergenic
979455741 4:120923513-120923535 GGATTTGTGGGAGACAGGAGGGG + Intergenic
979893712 4:126132349-126132371 AGGTTTGGGAGATACAGGAGTGG + Intergenic
980779922 4:137481544-137481566 GGCTTAGGGACAGGCAGGAGGGG - Intergenic
981051038 4:140309800-140309822 GGGTTTGGGGGAGACAGGAATGG - Intronic
981604759 4:146529152-146529174 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
982087261 4:151848378-151848400 GGCTTTGTTAGAGGCAGAAAGGG + Intergenic
982629187 4:157810076-157810098 GGCTTTGGGATAAGAAGTAGTGG - Intergenic
982834585 4:160108629-160108651 AGATTTGGGAGAGGCTGGGGTGG - Intergenic
983077461 4:163343776-163343798 GGCTTTGGAAGAGGCTGGCGCGG + Intronic
983928945 4:173432445-173432467 GGAGTGGGGAGAGACAGGAGAGG - Intergenic
984656099 4:182320511-182320533 GTCTTTATGAGAGACAGGAGAGG - Intronic
984705985 4:182847584-182847606 GGCTCTGGGGCAGGGAGGAGAGG - Intergenic
984849426 4:184141240-184141262 GCCTGTGGGAGATACAGGAGAGG - Intronic
985448436 4:190041337-190041359 GGCTCGGGGAGGGGGAGGAGCGG - Intergenic
985500926 5:244604-244626 AGGTTTGGTAGATGCAGGAGCGG + Intronic
985525483 5:399234-399256 GGCTTAGGGATCGGCAGGGGTGG + Intronic
985620673 5:953166-953188 GGGGTGGGAAGAGGCAGGAGGGG + Intergenic
985735936 5:1582926-1582948 AGGTTTGGTAGATGCAGGAGCGG - Intergenic
986817374 5:11427730-11427752 AAGTCTGGGAGAGGCAGGAGAGG - Intronic
986875927 5:12109236-12109258 AACTTTAGGAGAGGGAGGAGAGG + Intergenic
986906588 5:12501787-12501809 GGCTTTGTGAGAGAGAGGACTGG + Intergenic
986952017 5:13100336-13100358 GGCCTTGGAAGAGACAGTAGAGG + Intergenic
988886513 5:35563929-35563951 AGATTTGGGAGAGGCCGGGGTGG + Intergenic
988921494 5:35946602-35946624 GGCTTGAGAAGAGGTAGGAGAGG + Intergenic
989141895 5:38209672-38209694 GGCTGTGGGAGAGGGGAGAGGGG + Intergenic
989322543 5:40153406-40153428 GGGTATGGGAGAGGAAGGAATGG + Intergenic
990944375 5:61234175-61234197 GGCTTTGGGAGAGGTGTGAGAGG + Intergenic
991426325 5:66495858-66495880 TGCCTTGGGAAAGGCAGGTGTGG - Intergenic
991621025 5:68545520-68545542 GGGTTTGGAAGAGGAGGGAGTGG + Intergenic
991718473 5:69473828-69473850 GGTTATGGGAGAGGGAGAAGAGG + Intergenic
991967474 5:72107369-72107391 GGCGCTGGGAGAGGGCGGAGGGG + Exonic
992453204 5:76891815-76891837 GGGCCTGGGAGAGGGAGGAGGGG + Intronic
992533328 5:77672794-77672816 GGCTTTAGGAGATGCAGGGATGG - Intergenic
992556003 5:77904247-77904269 GGCTTTAGGGAAGGAAGGAGGGG - Intergenic
993429146 5:87810339-87810361 GGCTTTGGGAGAGGTTGGCAGGG + Intergenic
993777101 5:92012928-92012950 AGATTTGGGAGGGGCTGGAGTGG + Intergenic
994515264 5:100763811-100763833 AGCTTAGGGAGAGGCAGTAATGG - Intergenic
995035163 5:107525779-107525801 GGCTGAAGGGGAGGCAGGAGAGG + Intronic
995057802 5:107780294-107780316 GGCTTGGGGAGAGGGAGAAATGG - Intergenic
995473611 5:112527141-112527163 GGCTTAGGGACAGGCAGGAGGGG - Intergenic
995868941 5:116724298-116724320 GGCCTGGGGAGAGGCAGAAAAGG + Intergenic
996746825 5:126853212-126853234 GAGTGTGGGAGAGGGAGGAGAGG + Intergenic
997266731 5:132499186-132499208 GGCTATGGGAAAGGGAGCAGAGG - Intergenic
997350486 5:133227452-133227474 GCCTTGGGTAGAGGGAGGAGTGG + Intronic
997390644 5:133512122-133512144 GGCTTTGGAGGAGGGAGGAATGG - Intronic
997419026 5:133751158-133751180 GCCTTTGGGACAGGCATGACTGG - Intergenic
997579914 5:135010737-135010759 GGGTTGGGGAGGGGCAGGAGGGG - Intronic
997613076 5:135228769-135228791 GGCTTGGGGCCAGGCAGGGGTGG + Intronic
998316160 5:141184564-141184586 GCCTCTGGGAGCGGCAGGAAGGG - Exonic
998375546 5:141688228-141688250 GGCTTTGGGAGTGACCAGAGGGG + Intergenic
999120002 5:149201811-149201833 GGCCATGTGTGAGGCAGGAGAGG + Intronic
999303926 5:150507881-150507903 GGGCTTGGGTGAGGCAGGCGAGG + Intronic
999327341 5:150651265-150651287 GGCCCAGGGGGAGGCAGGAGAGG + Exonic
999805601 5:155078170-155078192 GGCTTTGTGAGAGGCAGTTCAGG + Intergenic
1000040316 5:157480347-157480369 GGTTTGGGGAGAGGTGGGAGGGG + Exonic
1000154346 5:158535886-158535908 TGCTTTGGAAGAGGTAGGTGTGG - Intergenic
1000254546 5:159525423-159525445 GGCTTTGGAAGTGGGAGAAGGGG - Intergenic
1000321051 5:160134739-160134761 GGCTCTGGGTGAGTCTGGAGTGG - Intergenic
1000552145 5:162680209-162680231 GGTTATGGGAGAGGGAGAAGAGG + Intergenic
1000944512 5:167404231-167404253 GTGTTTGAGAGAGGCATGAGGGG + Intronic
1001054141 5:168435521-168435543 AGCTATGGGAGAGGCTGAAGTGG - Intronic
1001254308 5:170171885-170171907 GGCTCAGGGACAGGCAGGGGAGG - Intergenic
1001294694 5:170490773-170490795 AGCTTGGGGAGAGGTTGGAGAGG - Intronic
1001545108 5:172566135-172566157 GGCACTCGGAGAGGTAGGAGGGG + Intergenic
1001568407 5:172714990-172715012 GGCCTCGGGAGAAGGAGGAGGGG - Intergenic
1002077580 5:176718064-176718086 GGGATTGGGAAGGGCAGGAGAGG - Intergenic
1002188497 5:177467118-177467140 GGGTTAGGGAGGGGCTGGAGGGG - Intronic
1002297363 5:178239092-178239114 AGGCTTGGGAGAGGCAGGGGAGG - Intronic
1002408399 5:179054168-179054190 GGCTTGGGGACAGGTAGGAGGGG + Intergenic
1002540337 5:179902512-179902534 GGCTTTGGGCCTGGCAGGAGGGG + Intronic
1002812072 6:640254-640276 TGCTTTGGGAGAGACAGAAGGGG + Intronic
1005057069 6:21739547-21739569 TGCTTTGGGAGAGTGAGCAGGGG + Intergenic
1005644969 6:27829266-27829288 AGCTTTTGGGGAGGCAGAAGTGG + Intergenic
1006256607 6:32837726-32837748 TGTTTTGGGTGAGTCAGGAGAGG - Exonic
1006297912 6:33178253-33178275 GGCTCTGGGGAAGCCAGGAGGGG - Intronic
1006416250 6:33905834-33905856 GGCTAAGGGAAAGGCAGGGGTGG - Intergenic
1006449913 6:34099798-34099820 GTCTTTGGGAGGAGCAGGATAGG + Intronic
1006891668 6:37433945-37433967 AGCTGTGTGAAAGGCAGGAGAGG - Intronic
1007089553 6:39173655-39173677 GGCTTTGCAAGAAGTAGGAGGGG - Intergenic
1007397768 6:41587278-41587300 TGCTGTGGGAGAGACAGGGGAGG - Exonic
1007417348 6:41699497-41699519 GGCTTTTGGAGAGGAAACAGAGG - Intronic
1007718331 6:43870170-43870192 GGCTGGGGGAGGGGCTGGAGAGG - Intergenic
1007727731 6:43926794-43926816 GGGTTGGGGGGAGGCATGAGAGG + Intergenic
1008124109 6:47649466-47649488 GGATTAGGGTGAGGCAGGTGGGG + Intergenic
1008463964 6:51809412-51809434 GTCATAGGAAGAGGCAGGAGAGG - Intronic
1009932534 6:70193421-70193443 GGCTGTGACAGAGGAAGGAGGGG - Intronic
1011565116 6:88665424-88665446 GGCTTGGGAACAGGTAGGAGGGG - Intronic
1011598908 6:89041890-89041912 TGCGTGGGGAGAGGCAAGAGAGG + Intergenic
1012210332 6:96510649-96510671 GGATTTGGGAGGGGCCGGGGTGG + Intergenic
1012611922 6:101228608-101228630 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1012832845 6:104227626-104227648 GGCTTAAAGAGAGGCAGGAAGGG - Intergenic
1013462346 6:110387150-110387172 TACTTTGGGAGAGACAGGATTGG + Intergenic
1013825337 6:114204235-114204257 GGCTTTGGGAGAGACAGTGGTGG + Intronic
1014275669 6:119385534-119385556 AGTTTTGGGAGAGGAGGGAGAGG + Intergenic
1014546976 6:122745990-122746012 GGCTTAGGCACAGGCAGGAGGGG + Intergenic
1014605522 6:123469388-123469410 GGGGTTGGGAAAGGGAGGAGTGG - Intronic
1015367919 6:132417902-132417924 AGATTTGGGAAAAGCAGGAGAGG + Intergenic
1017038216 6:150286145-150286167 TGCTTTGGGAGAGAAAGAAGAGG + Intergenic
1017225687 6:152018608-152018630 GGTTTTGGGGGTGGGAGGAGCGG + Intronic
1017548765 6:155481506-155481528 GACTTTTGGAGATGCAGGGGTGG + Intergenic
1017642979 6:156512456-156512478 GGCTTGGGGAGAAGCTGGAGTGG - Intergenic
1018358673 6:163043912-163043934 GGTTTTGGAAGAGTCAGAAGTGG + Intronic
1018392557 6:163351515-163351537 GGCTTAGGGGGTGGAAGGAGAGG + Intergenic
1018536839 6:164829209-164829231 GGCCTTGGGAGACCCAGGACAGG - Intergenic
1018689375 6:166332671-166332693 GGTTTTGGGAGAGGAAGAGGTGG - Intronic
1018836287 6:167486724-167486746 GGCTGGAGGAGAGGCAGGAGAGG - Intergenic
1018873902 6:167803636-167803658 GGCTTTGGCAGAGCCAGCAGAGG + Intergenic
1018915632 6:168130835-168130857 AGCTGGGGGAGAGGCAGGCGGGG + Intergenic
1019294142 7:265091-265113 GTCTTTGCCAGGGGCAGGAGGGG + Intergenic
1019321381 7:416982-417004 GGGGTGGGAAGAGGCAGGAGTGG + Intergenic
1019339139 7:500247-500269 GGCGTTCTGCGAGGCAGGAGCGG + Intronic
1019537041 7:1534574-1534596 GGATGCGGGAGAGGGAGGAGGGG - Intronic
1019571635 7:1715543-1715565 GGCTTTCTGGGAGGCAGAAGTGG - Intronic
1019723802 7:2589470-2589492 AGATCCGGGAGAGGCAGGAGTGG + Intronic
1019776225 7:2913463-2913485 AGCTCTGGCAGGGGCAGGAGAGG + Exonic
1019915757 7:4131247-4131269 CGCTGTGGGAGAGGAAGCAGCGG - Intronic
1020307289 7:6844754-6844776 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1020311760 7:6873590-6873612 GGCTTGGGAACAGGCAGGAAGGG + Intergenic
1020323299 7:6955924-6955946 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1020365627 7:7377975-7377997 TACTCTGAGAGAGGCAGGAGTGG + Intronic
1020408207 7:7861092-7861114 GGCTTGGGGAGAGGAGGGATGGG + Intronic
1020812661 7:12864899-12864921 GGCTGTGGGAGTGGCAGTAGTGG - Intergenic
1021428340 7:20529518-20529540 GGCCTGGGCAGAGGCAGCAGTGG + Intergenic
1021994658 7:26168086-26168108 GACTTGGGGGGAGGCAGGAAGGG - Intronic
1022474391 7:30700363-30700385 GGAATTGAGACAGGCAGGAGGGG + Intronic
1022588056 7:31634645-31634667 AGCTATGGGATAGGCAGGATGGG + Intronic
1022831666 7:34073829-34073851 GACTTTGGCTGAGGCAGCAGGGG + Intronic
1023366111 7:39464962-39464984 GGCTTTGGGGGAGACAGGTGGGG - Intronic
1023841577 7:44101359-44101381 GGCCTGGGGACAGGCAGGAGTGG - Intergenic
1026863973 7:73811200-73811222 GGCTCTGGGAGAGGCTGAAGAGG - Intronic
1026913964 7:74108757-74108779 GGGTGTGGCAGAGGCAGGAGAGG + Intronic
1027464010 7:78491996-78492018 GGATTTGGAAGAAGCAGGTGAGG - Intronic
1027472442 7:78590103-78590125 TTCTTAGGGAGAGGCAGAAGAGG + Intronic
1027702796 7:81488701-81488723 GGCTGTGAGAGAAGCAGGACTGG - Intergenic
1028268433 7:88758388-88758410 GGCATTGTGGGAGACAGGAGAGG + Intergenic
1028493777 7:91441900-91441922 AGATTTGGGAGGGGCAGGGGTGG + Intergenic
1028739755 7:94260227-94260249 GACTTTGGGAAAGGGAGAAGAGG - Intergenic
1029004883 7:97198870-97198892 TGCATTGGGAGAAGGAGGAGGGG - Intergenic
1029078423 7:97953691-97953713 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1029599576 7:101555911-101555933 AGCATTGGGAGAGGAAGGAGGGG - Intronic
1029895226 7:103976610-103976632 TGCTTTAGGAGAGTCAGGGGAGG + Intronic
1030841589 7:114359965-114359987 AGATTTGGGAGGGGCTGGAGTGG + Intronic
1031715839 7:125108237-125108259 AGATTTGGGAGAGGCAGAGGTGG - Intergenic
1031922257 7:127611053-127611075 GGCTTGGAATGAGGCAGGAGTGG - Exonic
1032439717 7:131933168-131933190 GGCTGTGACAGAGGCATGAGAGG - Intergenic
1032454159 7:132059118-132059140 AGATTTGGGAGGGGCTGGAGTGG + Intergenic
1032690231 7:134278454-134278476 TGATTTGGGAGAGGAAGGAAAGG - Intergenic
1033053929 7:138032095-138032117 TTCTTTGGGAGAGGCAGTGGAGG + Intronic
1033056342 7:138058424-138058446 GGCTTTGGGAGAGACGGCAGGGG - Intronic
1033225100 7:139555037-139555059 AGATTTGGGAGGGCCAGGAGTGG + Intergenic
1034422157 7:150995866-150995888 GGATGGGGGAGAGGGAGGAGGGG - Intronic
1034676318 7:152895031-152895053 GGCTCTGGGAGAGGGAGGCTTGG - Intergenic
1034730805 7:153386040-153386062 GGCTGTGGGAGAGAGAAGAGGGG + Intergenic
1034941948 7:155236490-155236512 GACTCTGGGAAAGGCTGGAGAGG - Intergenic
1035252212 7:157604943-157604965 GGAGTTGGGAGGTGCAGGAGGGG - Intronic
1035271689 7:157723534-157723556 GGCTGTGGTAGAGAAAGGAGAGG - Intronic
1035553454 8:545898-545920 GGCTTTGTCAGAATCAGGAGCGG + Intergenic
1035697875 8:1614049-1614071 GCCTTTGGAAGAGCCAGGTGGGG + Intronic
1036262297 8:7250336-7250358 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1036277427 8:7367702-7367724 GGCTTTAGAACAGGAAGGAGAGG - Intronic
1036304291 8:7589222-7589244 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1036314336 8:7708875-7708897 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1036343906 8:7942633-7942655 GGCTTTAGAACAGGAAGGAGAGG + Intronic
1036355143 8:8037214-8037236 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1036372771 8:8175059-8175081 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1036528300 8:9556067-9556089 GGCCGTGGGAGAGGCTGGGGTGG - Exonic
1036652536 8:10654521-10654543 GGCTCTTGGAGAGGAGGGAGAGG - Intronic
1036816856 8:11908803-11908825 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1036833582 8:12040335-12040357 GGTTTGGGAACAGGCAGGAGGGG + Intergenic
1036839247 8:12103400-12103422 GGCTTTAGAACAGGAAGGAGAGG + Intergenic
1036855429 8:12286900-12286922 GGTTTGGGAACAGGCAGGAGGGG + Intergenic
1036861037 8:12349643-12349665 GGCTTTAGAACAGGAAGGAGAGG + Intergenic
1036878135 8:12490582-12490604 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1036903747 8:12690738-12690760 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1036906226 8:12710385-12710407 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1037564724 8:20108190-20108212 GGCAGTGGCAAAGGCAGGAGCGG - Intergenic
1037980477 8:23249895-23249917 GGCTGTGGGAAAGGCAGGCCGGG - Intronic
1038479437 8:27891766-27891788 GGATTAGGGAGAGGGAAGAGTGG - Intronic
1038523793 8:28256364-28256386 GGGTTTGGGAGAAAGAGGAGAGG + Intergenic
1038798882 8:30731863-30731885 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1039213085 8:35237216-35237238 GGCTTTGTAAGAAGCAGGGGAGG + Intronic
1039382942 8:37102855-37102877 GGGTTGGGGAGAGGGAGGATGGG - Intergenic
1039513959 8:38115771-38115793 AACTTGGGTAGAGGCAGGAGAGG - Intronic
1039984508 8:42436381-42436403 GGCCTTGGCAAAGGCAAGAGTGG - Intronic
1040906997 8:52479514-52479536 GGCGTTTGGATAGGAAGGAGAGG - Intergenic
1041310376 8:56510351-56510373 TGCCCTGGGAGAGTCAGGAGTGG - Intergenic
1041420988 8:57666879-57666901 GTTTTTGGGAGAGGCACTAGTGG - Intergenic
1043697421 8:83237800-83237822 GGAATGGGGAGTGGCAGGAGGGG - Intergenic
1043751611 8:83943315-83943337 GGTTCTGGGAGTGGCAGCAGTGG + Intergenic
1043754626 8:83987309-83987331 GGCTTTGGGGGAGGTAGGGATGG + Intergenic
1044301080 8:90583773-90583795 GAATTTGGGCGAGGCAGGGGTGG + Intergenic
1045356185 8:101391077-101391099 GGTTTTGGGGCAGGCAGGATTGG + Intergenic
1045511476 8:102815315-102815337 CACTTTGGGAGAGCGAGGAGGGG - Intergenic
1045522498 8:102915411-102915433 GGTTTTGGCAGACGCTGGAGTGG - Intronic
1046528183 8:115408821-115408843 AACTTTGGGGGAGGCATGAGGGG - Exonic
1046665212 8:116994765-116994787 GCTTTTGGGAAAGACAGGAGAGG - Intronic
1046822060 8:118644488-118644510 AGCTTCTGGAGAGGCTGGAGAGG - Intergenic
1046987922 8:120411042-120411064 GGGAGTGGGAGAGGGAGGAGAGG - Intronic
1047393706 8:124474975-124474997 GGCCGTGAGAGAGACAGGAGAGG + Exonic
1047857782 8:128931197-128931219 TTCTTTGGGAGATGGAGGAGGGG + Intergenic
1048319435 8:133386900-133386922 TGCTTTGGAAGAGGGAGGGGTGG - Intergenic
1048732980 8:137464293-137464315 GGCTTTGGGGATGGCAAGAGAGG + Intergenic
1048957588 8:139549553-139549575 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1049048783 8:140174569-140174591 GGCTTGGGGGAAAGCAGGAGGGG - Intronic
1049583436 8:143422742-143422764 GGCTGTGGGGGTTGCAGGAGGGG - Intronic
1049684838 8:143935143-143935165 GGCTCTGGGGCAGGCAGCAGGGG + Intronic
1049696416 8:143986276-143986298 GGCCTGGGGAGGGGCAGGAGGGG - Intronic
1049759159 8:144324139-144324161 GGCTGTGAGGCAGGCAGGAGAGG - Intronic
1051166406 9:14266718-14266740 GGGTAAGGGAGAGGGAGGAGGGG - Intronic
1051279004 9:15422850-15422872 GGCTTTTGCAGGGGAAGGAGTGG + Exonic
1051643126 9:19242078-19242100 GGCTTGGGGAAAGGCAGAAAGGG - Intronic
1052593687 9:30531425-30531447 GGCATAGGATGAGGCAGGAGGGG + Intergenic
1052846876 9:33344619-33344641 CACTTTGGGAGAGCAAGGAGGGG + Intronic
1053017006 9:34667612-34667634 TGCTCTGGGAAAGGAAGGAGAGG + Intergenic
1053428116 9:38024407-38024429 GGCCGTGGGAGGGGCAGGACTGG - Intronic
1053541395 9:38977505-38977527 TGCTTTGGGAGAGAAAGGAGAGG + Intergenic
1053805816 9:41800548-41800570 TGCTTTGGGAGAGAAAGGAGAGG + Intergenic
1054076994 9:60546160-60546182 GGCTCTGGCAGAGGCTGGCGGGG - Intergenic
1054624743 9:67386403-67386425 TGCTTTGGGAGAGAAAGGAGAGG - Intergenic
1054714821 9:68546847-68546869 GGCTTTGTGGGAGGCAGGGAAGG + Intergenic
1054782933 9:69182555-69182577 GGATCTGGAAGAGGCAGGAAAGG + Intronic
1055507012 9:76958356-76958378 GGCTTTGTGTCAGGCAGGACTGG + Intergenic
1055955172 9:81766446-81766468 GAGTCTGTGAGAGGCAGGAGGGG + Intergenic
1056227740 9:84512747-84512769 GGCAATGGCAGAGGCAGAAGAGG + Intergenic
1056865589 9:90225315-90225337 GGCTTGGAAACAGGCAGGAGGGG - Intergenic
1056892924 9:90513126-90513148 GGCTTTTGGAGAGTCACAAGAGG - Intergenic
1056917419 9:90757571-90757593 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1057070731 9:92097654-92097676 GGCCTGGGCAGAGGAAGGAGTGG + Intronic
1057637377 9:96782412-96782434 GGTGCTAGGAGAGGCAGGAGTGG - Intergenic
1057698429 9:97344411-97344433 GCCTCTGGTAGAGGAAGGAGAGG - Intronic
1057803209 9:98202467-98202489 GGTTCTGGGTGAGGGAGGAGGGG - Intronic
1057827015 9:98379078-98379100 GGCTTTGGGGCAGGCAGCAAGGG - Intronic
1057959125 9:99438050-99438072 TGGTTTGGGCGAGGGAGGAGGGG - Intergenic
1059390940 9:113999219-113999241 GGCTGTGCGAGGGGCAGGCGGGG + Intronic
1059427497 9:114230354-114230376 GGCTTTGGAAAGGACAGGAGGGG + Intronic
1059535308 9:115075144-115075166 GGCTGGGGGAGAGGCAGAGGAGG + Intronic
1059646379 9:116272160-116272182 GGGGTTGGGAGGGGCAGGGGTGG + Intronic
1059856004 9:118397964-118397986 GTCTTTGAAAGAGGCAGGAGGGG - Intergenic
1060201318 9:121653081-121653103 GACTTCAGGAAAGGCAGGAGTGG - Intronic
1060405709 9:123372156-123372178 GGCTGTGGGAGAGGCAGGGCAGG - Exonic
1060482148 9:124022863-124022885 GGCTGCGGGAGAGGGAGGACTGG + Intronic
1060680847 9:125562902-125562924 GGCTTTGGCAGAGGAATGGGTGG - Intronic
1060957340 9:127651964-127651986 GGCTCTGGGAGAGGAAGAAGAGG + Intronic
1061002474 9:127910178-127910200 GGCTCTGGGGGAGGCTGGGGAGG + Intronic
1061164168 9:128912839-128912861 GGATCTGGGAGACGCTGGAGGGG + Intronic
1061176757 9:129002281-129002303 GTCTTTGGGAATGACAGGAGAGG - Intronic
1061334621 9:129923964-129923986 GGGTGAGGCAGAGGCAGGAGGGG + Exonic
1061664085 9:132150245-132150267 GGCTTTGGGAGAAGGGGGAATGG - Intergenic
1061730673 9:132611517-132611539 GTCCTGGGGAGAGGAAGGAGAGG - Intronic
1062054181 9:134462430-134462452 GGCTGTGGGAGGAGCTGGAGAGG + Intergenic
1062104067 9:134743145-134743167 GGCTTTTGGAGAGGCACACGGGG - Intronic
1062224412 9:135441324-135441346 GGCTTGGGAACAGGCAGGAGGGG + Intergenic
1185655788 X:1684513-1684535 GGAGCTGGGAGAGGCAGGAAGGG + Intergenic
1185704950 X:2260045-2260067 GGAGCTGGGAGAGGCAGGAAGGG - Intronic
1185790422 X:2924877-2924899 GGAGCTGGGAGAGGCAGGAAGGG + Intronic
1185844756 X:3427593-3427615 GGTTATGGGAGAGGGAGAAGAGG - Intergenic
1185909732 X:3970661-3970683 GGCTTAGGGACAGGGAGGAGGGG - Intergenic
1185919862 X:4078984-4079006 TTCTGTGGGAAAGGCAGGAGAGG - Intergenic
1186246910 X:7624719-7624741 GGCCTTGGGAGAGGCTAGAATGG - Intergenic
1186530801 X:10293360-10293382 GGCTTTGGGACAGGCAGAATGGG + Intergenic
1186760648 X:12718487-12718509 GGCTGTGGCACAGGCAGCAGTGG + Exonic
1187227620 X:17388795-17388817 GACTGCGGGAGAGGCAAGAGGGG + Intronic
1187290991 X:17952868-17952890 GGGTTTGGGAGGGGCAAAAGAGG + Intergenic
1187390736 X:18885053-18885075 CTCTTTGAGAGAGGCAGGGGGGG + Intergenic
1187474821 X:19601637-19601659 GTCTGTGGGTGAGGCTGGAGAGG + Intronic
1187547144 X:20266165-20266187 GACTTTGGGAGATGAGGGAGGGG - Intronic
1188052861 X:25508781-25508803 AGATTTGGGAGAGGCCGGGGTGG - Intergenic
1188995291 X:36877500-36877522 GGCTTTGGGAGGGGCAGGGTTGG + Intergenic
1189110258 X:38282268-38282290 GGGTTTCAGAGAGGAAGGAGTGG - Intronic
1189245409 X:39559896-39559918 GACCTTTGGAGTGGCAGGAGGGG - Intergenic
1189375361 X:40462281-40462303 GGCTTTGGGAGAAACATCAGAGG - Intergenic
1189470336 X:41308967-41308989 GGCTTGTGGACAGGCAAGAGTGG + Intergenic
1190292011 X:48999503-48999525 GCCTTTGGGGGAGGCAGGAAGGG + Exonic
1190328222 X:49219596-49219618 GGCAGGGGGTGAGGCAGGAGGGG - Intronic
1190426072 X:50335452-50335474 GGCTTAGGGACAGGGAGGAAGGG + Intronic
1190512577 X:51188801-51188823 GGCTAGGGGAGAGGGTGGAGAGG + Intergenic
1190873754 X:54445629-54445651 AGCCATGGGAGAGGCAGGAGAGG + Exonic
1191036250 X:56028945-56028967 GGCTTGGGGACAGGTAGGAGGGG + Intergenic
1192160392 X:68782049-68782071 GGTTATGGGAGGGGCAGAAGGGG + Intergenic
1192161456 X:68791300-68791322 GGTTATGGGAGGGGCAGAAGGGG - Intergenic
1192239326 X:69316911-69316933 GGTTATGGGAGGGGCAGAAGGGG - Intergenic
1192270430 X:69574619-69574641 AGATTTGGGAGGGGCAGGGGTGG - Intergenic
1192478655 X:71466077-71466099 GGCATTGGGATGGGGAGGAGGGG + Intronic
1192594619 X:72393666-72393688 GGCTTTGGGAAAAGGAGGATGGG + Intronic
1192844425 X:74891010-74891032 TGCTTTTGGAGAGGATGGAGAGG + Intronic
1193917466 X:87382859-87382881 AGATTTGGGAGGGGCAGAAGTGG + Intergenic
1193918858 X:87400898-87400920 AGATTTGGGAGGGGCAGAAGTGG + Intergenic
1194088782 X:89560886-89560908 TGCTTTGGGAGAGGCTGTGGTGG - Intergenic
1194088965 X:89562901-89562923 AGATTTGGGAGAGGCTGGGGTGG - Intergenic
1194194209 X:90871344-90871366 AGATTTGGGAGGGGCAGGAGTGG + Intergenic
1194206788 X:91019647-91019669 GGCAGTGGCAGAGGCAGGCGTGG + Intergenic
1194236681 X:91392971-91392993 GGCTGAAGGGGAGGCAGGAGAGG - Intergenic
1194400315 X:93432948-93432970 GGCTTGGGAACAGGCAGGAGGGG - Intergenic
1196179076 X:112670951-112670973 AGCTTTGGGGCAGGGAGGAGTGG - Intronic
1196625245 X:117870736-117870758 TGCTTGAGGAGAGGGAGGAGTGG + Intergenic
1196717356 X:118824191-118824213 GGATTTGGGGGTGGGAGGAGAGG + Intronic
1196830598 X:119772741-119772763 AACTTTGGGAGAGGCAGGGAGGG - Intergenic
1197112679 X:122795293-122795315 GGGTCAGGGAGAGGGAGGAGGGG + Intergenic
1197279064 X:124513980-124514002 GGACTTGGGGGAGGGAGGAGTGG + Intronic
1197362378 X:125521285-125521307 GGATGTGGGACAGGCAGAAGAGG + Intergenic
1197607346 X:128599291-128599313 TGCTATGGCAGAGGCAGAAGTGG - Intergenic
1197749124 X:129953045-129953067 GGGGCTGGGAGAGGCTGGAGGGG - Intergenic
1198152457 X:133924406-133924428 GGCTTTTGGAGTGGGAGCAGGGG - Intronic
1198969858 X:142268426-142268448 GGCTTGGGGACAGGTAAGAGGGG - Intergenic
1198992714 X:142534277-142534299 GGTTTTGGGAAAGGTAGGTGTGG - Intergenic
1199228780 X:145410338-145410360 AGATTTGGGAGGGGCAGGGGTGG + Intergenic
1199623183 X:149716746-149716768 TGCTTTGAGAGAGGAGGGAGAGG + Exonic
1199635639 X:149809125-149809147 GGCTTTGGGAGAGGAGGAAGAGG + Intergenic
1199904072 X:152206719-152206741 GGCTTTGGCAGAAGCAGTAGAGG - Intronic
1200091403 X:153637803-153637825 GGCTGGGGGACAGGCAGGAGGGG - Intergenic
1200149060 X:153942649-153942671 GGACTTGGGTGGGGCAGGAGGGG + Intronic
1200441458 Y:3216937-3216959 TGCTTTGGGAGAGGCTGTGGTGG - Intergenic
1200441637 Y:3218958-3218980 AGATTTGGGAGAGGCTGGGGTGG - Intergenic
1200521167 Y:4211074-4211096 GGACTTGGAAGATGCAGGAGTGG + Intergenic
1200540817 Y:4453728-4453750 AGATTTGGGAGGGGCAGGAGTGG + Intergenic
1200552537 Y:4594436-4594458 GGCAGTGGCAGAGGCAGGTGTGG + Intergenic
1200943184 Y:8806235-8806257 GTCTCAGGGACAGGCAGGAGGGG - Intergenic
1200983809 Y:9285967-9285989 GGCTTAGGAACAGGCAGGAGGGG + Intergenic
1201411767 Y:13705418-13705440 GGCGATGGGAGAAGCAGGCGTGG - Exonic
1201554905 Y:15257519-15257541 GGCTTAGGTACAGGCAGGAGCGG - Intergenic
1201680723 Y:16641558-16641580 GGCTTGGGGACAGGTAGGAGGGG + Intergenic
1202126562 Y:21573733-21573755 GGCTTAGGAACAGGCAGGAGGGG - Intergenic
1202251319 Y:22876396-22876418 GGGTTGGGGGGAGGCGGGAGGGG + Intergenic
1202404307 Y:24510145-24510167 GGGTTGGGGGGAGGCGGGAGGGG + Intergenic
1202466472 Y:25159937-25159959 GGGTTGGGGGGAGGCGGGAGGGG - Intergenic