ID: 1152438027

View in Genome Browser
Species Human (GRCh38)
Location 17:80288091-80288113
Sequence GGAGAGGCAGGAGTGGCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 764}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152438008_1152438027 29 Left 1152438008 17:80288039-80288061 CCTCTCCGCGCCCACCGAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438016_1152438027 -1 Left 1152438016 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG 0: 1
1: 1
2: 8
3: 66
4: 433
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438013_1152438027 15 Left 1152438013 17:80288053-80288075 CCGAGGTTGGCGACAGCCCCCTG 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438021_1152438027 -4 Left 1152438021 17:80288072-80288094 CCTGCAGGCCCAGGCTTTGGGAG 0: 1
1: 1
2: 7
3: 71
4: 694
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438012_1152438027 18 Left 1152438012 17:80288050-80288072 CCACCGAGGTTGGCGACAGCCCC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438020_1152438027 -3 Left 1152438020 17:80288071-80288093 CCCTGCAGGCCCAGGCTTTGGGA 0: 1
1: 1
2: 4
3: 31
4: 344
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438011_1152438027 19 Left 1152438011 17:80288049-80288071 CCCACCGAGGTTGGCGACAGCCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438018_1152438027 -2 Left 1152438018 17:80288070-80288092 CCCCTGCAGGCCCAGGCTTTGGG 0: 1
1: 2
2: 7
3: 75
4: 410
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764
1152438010_1152438027 24 Left 1152438010 17:80288044-80288066 CCGCGCCCACCGAGGTTGGCGAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG 0: 1
1: 0
2: 6
3: 87
4: 764

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152438027 Original CRISPR GGAGAGGCAGGAGTGGCCAC AGG Exonic
900113309 1:1018672-1018694 GGAGAGGCATGAGCGGGAACCGG - Intergenic
900134788 1:1111710-1111732 GGGGAGGCGGGAGGGTCCACTGG + Intronic
900250729 1:1667536-1667558 GCACAGGAAGCAGTGGCCACAGG + Intronic
900261696 1:1733896-1733918 GCACAGGAAGCAGTGGCCACAGG + Intronic
900338829 1:2178188-2178210 GGAGAGGCTGGAGTGGGTTCGGG - Intronic
900364684 1:2306309-2306331 GGCTGGGCAGGACTGGCCACCGG - Intronic
900411746 1:2515678-2515700 GGACCGGCTGGAGAGGCCACTGG - Exonic
900556931 1:3285251-3285273 GGAGAGGCAGGGGCCTCCACGGG - Intronic
900637090 1:3671335-3671357 GGAGAGGCAGGAACAGCAACTGG - Intronic
900640925 1:3687750-3687772 GGAGAGGCAGGAAGGGGCACAGG - Intronic
900780488 1:4614634-4614656 GGAAAGGAAGGTGTGGCCTCAGG + Intergenic
901234585 1:7661155-7661177 GCAGATGCAGGAGAGGCCAGGGG - Intronic
901645415 1:10714512-10714534 CACGAGGCTGGAGTGGCCACTGG + Intronic
901789390 1:11646475-11646497 AGTGAGGCAGGAGAGGCCTCTGG - Intergenic
901789952 1:11648865-11648887 GGGGCGGCAGGAGAGGCCTCAGG - Intronic
902531453 1:17093467-17093489 GGTGAGGCAGGTGTGGACTCAGG - Intronic
902551127 1:17220176-17220198 GAAGAGGCAGGAGTGTGCAGGGG - Intronic
902878117 1:19353114-19353136 GGTGAGGCAGGCTGGGCCACAGG + Intronic
902878724 1:19356786-19356808 GGAGAGCCTGAAGTGGCCCCTGG + Intronic
902963835 1:19984007-19984029 GCGGAGCCAGGAGTGGCAACCGG - Intergenic
903619653 1:24688768-24688790 GGAGGGGCAGGACTGACCTCAGG - Intergenic
903643515 1:24876374-24876396 GGCGGGGCAGGAGTGGCAGCAGG + Intergenic
904136167 1:28314226-28314248 GCAGAGGCAGGAAAGGTCACTGG + Intergenic
904162303 1:28530793-28530815 GGAGAGGCAGGAGGGGCGGGAGG - Intronic
904254041 1:29243398-29243420 GGATAGGCAGGAGTGGGATCAGG - Intronic
904259222 1:29278982-29279004 GGAAAGGCAGCAGGGGCCAGGGG - Intronic
904336911 1:29803767-29803789 AGACAGGCAGGAATGCCCACTGG + Intergenic
904814061 1:33182066-33182088 GGGGAGGCAGCCGCGGCCACCGG - Intergenic
905205409 1:36340428-36340450 GGCCAGGCAGGAGGGGCCTCAGG + Exonic
905272647 1:36797000-36797022 GGAGGGGCAGGAATGGCCAACGG - Exonic
905274014 1:36805519-36805541 GGGAAGGCAGGAATGGCCTCTGG + Intronic
905473238 1:38208311-38208333 GGAAAGGCAGGACTGCCCGCCGG + Intergenic
905964687 1:42081840-42081862 GCAGTGGCAGCAGTGGCTACAGG + Intergenic
906218664 1:44060110-44060132 GGAGAGTCAGGAGTGGTTATGGG - Intergenic
906524919 1:46488379-46488401 GGTGGGGCAGAAGGGGCCACAGG - Intergenic
906532643 1:46532477-46532499 GGAGGGGCAGGAGAGGGGACTGG + Intergenic
906819700 1:48916397-48916419 GGAGAGGGAGGCGGGGCAACTGG + Intronic
907220713 1:52905149-52905171 GCAGAGGCAGCTGTGGCCCCCGG - Intronic
907551525 1:55309023-55309045 GAAGAGGCAGGAGGGGCCCAGGG + Intergenic
907584660 1:55606494-55606516 GGAGAGGCAGGCTAGTCCACTGG - Intergenic
908473797 1:64470047-64470069 GGAGAGAGAGGAGGGGCAACCGG + Intergenic
908561333 1:65309596-65309618 GGAAAAGAAGGAGCGGCCACCGG - Exonic
908747600 1:67391079-67391101 GCAGAGGCAGGGGTGGCCTCTGG - Intronic
908864942 1:68537178-68537200 GGAGAGGAAGGAGAGGGAACAGG + Intergenic
910622689 1:89273686-89273708 GGAGAGGCAGGGGTGGGAACTGG - Intergenic
911647370 1:100351597-100351619 GGAGAGAGAGGAGAGTCCACTGG - Intergenic
911954530 1:104217805-104217827 GGAGAGGCACGAGCGGGAACCGG - Intergenic
913475906 1:119237552-119237574 GGATAGACAGGAGTGAACACAGG - Intergenic
913692150 1:121289465-121289487 GGAGAGGCACGAGCGGGAACCGG - Intronic
913987069 1:143575094-143575116 GGAGAGGCATGGGTGGAAACCGG + Intergenic
913998837 1:143675282-143675304 AGAGTGGCAAGAGAGGCCACGGG - Intergenic
914145405 1:144990649-144990671 GGAGAGGCACGAGCGGGAACCGG + Intronic
914509477 1:148318350-148318372 AGAGTGGCAAGAGAGGCCACTGG - Intergenic
914858886 1:151370789-151370811 GCAGAGGCTGGACTGGCCACAGG - Intronic
914975061 1:152353587-152353609 GGACAGACAGGAGAGGCCACTGG - Exonic
915034505 1:152910775-152910797 GGAGCAGCAGGAGGGGCAACTGG + Exonic
915121146 1:153630154-153630176 GGGCAGGCAGGGGTGGTCACAGG - Intronic
915196435 1:154193368-154193390 GGAGAGGAAGGAGTGGAAAATGG + Intronic
915263204 1:154694477-154694499 GGAGAGGGAGGAGTTGACAGAGG - Intergenic
915557073 1:156666751-156666773 GGATGAGCAGGAGTGGCCAGTGG - Intergenic
915666147 1:157446641-157446663 GGAGAGGCGCGAGCGGCAACCGG - Intergenic
915953430 1:160205261-160205283 GGAGAGGCAGGAGGGGGCGGGGG - Intergenic
916720129 1:167478569-167478591 GGAGAGGCAGTAGTGTGGACAGG + Intronic
917488844 1:175480031-175480053 GGAGAGGCAGGAATGACCACAGG + Intronic
917932366 1:179831712-179831734 GGAGACCCAGGAGTGGCTACAGG + Intergenic
917952437 1:180053851-180053873 GGAGACGCAGGAGTGAAGACTGG - Exonic
917967591 1:180188215-180188237 GGGGAGCCAGCAGTGTCCACTGG - Intronic
918047744 1:180951710-180951732 GGAAAGGCTGGGGAGGCCACGGG + Intergenic
918097293 1:181345868-181345890 GGAGGGGAGAGAGTGGCCACAGG + Intergenic
919174434 1:194001841-194001863 GGAGAGGCACGAGCGGGAACCGG + Intergenic
919587243 1:199454314-199454336 GAACAGGCAAGAGTGGACACAGG - Intergenic
919782624 1:201230663-201230685 GGACAGGCAGGAATGGGCAAGGG + Intergenic
920479474 1:206307813-206307835 GGAGAGGCACGAGCGGGAACCGG - Intronic
920504913 1:206508648-206508670 TGAAAGGCAGGAGGGGGCACGGG - Intronic
921338471 1:214111165-214111187 GGAAAGGCAGGAGTGGATGCTGG + Intergenic
921801769 1:219410651-219410673 GGAGAGGCAAGAGCGGGAACCGG + Intergenic
922329959 1:224565738-224565760 GGAGAAGCAGGGGCTGCCACGGG - Intronic
922739348 1:228006841-228006863 GCAGGGGCAGGCGGGGCCACGGG - Intergenic
922806837 1:228394661-228394683 GGAGGGGCAGGAGAGGCAACAGG + Exonic
922932886 1:229403882-229403904 CGAGGGGCAGGTGTGCCCACAGG - Intergenic
922991855 1:229920927-229920949 GGAGAGGCAGCAGTAGCAGCTGG - Intergenic
923157272 1:231289836-231289858 GGAGAGGCGCGAGTGGTAACTGG - Intergenic
923219918 1:231883641-231883663 TTAGAGGCAGGTGAGGCCACAGG + Intronic
923324846 1:232871804-232871826 GGAGAGGCACGAGCGGGAACCGG - Intergenic
924005058 1:239600163-239600185 GGAGAGGAAGGAGCAGACACTGG - Intronic
924497250 1:244602403-244602425 TCAGCGGCAGGGGTGGCCACCGG + Intronic
1062858104 10:789608-789630 CGTGAGGCAGCACTGGCCACTGG + Intergenic
1062947428 10:1472272-1472294 TGAGGGGCAAGGGTGGCCACAGG + Intronic
1063157489 10:3393692-3393714 TGAAAGGAAGGAGTAGCCACTGG - Intergenic
1063264154 10:4427790-4427812 TTAGAGGCAGGATTCGCCACTGG - Intergenic
1063300046 10:4842991-4843013 TGAGAGGCAGGAGTGAAGACTGG + Intronic
1063321073 10:5053460-5053482 GGAGAGGCATGGGTGGGAACTGG - Intronic
1063367154 10:5498563-5498585 GGGGAGGCAGGAGCTGCCCCTGG + Intergenic
1063704801 10:8420410-8420432 GGTGAGGCAAGATTGGCCCCCGG - Intergenic
1063887849 10:10597737-10597759 GCAGTGGCAGGAGAGGCCAAGGG - Intergenic
1064020930 10:11808168-11808190 TGAGAGGCAGACCTGGCCACAGG - Intergenic
1064164077 10:12972005-12972027 GGAGAGGCAGGAGAGAGCAGAGG - Intronic
1064390508 10:14937985-14938007 GGAGAGGCAGTAGTGCCTGCAGG - Intronic
1064400884 10:15020000-15020022 GGAGAGGCAGTAGTGCCCGCAGG - Intergenic
1065918009 10:30368336-30368358 GGAGCGGGAGGAGAGGCTACGGG - Intronic
1066186264 10:33013291-33013313 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1066293588 10:34035394-34035416 GGAGAGGCGGGAGTGGGAACTGG + Intergenic
1066544278 10:36482357-36482379 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1067282115 10:44880638-44880660 TGGGAGGAAGGAGAGGCCACTGG + Intergenic
1067552668 10:47246436-47246458 GGAGAGGCAGCTGTGGGCAGTGG - Intergenic
1067733176 10:48828495-48828517 GGGGAATCAGGAGTGGGCACAGG + Intronic
1067765263 10:49081146-49081168 GGAAAGGCAGGACTGGCCGTGGG - Intronic
1067797600 10:49332071-49332093 GGAGAGGAAGGTGTGGCAGCAGG - Intergenic
1068902076 10:62280377-62280399 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1069776172 10:70928558-70928580 AGTGGGGCAGGAGTAGCCACAGG + Intergenic
1070630531 10:78081592-78081614 GGAGAGAGGGGTGTGGCCACAGG + Intergenic
1070773397 10:79095952-79095974 CGTGAGGCAGGTGGGGCCACAGG + Intronic
1070909851 10:80108582-80108604 GCAGATGCAGGAGCTGCCACTGG + Intergenic
1071003718 10:80859235-80859257 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1072705418 10:97677355-97677377 GGAGGGGCAAGAGTGTCCCCAGG - Intergenic
1073150111 10:101305685-101305707 GGGGATGCAGAAGTGGGCACAGG - Intergenic
1074468079 10:113701950-113701972 AGAGAGACAGGAATGGCCAGTGG - Intronic
1074492515 10:113951824-113951846 GGAGAGGGAAGAGTGATCACAGG + Intergenic
1074653622 10:115557240-115557262 GAAGAGGCAGGAGTTGCATCTGG + Intronic
1074999196 10:118782902-118782924 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1075519472 10:123135334-123135356 GGAGAGGCAGGCGCGGTCTCCGG + Intergenic
1075673606 10:124281137-124281159 GGCAAGGCTGGAGTGGCCAGGGG - Intergenic
1075708629 10:124518377-124518399 GGAAAGGCAGGATTGGGGACTGG - Intronic
1075822502 10:125326938-125326960 GGTGAGGCAGGAGAGGCCCCTGG + Intergenic
1076209959 10:128632435-128632457 GCAGATGCAGGAGTGGGCAGGGG + Intergenic
1076250048 10:128978314-128978336 GGATGGGCAGGAATGGCCACAGG + Intergenic
1076266500 10:129113252-129113274 CTAAAGGGAGGAGTGGCCACAGG - Intergenic
1076685034 10:132194710-132194732 GGAGACACAGCAGAGGCCACCGG - Intronic
1076768866 10:132652030-132652052 GGAGAGGGAGGAGGGACCAAGGG - Intronic
1076806235 10:132860528-132860550 GGACAGGCAGGGGTGGATACGGG + Intronic
1077105300 11:839558-839580 GGACAGGCAGCAGTGGGCAGAGG + Intronic
1077147046 11:1051012-1051034 GGTGGGGCAGGTGGGGCCACCGG - Intergenic
1077266041 11:1650782-1650804 GGGCAGGCAGGAGACGCCACGGG - Intergenic
1077432442 11:2522452-2522474 GCAGAGGCAGGAGGGGACACAGG + Intronic
1077457555 11:2690022-2690044 GGAGAGGCAGGGCTGGCCCTCGG - Intronic
1077461428 11:2712690-2712712 GCTGAGGCTGGAGTGTCCACAGG - Intronic
1077730496 11:4724174-4724196 GTAGAGGCAGGAGTGGAGGCAGG + Intronic
1077805725 11:5589879-5589901 GGAGAGGCGCGAGTGGGAACCGG + Intronic
1078108586 11:8373883-8373905 TGAGAGGCAGGAGGGGCCTCTGG - Intergenic
1078251932 11:9623398-9623420 GGAGAGGCATGAGCGGGAACCGG - Intergenic
1078301237 11:10133665-10133687 GGAGAGGCATGAGCGGGAACCGG - Intronic
1078427807 11:11265734-11265756 GGAGAGGGAGGAGTGCCAGCAGG - Intergenic
1078579286 11:12526065-12526087 GCACAGGCAGGAGCGGGCACAGG + Intronic
1079415335 11:20229765-20229787 GGGGAGGCAGCAGTGACCAATGG + Intergenic
1080692730 11:34572146-34572168 GAAGAGGCAGAACTGACCACAGG - Intergenic
1080951594 11:37039879-37039901 GAAGAGGCATGAGTGGTCATTGG + Intergenic
1081533767 11:43982864-43982886 GAGGAGGCAGGAGTGGTCAGAGG + Intergenic
1081549141 11:44096048-44096070 GGAGAAGCAGGAGTGGAAATCGG - Intronic
1081852815 11:46285475-46285497 GGAGAGGCAGGAAATGCCCCAGG + Intronic
1082934232 11:58639783-58639805 GGAGAGGCAGCACTGGCCAGAGG + Intergenic
1082985909 11:59171550-59171572 GCAGAGGTTGGAGTGGCCACTGG + Intronic
1083180418 11:60981645-60981667 GGAGCAGCAGCTGTGGCCACAGG - Intronic
1083312017 11:61788716-61788738 GGAGGGGAAGGTGTGGCCATGGG - Intronic
1083328494 11:61885838-61885860 GGAGAGGCAGGAATGTCCTGGGG - Intronic
1083546075 11:63550205-63550227 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1083602924 11:63960195-63960217 GGTGGGGCAGGAGAGGCCTCTGG - Intergenic
1083799256 11:65037002-65037024 GGAGAGGCAGGAGCAGGAACGGG - Intronic
1083886714 11:65576652-65576674 GCTGAGGAAGGAGTGGACACAGG - Intronic
1084008618 11:66335790-66335812 GGAGACGAAGGAGGGGCCACTGG + Exonic
1084562163 11:69911209-69911231 GGAAGGGAAGGAGTGGCCCCTGG - Intergenic
1084640398 11:70422674-70422696 GGAGGGGCAGGAGGGGCGGCGGG - Intronic
1084642783 11:70435775-70435797 GGACAAGCCGGAGTGGGCACAGG - Intronic
1084679857 11:70660628-70660650 AGGGAGGCATGAGTGGCCAAGGG + Intronic
1084730045 11:71067018-71067040 GAAGATGCAGGAGTGGTCAAAGG - Intronic
1084907317 11:72358048-72358070 GGAGAGGCAGGAGTGGGATATGG + Intronic
1085054172 11:73394445-73394467 GCACAGGCAGAAGTGGCCATAGG - Intronic
1085202059 11:74707801-74707823 GCAGAGGCAGGAGTGGGCTGGGG - Intronic
1085302687 11:75467654-75467676 GCTGGGGCAGGAGTGGCCCCTGG + Intronic
1085304394 11:75476906-75476928 GAAGAGGCTGGAGTGGCCAGGGG - Intronic
1085315743 11:75543838-75543860 GTAGAGGTGGGAGTGGCCCCTGG - Intergenic
1085411201 11:76291745-76291767 GGGGAGACAGGTGTGGACACAGG - Intergenic
1087486427 11:98763770-98763792 GGAGAGGCGCGAGTGGGAACCGG - Intergenic
1088570838 11:111221978-111222000 GGAGAGGCGCGAGCGGCAACCGG + Intergenic
1088815927 11:113420833-113420855 GCAGAGGAAGGAGTGGCCCCAGG + Intronic
1089612632 11:119677958-119677980 TGAGAGGCAGGGATGGCCAAGGG - Intronic
1089657743 11:119963949-119963971 GGAGAGGCAGTAGTGAGGACAGG + Intergenic
1089742933 11:120597404-120597426 GGAGAGGAAGGAGAGGGAACTGG - Intronic
1090158240 11:124464189-124464211 GCTGAGCCAGGAGTGGCCCCTGG + Intergenic
1090160846 11:124493106-124493128 GCTGAGCCTGGAGTGGCCACTGG + Intergenic
1091201179 11:133782349-133782371 GGAGAGGCACGGGTGGGAACCGG + Intergenic
1091300342 11:134503331-134503353 AGGCAGGCAGGAGTGGCCGCTGG + Intergenic
1091448309 12:557504-557526 GGTGAGTCAGGAGTGCCCATCGG - Intronic
1091683893 12:2547881-2547903 GGAGGGGCAGGCCTGGGCACTGG - Intronic
1091691350 12:2599547-2599569 GGAGAGGCAGGGATGGCCCGTGG + Intronic
1091750088 12:3016940-3016962 ACTGAGGCAGGAGGGGCCACAGG + Intronic
1091767327 12:3130148-3130170 GGTGGGGCAGGGCTGGCCACCGG - Intronic
1091999319 12:5019506-5019528 GGGGAGACAGGTGTGGACACAGG + Intergenic
1092221360 12:6716036-6716058 GGAGAGGCATGAGCGGGAACCGG + Intergenic
1092593477 12:9974243-9974265 GGAGAGGCAGGCATGGTGACAGG - Intronic
1093972921 12:25391428-25391450 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1094589341 12:31806149-31806171 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1094666450 12:32525673-32525695 GGAGAGGCACGAGCGGGAACCGG + Intronic
1095397150 12:41774297-41774319 GAAGAGGCAAGAGTGCCCACTGG + Intergenic
1095444996 12:42274063-42274085 GGAGAGGCATGAGCGGGAACTGG - Intronic
1095953879 12:47795773-47795795 GGAGAGGCGGGAGAAGTCACGGG + Intronic
1096233811 12:49912497-49912519 GGAGAGCCAGGCGGGGCCAGGGG + Intergenic
1096575793 12:52552142-52552164 TGAGAGGCAGAAGAGGGCACTGG - Intronic
1096627608 12:52904983-52905005 GTAGAGGCAGGAGTGGAGGCAGG + Exonic
1096839454 12:54371414-54371436 GTAGAGGCAGGGGTGGCCTGAGG + Intronic
1097101668 12:56594093-56594115 GGAGTGACAGGAGTAGGCACTGG - Exonic
1097140612 12:56899951-56899973 GTAGTGGCAGGAGTGGCTGCAGG + Intergenic
1097287666 12:57890029-57890051 GGTGAGGCAGGGGAGGCCAGAGG + Intergenic
1097326534 12:58283659-58283681 TAAGAGGCAAGAGTGGACACAGG - Intergenic
1099559654 12:84155481-84155503 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1101462001 12:104905873-104905895 GGAGAGGCACGAGCGGGAACCGG - Intronic
1101846891 12:108369974-108369996 CAAAAGGCAGGAGTGGCCTCAGG - Intergenic
1101877127 12:108603373-108603395 GGACAGGCTCCAGTGGCCACTGG - Intergenic
1102098127 12:110256808-110256830 AGGGAGGAAGGAGGGGCCACAGG - Intergenic
1102463852 12:113116434-113116456 GGAGAGCCAAGAGAGGCCAATGG + Intronic
1103439273 12:120950704-120950726 GGAGAGGCGGGAGCGGCAACTGG - Intergenic
1103902441 12:124310420-124310442 GGAGAGGCTGCAGGGGCCAGAGG + Intronic
1104034844 12:125091178-125091200 GCAGAGGGAGGAGAGCCCACGGG + Intronic
1104073614 12:125370213-125370235 GGAAAGGCAGGAATGTCCACAGG + Intronic
1104111671 12:125710364-125710386 TCAGAGGCAGGGGTGGTCACAGG + Intergenic
1104749201 12:131227811-131227833 GGAGAGGCGGGAGTGGGAACCGG + Intergenic
1104899153 12:132178907-132178929 GGAGAGGCAGGTGCGGCCCGGGG - Intergenic
1104966219 12:132509834-132509856 GGAGGGTGAGGAGTGGCCGCGGG - Intronic
1105020957 12:132816662-132816684 GGAGAGGCATCAGGGCCCACTGG + Exonic
1105037713 12:132938753-132938775 GGAGAGGCACGAGCGGGAACCGG + Intronic
1105049177 12:133032773-133032795 GGAGTGGCTGGAGTGGCAGCTGG + Intergenic
1105328927 13:19396297-19396319 GCAGAGCCAGGAGTGGCCGTGGG - Intergenic
1105628314 13:22135672-22135694 TGAGAGACAGGAGTAGCCAGTGG - Intergenic
1105863019 13:24433543-24433565 GCAGAGCCAGGAGTGGCCGTGGG + Intronic
1106465095 13:30006425-30006447 GGAGAGGCAAGAGTGCCTCCCGG + Intergenic
1106484396 13:30159548-30159570 GGAGAGCCAGGACAGGCCCCTGG - Intergenic
1106628251 13:31442754-31442776 GGATAGGCAGGGGTGGTTACAGG + Intergenic
1106810910 13:33357980-33358002 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1108475511 13:50812255-50812277 GGGGCTGCAGGAGTGGACACTGG + Intronic
1108706852 13:52996702-52996724 GGAGAGGAAGACTTGGCCACGGG + Intergenic
1109141008 13:58714083-58714105 GGAGAGACAGGAGCGGGAACCGG + Intergenic
1109159911 13:58958543-58958565 GGAGAGGCGCGAGTGGGAACTGG - Intergenic
1110034811 13:70670003-70670025 GGAGGAGCAAGAGTGGCCATAGG - Intergenic
1110417449 13:75268448-75268470 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1111845924 13:93508416-93508438 GGTGAGGCTGGTGTGGCCAAAGG + Intronic
1113291556 13:108912041-108912063 GGAGATGCAGGAGTGTCAGCAGG + Intronic
1113435380 13:110287089-110287111 GAAGAGGCAGGAGAGGCCCCGGG + Intronic
1114560349 14:23585243-23585265 GGAGAGGCACCAGTGGGAACCGG - Intergenic
1116479917 14:45385154-45385176 GGATAGCCAGGAGTGAACACTGG - Intergenic
1116623976 14:47242443-47242465 GGAGAGGCACGAGCGGGAACCGG + Intronic
1117571963 14:57056976-57056998 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1117578394 14:57125566-57125588 GCAGAGGCAGGAGTGGAGTCAGG - Intergenic
1117587182 14:57221448-57221470 GGAGAGGCAAGAATGTACACAGG + Intronic
1117595855 14:57326478-57326500 GGAGATGCATGATTGGCCTCAGG - Intergenic
1118792575 14:69108557-69108579 GGAGAGGCAGAAGAGGCAAATGG + Intronic
1118821111 14:69346870-69346892 TGAGGAGCAGGAGTGGCCTCTGG - Intronic
1119453824 14:74736964-74736986 GGAGAGGGAGGAAAGGCCAGTGG + Exonic
1119564277 14:75615430-75615452 TGACAGGCAGCAGAGGCCACTGG - Intronic
1120502471 14:85313532-85313554 GGAGAGGCAGCTGTGGCCCTTGG + Intergenic
1120827468 14:88968839-88968861 ATAGAGCCAGGAGTGGACACGGG - Intergenic
1122428145 14:101623523-101623545 TGAGAGCCAGGAGTGACCCCTGG - Intergenic
1122501379 14:102202263-102202285 GAAGAGGAAGGAGCTGCCACAGG - Intronic
1122600312 14:102918048-102918070 GGGGAGGAAGGAGCCGCCACTGG - Intergenic
1123051845 14:105547830-105547852 GGAGAGGCACGGGTGGGAACCGG + Intergenic
1123073885 14:105656643-105656665 GCACAGGCAGCAGTGGCCATGGG - Intergenic
1123799099 15:23802914-23802936 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1124573088 15:30883756-30883778 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1124696847 15:31870659-31870681 GGCGGGGGAGGAGAGGCCACCGG - Intronic
1125480331 15:40075133-40075155 GGAGAGGCACGAGTGGGAACCGG - Intergenic
1125697585 15:41651908-41651930 GGAGAGGAAGGAGTGGAGAAGGG - Intronic
1125825919 15:42676246-42676268 GGAGAGAGAAAAGTGGCCACAGG - Intronic
1126697023 15:51335021-51335043 GGAGAAGCAGGATTGGGCAGAGG - Intronic
1127701675 15:61507325-61507347 GGAGAGGCAGTGCTGACCACAGG - Intergenic
1128107573 15:65055897-65055919 GCAGAGGCAGGAGAGGGCAGGGG + Intronic
1128648417 15:69393593-69393615 GGAGAGGCAGGGGTGGAGCCTGG - Intronic
1128762390 15:70226179-70226201 CCAGAGGCAGGAGTGGGCATGGG + Intergenic
1128764149 15:70240838-70240860 GGTGAGGCAGGAGTGGGCACAGG + Intergenic
1128803999 15:70517338-70517360 GGGGTGGCAGGAGCGGGCACAGG - Intergenic
1129859130 15:78846873-78846895 GGAGAGGCACGAGCGGGAACCGG + Intronic
1130221087 15:82020306-82020328 GGAGAGAGAGGAGTGGGCGCAGG - Intergenic
1132205110 15:99981061-99981083 GCAGAGGTAGGAGTGGCGAGTGG + Intronic
1132548262 16:543553-543575 GCACGGGCAGGAGTGGCCCCAGG - Intronic
1132567811 16:631262-631284 GGAGCGGCAGGAGTGGACGTAGG - Exonic
1132695030 16:1198282-1198304 GGAGGGGCAGGAGTGGAGGCAGG - Intronic
1132851955 16:2028791-2028813 GGAGAGAAAGCAGTGCCCACTGG - Intronic
1132866067 16:2093323-2093345 GGCCAGGCAGGAGTGGGCATTGG + Intronic
1133130352 16:3672907-3672929 GGCGAGGCGGGAGTGGGCTCTGG - Intronic
1133332859 16:4987437-4987459 GGAAAGGCAGCCCTGGCCACTGG - Intronic
1133392812 16:5422968-5422990 GGAGAGGGAGGAGTGGGGAGAGG + Intergenic
1133473537 16:6098239-6098261 GGAGAGGCAGCAGTGCCAAGGGG + Intronic
1135262162 16:20990001-20990023 GGAGAGGCGCGAGTGGGAACCGG - Intronic
1136026015 16:27469592-27469614 GGAGAGGCTGCAGTAGCAACTGG - Intronic
1136163260 16:28435369-28435391 GGAGAGGCACGAGTGGGAAGCGG + Intergenic
1136199706 16:28679618-28679640 GGAGAGGCACGAGTGGGAAGCGG - Intergenic
1136216053 16:28793791-28793813 GGAGAGGCACGAGTGGGAAGCGG - Intergenic
1136316642 16:29458304-29458326 GAGGAGGCAGGAGGGGCCCCTGG + Intergenic
1136431218 16:30197646-30197668 GAGGAGGCAGGAGGGGCCCCTGG + Intronic
1136456239 16:30381362-30381384 GTAGAGGCAGCAGTGGACTCGGG + Exonic
1137580629 16:49631568-49631590 GGGGAGGCAGCCCTGGCCACAGG - Intronic
1138776500 16:59729783-59729805 GGCAAGGCACCAGTGGCCACAGG - Intronic
1139345430 16:66300159-66300181 GAAGAGGCATGGGTGGCCCCTGG - Intergenic
1139603010 16:67998215-67998237 GGAGAGGCGCGAGTGGGAACCGG + Intronic
1139968791 16:70761034-70761056 GGGTAGGCAGGAGAGGCCAAGGG + Intronic
1140722562 16:77784738-77784760 GGAGAGGCCCGAGCGGCAACCGG - Intergenic
1140903404 16:79391027-79391049 GGAGAGGCAGCAGTGGACCCTGG - Intergenic
1141944204 16:87298396-87298418 AGAGTGGCAAGAGTGGACACGGG - Intronic
1142030291 16:87835185-87835207 GGAGATGCAGGGCTGACCACAGG + Intronic
1142122341 16:88393170-88393192 GGCGAGGCAGGAATGCACACGGG - Intergenic
1142207999 16:88793094-88793116 GCAGGGGCAGGAGTGGGCAGGGG - Intergenic
1142505630 17:361593-361615 GGAGAGGCACCAGTGGGAACCGG + Intronic
1142595206 17:1026573-1026595 GGAGAGGCGGGAGGGGCCCGTGG - Intronic
1142691178 17:1606838-1606860 GGAGAGCCAGCACTGGCTACTGG + Intronic
1142726732 17:1820718-1820740 GGAGAGGTAGGGGTGGACAGTGG + Intronic
1143403563 17:6661077-6661099 GGAGAGGCAGGAGTGGGATGGGG + Intergenic
1143663222 17:8340139-8340161 GGGGAGGCAGGATGGGGCACAGG + Exonic
1144436960 17:15250910-15250932 GGAGAGGCAAGAGTGGAAACTGG - Intronic
1145403704 17:22568668-22568690 GGAGAAGGAGGAGTCGCCAGTGG - Intergenic
1145882752 17:28364209-28364231 GGAGGGGCAGGGTGGGCCACAGG + Intergenic
1146278081 17:31527945-31527967 GGAGGGGCAGGGCTGGCCATCGG + Intronic
1147684701 17:42280189-42280211 GGAGATGCAGCAATGTCCACTGG + Intergenic
1147805312 17:43126840-43126862 GGAGAGGCGGGTGTGGGAACTGG + Intergenic
1147898452 17:43767883-43767905 GGAGAGGCAGGTGTGGCGTAAGG - Exonic
1148351554 17:46945149-46945171 CGAGGGGCAGGAGTGGCCTGGGG + Intronic
1148774396 17:50087560-50087582 GGAGAAGCAGGAAGGACCACTGG + Intronic
1148775771 17:50095115-50095137 GGAAAGGGAGGAGTGAACACAGG + Intronic
1149297837 17:55276595-55276617 ATAGAGGCAGGAATGCCCACAGG + Intronic
1150438690 17:65173993-65174015 GCCGAGGCAGCAGTGGCCAGAGG + Intronic
1150641707 17:66953855-66953877 GAAGAGGGAGGAGGAGCCACAGG + Intergenic
1150745293 17:67811814-67811836 AGAGAGACACGAGTGGTCACTGG + Intergenic
1150951136 17:69802836-69802858 GCAAAGGCACGACTGGCCACAGG + Intergenic
1151012713 17:70519077-70519099 GGTGAGGAAAGGGTGGCCACTGG + Intergenic
1151230482 17:72681421-72681443 AGGGAAGCAGGAGTGGCCAGAGG + Intronic
1151585334 17:75005073-75005095 GGGGAGGCAGGGGTGGACATTGG - Exonic
1151594339 17:75067907-75067929 TGAGAGGCAGCAGCTGCCACTGG - Intergenic
1151656687 17:75499531-75499553 GAAGAGCCAGGACTGGCCAAGGG - Exonic
1151671431 17:75573645-75573667 GGAGGGGCGGGAGAGGCCTCTGG - Intronic
1151786533 17:76277961-76277983 GGAGAGGCGGGCGAGGCCATGGG - Intronic
1151796227 17:76347725-76347747 GGCAGGGCAGGAGTGGCCACGGG + Intronic
1151977001 17:77488819-77488841 GTAGAGGCAGCAGTGGACGCGGG - Exonic
1152106270 17:78330993-78331015 GGAGGGGCAGGAGGCTCCACTGG - Intergenic
1152132314 17:78484827-78484849 GGAGGGGAAGGCGTGGCCCCGGG - Intronic
1152438027 17:80288091-80288113 GGAGAGGCAGGAGTGGCCACAGG + Exonic
1152576508 17:81143585-81143607 GGAGGACCAGGTGTGGCCACGGG - Intronic
1152718889 17:81912899-81912921 GGTGGGGCAGCAGTGGCCCCAGG + Intronic
1152776649 17:82206089-82206111 GGAGCGGCAGGAGAAGCCGCCGG + Intronic
1152887413 17:82860607-82860629 GGAGAGCCAGCAGACGCCACTGG + Intronic
1152930735 17:83108198-83108220 GCAGGGGGTGGAGTGGCCACTGG + Intergenic
1153332840 18:3891431-3891453 GTAGAGCCAAGAGTGGACACCGG - Intronic
1153832503 18:8935783-8935805 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1154411370 18:14143843-14143865 AGTGAGGCAGGAGGGGCCACAGG + Intergenic
1155772835 18:29723517-29723539 GGAGAGGCACCAGTGGGAACCGG + Intergenic
1155856415 18:30839518-30839540 GGAGAGGCGCGAGTGGGAACCGG - Intergenic
1155931321 18:31711937-31711959 GGAGAGGCAGGAGAGAACAGAGG - Intergenic
1156352884 18:36316017-36316039 GGAGAAGGAGGGGTGGCCCCGGG + Intronic
1156757898 18:40550901-40550923 GGAGAAGAATGAGTGCCCACTGG - Intergenic
1159656146 18:71031699-71031721 GGAGAGGCACGAGTGGGAACCGG - Intergenic
1159925889 18:74268715-74268737 GGAGAGACAGGAAGTGCCACTGG + Intronic
1160158845 18:76455566-76455588 GGAGAGCCAGGAGAAGCCCCTGG + Intronic
1160513095 18:79463447-79463469 GGAGAGGCCGGTATGGACACGGG - Intronic
1160535663 18:79590072-79590094 GGAGAGGCTGAAGTTGCCAGAGG - Intergenic
1160767354 19:814359-814381 GGGGAGGCATGAGTGCCCACAGG - Intronic
1160944109 19:1633226-1633248 GGAGAAGCAGGAGCGGGCCCTGG + Intronic
1160980801 19:1815764-1815786 GGAGGGGCAGGAGGGGCTGCGGG + Exonic
1161091725 19:2363607-2363629 GGGGAGGCAGGACTGGACCCTGG + Intergenic
1161093770 19:2376998-2377020 CGAGAAACTGGAGTGGCCACGGG + Intergenic
1161221602 19:3120481-3120503 GGAGGGGCAGGGGTGGCCGGTGG + Intronic
1161318662 19:3631181-3631203 GGAGCAGCAGGTGTGGCCCCGGG - Exonic
1161366641 19:3883692-3883714 GGGGAGGCAGAATTGTCCACAGG + Intronic
1161430021 19:4226070-4226092 GGGGAGGCAGGAGTGGGAGCGGG + Intergenic
1161439817 19:4284620-4284642 GCAGGGGCAGGATTGGCCACAGG - Intronic
1161567853 19:5013335-5013357 GGAGAGGCCTGGGTGGCCCCTGG + Intronic
1161923389 19:7283230-7283252 GGAGAGGCAGCAGTGGCTCTCGG - Intronic
1162105260 19:8366345-8366367 GGCGGGGTAGGGGTGGCCACCGG - Intronic
1162263019 19:9547822-9547844 GGAGAGGCATGGGTGGGAACCGG + Intergenic
1162564475 19:11437681-11437703 GAAGAGGCAGGAGGCGGCACTGG + Intronic
1162958903 19:14114668-14114690 GGAGAGGGAGCAGCGGCCCCAGG - Intronic
1163290549 19:16376729-16376751 GAAGGGGCCAGAGTGGCCACAGG + Intronic
1163323669 19:16589149-16589171 GGAGGGACAGGAGTGGGCACAGG + Intronic
1163608704 19:18290251-18290273 AGAAGGGCAGGAGGGGCCACAGG + Intergenic
1163616456 19:18331810-18331832 GGAGAGGCAGGAGTGGGGAGTGG + Intergenic
1163861844 19:19747009-19747031 GGAGGGGCAGGAATGTCCCCGGG - Intergenic
1164038595 19:21474804-21474826 GGAGAGGAGGGCGTGGCCTCCGG + Intronic
1164310420 19:24041314-24041336 GGAGAGGCATGAGCGGGAACCGG + Intronic
1164534627 19:29076066-29076088 GGAGAGGCAGAGGAGGCCACAGG - Intergenic
1164621752 19:29700126-29700148 GGAGGGGCTGCAGTGGACACTGG + Intronic
1164646245 19:29860543-29860565 GGAGAGGAAAGGGTGGCCATGGG - Intergenic
1164676063 19:30102372-30102394 GTAGAGGCAGGTGTGGCCTGGGG + Intergenic
1164720462 19:30428258-30428280 GGAGAGGCAGGAGCAGACGCAGG + Intronic
1165187153 19:34032090-34032112 GGAGAGGCTGGAGAGGATACAGG + Intergenic
1165244470 19:34490345-34490367 GGAGAGGCAGGAGAGAGCAGGGG - Intronic
1165786243 19:38463600-38463622 GGAGAGGAGGGAGGGACCACAGG + Intronic
1165930424 19:39354799-39354821 GATGAGGTTGGAGTGGCCACAGG + Intronic
1166044970 19:40224648-40224670 GGAGGGGCAAGGGTGACCACGGG + Intronic
1166072083 19:40393708-40393730 GGAGGGGCAGGAGTGGGTATAGG - Intergenic
1166441934 19:42823071-42823093 GGACAGAAAGGAGTGACCACAGG + Intronic
1166461358 19:42991353-42991375 GGACAGAAAGGAGTGACCACCGG + Intronic
1166568913 19:43781043-43781065 GGAGGGGCAGGGGAGGCCCCAGG + Exonic
1166791302 19:45400273-45400295 GGAGGGGCAGCTGTGGTCACTGG + Intronic
1167303841 19:48695879-48695901 GGGGAGGGAGGAGGGGCTACGGG + Intergenic
1167638559 19:50668301-50668323 GGCGAGGCGGGGGTGGGCACGGG + Exonic
1167767833 19:51496021-51496043 GCAGAGGCAGGAGTGGCTGGAGG + Intronic
1168073946 19:53968820-53968842 GTGGAGAAAGGAGTGGCCACAGG + Intronic
1168315401 19:55482725-55482747 GGTGAGGCCGCACTGGCCACAGG - Exonic
1168353106 19:55687600-55687622 GGAAGAGCAGGAGGGGCCACAGG + Intronic
925099010 2:1229955-1229977 GGAGAGGCACGAGCGGGAACGGG - Intronic
925106901 2:1299473-1299495 GGAGAGCCAGGTGTGGAGACAGG - Intronic
925134486 2:1516661-1516683 GGAGAGCCAGCAGGGGACACAGG - Intronic
925537847 2:4935674-4935696 GGAGAGGCACGAGCGGGAACCGG - Intergenic
925714789 2:6773842-6773864 GAGGAGGCAGGAATGCCCACAGG - Intergenic
925734442 2:6948982-6949004 GGAGAGGCACCAGTGGGCTCTGG + Intronic
927645867 2:24876647-24876669 GGCCAGGCAGGTGTGGCCGCAGG + Intronic
927904822 2:26848650-26848672 GGACCGGCAGGACTGGCCCCCGG - Intronic
928064821 2:28152564-28152586 GGGGAGACAGGAATGGGCACAGG + Intronic
928311391 2:30213440-30213462 GGAGAGGTGGAGGTGGCCACAGG + Intergenic
928395351 2:30939478-30939500 GGAGAGGCAGGCAAGGCCATGGG + Intronic
928427158 2:31188858-31188880 GGGGAAGCAGGAGTGGCTTCAGG - Intronic
928437186 2:31262135-31262157 GGGGAGGCAGAAGTGCACACGGG + Intronic
928863914 2:35895276-35895298 CCAGAGGCAGTGGTGGCCACAGG - Intergenic
928904518 2:36355911-36355933 GGAGAGGGAGGAGGCGCCGCCGG + Exonic
929791213 2:45024459-45024481 GGAGAGGCAGGAGGGGACACTGG - Intergenic
929832450 2:45358084-45358106 TTGGAGGCAGGAGTGGCAACAGG + Intergenic
929979898 2:46668648-46668670 GGAGAAGCAGGAGTCGCAAGGGG - Intergenic
930037974 2:47099732-47099754 GGAGAGGCGCGAGTGGGAACCGG + Intronic
930485467 2:52006799-52006821 GGAGAGGCACCAGTGGGAACCGG + Intergenic
930785176 2:55264854-55264876 GCAGAGGCAATAGAGGCCACGGG - Intronic
930946618 2:57084142-57084164 GGAGAGGATGGAGAGGCAACTGG - Intergenic
931008704 2:57882385-57882407 GGGGAGGAATGAGTAGCCACCGG - Intergenic
932375764 2:71234527-71234549 AGAGAGGCAGGAGGGGTGACTGG + Intergenic
932486436 2:72086890-72086912 GGAGAGGCACGAGCGGGAACCGG + Intergenic
932615543 2:73228944-73228966 GGAGAGGAAGGAGCAGCCCCTGG + Exonic
932619966 2:73259485-73259507 GGAGAGGCTGCATTGGCCTCTGG + Intronic
932766711 2:74475139-74475161 GGAGAGGCAGGAGGGTCAAGTGG - Intronic
933506293 2:83181043-83181065 GGAGAGGCACGGGTGGGAACTGG + Intergenic
935263442 2:101374835-101374857 GCTGGGGGAGGAGTGGCCACAGG + Intronic
937286604 2:120758082-120758104 GGAGAGGCTGGTGTGGCCAGCGG + Intronic
938143164 2:128812762-128812784 GGAAAGCCAGCAGGGGCCACAGG + Intergenic
939053257 2:137331967-137331989 GGAGAGGCGCGAGTGGGAACCGG - Intronic
939085642 2:137715796-137715818 GGAGAGGCATGGGTGGGAACCGG + Intergenic
939218028 2:139265277-139265299 CAAGAGGCAGGAGTGGCCAAAGG - Intergenic
940939737 2:159545188-159545210 GGAGAGGCAGGAGAAGGGACTGG - Intronic
941705912 2:168657799-168657821 GGAGAGGCACGAGCGGGAACCGG - Intronic
942068669 2:172295788-172295810 GCTGAGGCAGGTGTGGCCCCGGG + Intergenic
942248292 2:174026604-174026626 GGAGAGAGAGGAGGGCCCACAGG - Intergenic
942317638 2:174709928-174709950 GGAGAGGCACGAGTGGGAACCGG - Intergenic
943401024 2:187410900-187410922 GGAGAGGTAGGTGGGGCCACAGG + Intronic
943501324 2:188693208-188693230 GGAGAGGTAGGGTTGGCCATGGG + Intergenic
944055158 2:195515679-195515701 GGAGAGGCGGGGGCGGCAACTGG + Intergenic
944843171 2:203643187-203643209 GGAGAGGCACGAGCGGGAACCGG - Intergenic
944933521 2:204545072-204545094 GGAGATGCAGGAGTGCCCCGAGG - Intergenic
945169427 2:206980340-206980362 GGGGAGAAAGGAGGGGCCACAGG - Intergenic
945727758 2:213494037-213494059 GGAAAAGCAGGAGTGGTCAGAGG - Intronic
945872872 2:215246093-215246115 GGAGAGGCACGAGCGGCAACCGG - Intergenic
946319680 2:218944907-218944929 AGAGAGGCAGGAGCTGCGACAGG + Intergenic
946358125 2:219201788-219201810 GGAGAGGCACGAGCGGGAACCGG - Intronic
947411951 2:229850718-229850740 GGAGAGGCGCGAGTGGGAACGGG + Intronic
948132235 2:235609256-235609278 GGAAAAGCAGATGTGGCCACTGG + Intronic
948372505 2:237498547-237498569 GGAGGGGCAGGCCTGGCCAAGGG - Intronic
948401227 2:237686955-237686977 GGAGTGGGAGGTGTGGTCACTGG + Intronic
948455968 2:238104811-238104833 GACGAGGGAGTAGTGGCCACGGG - Exonic
948480697 2:238248353-238248375 AGAGGGGCTGGAGTGCCCACAGG + Intronic
948718985 2:239884194-239884216 GGAGAGGCACGTGTGGCTTCTGG + Intergenic
948852886 2:240717108-240717130 GGAGAGGCTGGGGGGGCCAAGGG - Exonic
1168761666 20:353903-353925 GCAGAGGAAGGAGTGGGGACGGG - Exonic
1168924191 20:1566121-1566143 GGAGAGGGAGGACTGACCAAGGG - Intronic
1169058177 20:2641130-2641152 GCAGAGGGAGGAGTGGTCTCTGG - Exonic
1169493248 20:6089289-6089311 GCAGAGCCAGGTGTGGCCCCAGG - Intronic
1169814495 20:9641949-9641971 GGAGAGGCACAAGTGGGAACCGG - Intronic
1169849155 20:10031681-10031703 GGAGAGGCGCGAGCGGCAACCGG + Intronic
1171250053 20:23639842-23639864 GGAGAGGGAGCAGCAGCCACAGG + Intergenic
1171256154 20:23690357-23690379 GGAGAGGGAGCAGCAGCCACGGG + Intergenic
1171973470 20:31578921-31578943 AGAGAGGCAGGGGTGGTAACCGG - Intergenic
1172100966 20:32483738-32483760 TGAGAGGGAGGAGTGGGCACGGG + Intronic
1172234182 20:33358721-33358743 TGAGAGGGAGCAGTGTCCACAGG + Intergenic
1172767801 20:37360012-37360034 GAGGAGGCAGGACTGGCCATGGG - Intronic
1172772128 20:37388041-37388063 GGAGGTGCAGCAGAGGCCACAGG + Intronic
1173063977 20:39691766-39691788 GGAGAGGAGGCAGTGGGCACTGG + Intergenic
1173351901 20:42253160-42253182 GCAGAGTCAGGTGTGGCCACAGG + Intronic
1173475136 20:43353474-43353496 GGAGATGCAGGGGGAGCCACTGG - Intergenic
1173721111 20:45258995-45259017 GAAGAGACAGGAGCAGCCACAGG + Intergenic
1173911112 20:46671648-46671670 GGAGAAGCAGGATTGGGCAGAGG + Intronic
1173937590 20:46880842-46880864 GGAGAAGCAGGAGTGGAGCCTGG + Intergenic
1173957281 20:47043435-47043457 GGAGAAGCAGGACTGGCTTCAGG - Intronic
1174050381 20:47763512-47763534 GGAGAGGAAGAAGGGGCCAGAGG + Intronic
1174050697 20:47765428-47765450 GGAGAGGAAGAAGGGGCCAGAGG + Intronic
1174098666 20:48109808-48109830 AGAGAGGCAGCAGTGGTCACTGG - Intergenic
1174402340 20:50282794-50282816 GTAGAGGCAGGACTGGCTTCGGG - Intergenic
1175703533 20:61158038-61158060 GCAGAGGAAGGTGAGGCCACAGG - Intergenic
1176085877 20:63295221-63295243 GGTGGGGCAGGCGTGGCCTCGGG - Intronic
1176388482 21:6151452-6151474 GGGGCTGCAGAAGTGGCCACAGG + Intergenic
1176662522 21:9651614-9651636 GTAGAGGAAGGAGTGGTGACTGG + Intergenic
1176861687 21:14014574-14014596 AGTGAGGCAGGAGGGGCCACAGG - Intergenic
1176966658 21:15218936-15218958 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1177700746 21:24636103-24636125 AGTGAGTCAGGAGTGCCCACTGG - Intergenic
1178326960 21:31654195-31654217 GGAGAGGCATGAGCGGGAACAGG + Intergenic
1178398703 21:32265331-32265353 GGAGAGGCACGAGCGGGAACTGG + Intergenic
1178981686 21:37269816-37269838 GGGGAGAGAGGAGTAGCCACGGG - Intergenic
1179734990 21:43386796-43386818 GGGGCTGCAGAAGTGGCCACAGG - Intergenic
1179991340 21:44949619-44949641 GAAGCGGCAGGAGTGGCTGCCGG - Intronic
1180038698 21:45264706-45264728 GGCGAGGGAGGGGTGGCCAGTGG + Exonic
1180635682 22:17261322-17261344 GGAGAGTCACTAGTGGGCACTGG - Intergenic
1180752807 22:18136785-18136807 GGAGTGGCAGGAGCAGCCAGCGG + Intronic
1180755063 22:18155525-18155547 GGAGAGGCAGGGGCGGGAACTGG + Intronic
1181120383 22:20664076-20664098 AGTCAGGCAGTAGTGGCCACAGG - Intergenic
1181235209 22:21444354-21444376 GGAGAGGCAGGGCTGGCTGCAGG + Intronic
1181474976 22:23162424-23162446 GGAGAGGCAGCAGTGGGCACAGG - Exonic
1181618936 22:24074532-24074554 GCAGAGGCAGGAAGAGCCACAGG + Intronic
1181688296 22:24543936-24543958 GCAGAAGCAGTGGTGGCCACTGG + Exonic
1181756733 22:25029374-25029396 GGGGACGCAGGGGTGGCCAGGGG - Exonic
1182914035 22:34011270-34011292 GGAGAGGCAGGAGGTGCTAGTGG - Intergenic
1183103546 22:35598662-35598684 GGAGAGGAAGTAGAGCCCACAGG + Intergenic
1183485192 22:38084611-38084633 GGAGAGGTGGCAGTGGCCAAGGG - Intergenic
1183548754 22:38469048-38469070 GCAGAGGCAGGAGTGAGCTCAGG + Intronic
1183599704 22:38832851-38832873 GGAGAGGTACTAATGGCCACGGG + Intronic
1183617887 22:38956155-38956177 GGAGATGCAGGAGACGCCCCAGG + Intronic
1183980568 22:41537458-41537480 GGAGAGGGAGCAGTGGGAACAGG + Intronic
1184533521 22:45071512-45071534 GGAGAGGGAGCAGGGGGCACCGG + Intergenic
1184561215 22:45263937-45263959 GCGGAGGCAGGGGTGGCCGCAGG - Intergenic
1184791533 22:46703338-46703360 GGAGAGGCAGGAGGGGCAGGTGG - Intronic
1184852490 22:47128379-47128401 GGAGAATCAGGAGTGGCTAGGGG + Intronic
1184859460 22:47165032-47165054 GGAGAGGCTGGAGTGAGCACCGG - Intronic
1184983347 22:48112200-48112222 GGAGAGGCAGTAGCTGCCAATGG + Intergenic
1185294447 22:50046331-50046353 GGAGAGGGAGGAGCGGCTGCAGG + Intronic
1185366844 22:50440772-50440794 AGTGAGGCAGGAGGGGTCACAGG - Intronic
1185392098 22:50567903-50567925 GGTGAGGCAGGTGTGGTCAGGGG - Intergenic
950005496 3:9688616-9688638 GGACAGGCAGGATTGGGAACGGG + Intronic
950127909 3:10521742-10521764 GGAGAGCCAGAGGTGGCCATGGG + Intronic
950181849 3:10918944-10918966 GGTGAGGCTGGTGGGGCCACAGG - Intronic
950374154 3:12556743-12556765 GGAGAGGCTGGAGTTTCCCCAGG + Intronic
950386523 3:12664388-12664410 GGCCAGCCAGGAGTGGCCAGAGG + Intergenic
950513405 3:13447557-13447579 GGAGAGGCACGAGCGGGAACCGG - Intergenic
950680257 3:14580267-14580289 GGAAGGGCAGGAGAGGCCATGGG - Intergenic
951024895 3:17818045-17818067 GGAGAGGCATGGGTGGGAACCGG - Intronic
951687782 3:25363761-25363783 TGAGAGGAATGAGGGGCCACAGG - Intronic
951822474 3:26827716-26827738 CCACAGGCAGGAGTGGTCACCGG - Intergenic
952207910 3:31198874-31198896 GGTGGGGCAGGAGTGGTGACTGG - Intergenic
952475865 3:33710041-33710063 GATGGGGCAGGATTGGCCACGGG + Intronic
952698045 3:36293449-36293471 GGAGAGACAGGAGCAGCAACAGG - Intergenic
953089785 3:39713316-39713338 GGAGAGACAGGAGAGGGAACCGG + Intergenic
953307648 3:41844525-41844547 GGAGAGGCGCGAGCGGCAACCGG - Intronic
953350263 3:42210059-42210081 GGAGATGCAGGAGCCGCCAGCGG + Intronic
953856259 3:46501436-46501458 GGAAAGGCAGGATGTGCCACCGG + Intergenic
953887231 3:46721781-46721803 TGAGATACAGGAATGGCCACGGG + Intronic
954392503 3:50274988-50275010 TGAGAGGGAGGAGGGGCGACGGG - Intronic
954415482 3:50391318-50391340 GGGGAGGGGGGAGTGGCCATTGG - Intronic
954633856 3:52061065-52061087 GGAAAGGCAGGGGTGGACCCCGG - Intergenic
954649219 3:52150053-52150075 GGAGAGGCAGGGGGAGCAACTGG + Intronic
954680438 3:52343131-52343153 GCAGAGCCTGGAGTGGCCTCAGG + Intronic
955318959 3:57960730-57960752 GAAGAGGGAGGAGTTGCTACTGG - Intergenic
957293851 3:78311129-78311151 GGAGCAGCAGGAGGGGCCTCTGG - Intergenic
957419710 3:79951731-79951753 GGAGAGGCGGGAGCGGGAACCGG - Intergenic
957966020 3:87323244-87323266 GTGGAGGCAGGAGTGGAGACAGG - Intergenic
958548625 3:95588897-95588919 GGAGAGGCATGGGTGGGAACAGG - Intergenic
958671460 3:97210841-97210863 GGATTGGCAGGAGTGGGGACTGG + Intronic
958859198 3:99424888-99424910 GGAGGGTTAGGAGTGGCCATTGG - Intergenic
960116864 3:113903649-113903671 GAGGAGGCAGGAGTGGCCAATGG + Intronic
960425107 3:117497180-117497202 GGAGAAGCAGGAGGGGAGACAGG - Intergenic
960693217 3:120369245-120369267 GGAGAGGCAGGTGAGGTCACAGG - Intergenic
960761710 3:121078914-121078936 GGAGAGGCATAAGTGGGAACTGG - Intronic
960948944 3:122986545-122986567 AGAGAGGCAGGAGGGGGCACTGG + Intronic
961140763 3:124553941-124553963 GAAGAGGCAGTAGTAGCAACTGG - Intronic
961201457 3:125048970-125048992 GAAGAGGCAGGAGTTGACACAGG + Intronic
961315321 3:126031503-126031525 GGGGAGGCAGCAGTGACCAAAGG - Intronic
961660046 3:128463693-128463715 GCAGAGGCAGGATCAGCCACGGG + Exonic
961819449 3:129567817-129567839 GGAGAGGCAGGTCAGGCCTCTGG + Intronic
962383801 3:134916720-134916742 GGAGAGGCACGGGTGGGAACAGG - Intronic
962398789 3:135039789-135039811 GGAGAGGCACGAGCGGGAACCGG - Intronic
962434753 3:135356121-135356143 GGAGAGGTAACAGTGGCCACGGG + Intergenic
962500042 3:135981992-135982014 GGAGAGGCAAGAGTGGAAGCAGG + Intronic
963503953 3:146161451-146161473 GGAGAGGGAGGAGGAGCCGCCGG + Intronic
964139259 3:153378696-153378718 GGAGAGGCACGAGCGGGAACCGG - Intergenic
964393819 3:156224285-156224307 GGAGAGGCACGGGTGGAAACCGG - Intronic
965109465 3:164402272-164402294 GGAGAGGCGTGAGTGGCAACTGG - Intergenic
967815572 3:193795675-193795697 GAAGAGGCAGGAGTGGACACAGG - Intergenic
968480374 4:830507-830529 GGAGAGGCAGGGCTGGCCCAGGG + Intergenic
968568468 4:1327218-1327240 GTAGAGGAAGCAGTGGCCTCAGG + Intronic
968716125 4:2161270-2161292 GGAGAGGCACGAGCGGGAACCGG + Intronic
968845826 4:3041109-3041131 GGAGATGCAGGAATGCCAACGGG - Intergenic
968874321 4:3257327-3257349 GCAGAGGCAGGTGTGGCAGCAGG + Intronic
969259633 4:6025212-6025234 GCAGAGGTGGGGGTGGCCACAGG - Intergenic
969296932 4:6275781-6275803 GAAGAGTCAGGAGTGGCCCCAGG - Intronic
969362316 4:6672724-6672746 GGAGAGGCGCGAGCGGGCACCGG + Intergenic
969453577 4:7288475-7288497 GGAGAGGCAGAACTGGCGTCTGG + Intronic
969591424 4:8123825-8123847 GGAGGGGCAGGAGGTGGCACGGG + Intronic
969692210 4:8709995-8710017 GAAGAGGCAGGAGAGGACTCAGG + Intergenic
969868921 4:10092925-10092947 GGACAGGCAGGAGTGTGGACCGG - Intronic
970762885 4:19513233-19513255 GCAGAGGAAGGAATGGCCATAGG - Intergenic
971298892 4:25425688-25425710 GGCAAGGCAGGAGGGGCCAAAGG - Intergenic
971476967 4:27081434-27081456 CTAGAGGGAGGAGTGGCCAGTGG - Intergenic
971553076 4:27978695-27978717 GGAGAGGCATGAGTGGGAACCGG - Intergenic
971635080 4:29047528-29047550 GGAGAGGCACGGGTGGAAACTGG + Intergenic
971639786 4:29117353-29117375 GGAGAGGCGGGAGCGGGAACCGG + Intergenic
971722542 4:30264690-30264712 GGAGAGGCATGAGCGGGAACTGG + Intergenic
971811917 4:31438652-31438674 GGAGAGGCACGAGCGGGAACCGG + Intergenic
972170575 4:36340940-36340962 GGAGAAGCAGGGGAGGCCAGGGG + Intronic
972505815 4:39718862-39718884 GGAGAGGCACGGGTGGGAACCGG - Intronic
973037062 4:45420163-45420185 GGAGAGGCACGAGTGGGAACCGG + Intergenic
973144292 4:46805150-46805172 GGAGAGGCATGGGTGGGAACTGG - Intronic
973889710 4:55356908-55356930 GGTGAGGCAGGAGTGGGGAGAGG - Intronic
974019047 4:56676845-56676867 TCAGAGACAGGACTGGCCACAGG + Intronic
974299281 4:60042578-60042600 GGAGAGGCATGGGTGGGAACCGG - Intergenic
976646902 4:87396306-87396328 GGAGAGGCACGAGTGGGAACAGG - Intergenic
977885128 4:102245043-102245065 GGAGAGGCATGGGTGGGAACTGG + Intergenic
978997911 4:115179026-115179048 CCAGAGGCAGCAGTGGCCACCGG - Intergenic
979424788 4:120551097-120551119 GGAGAGGCACGAGCGGGAACCGG - Intergenic
979678646 4:123435729-123435751 GGAGAGGCGTGGGTGGCAACCGG - Intergenic
980227939 4:130012781-130012803 GGAGAGGCGCGAGCGGCAACCGG + Intergenic
981751152 4:148093279-148093301 GGAGAGCGGGGAGTGGCCGCTGG - Intronic
983134915 4:164068396-164068418 GGAGAGGCATGGGTGGGAACCGG + Intronic
984104635 4:175529785-175529807 GGAGAGGAAACAGTGGGCACTGG + Intergenic
984873158 4:184345132-184345154 GCAGATGCAGGGGTGGCCAGTGG + Intergenic
985203213 4:187505631-187505653 GGAGAGGCGGGAGCGGAAACTGG + Intergenic
985366359 4:189236308-189236330 GGAGAGGCACGAGCGGGAACCGG + Intergenic
985403910 4:189617005-189617027 GGAGAGGCGGGAGCGGAAACTGG - Intergenic
985412873 4:189704911-189704933 GTAGAGGAAGGAGTGGTGACTGG - Intergenic
985527549 5:414943-414965 AGAGGGGCAGCAGTGCCCACAGG + Intronic
985653858 5:1119885-1119907 GGGGAGGCAGAAGCAGCCACAGG - Intergenic
985665399 5:1179418-1179440 GGAGAGGCAGGCGGGGCCTGTGG + Intergenic
985691016 5:1312382-1312404 GGAGAAGCAGACGTTGCCACAGG + Intergenic
985770411 5:1806427-1806449 GGCCAGGCAGGTGAGGCCACAGG - Intronic
985868631 5:2536428-2536450 GGAGAGGCCAGGGAGGCCACTGG - Intergenic
985873572 5:2577923-2577945 GGCCATGCACGAGTGGCCACTGG - Intergenic
985899955 5:2780579-2780601 GGAGAGGCTGGAGTGGAAACAGG - Intergenic
985975628 5:3417473-3417495 GGAGAGTCTGGAGGGGCCTCCGG - Intergenic
986151964 5:5137786-5137808 GGAGAGGCACGAGCGGGAACCGG + Intergenic
986782992 5:11084352-11084374 GGGGAGGCAGATGTGTCCACAGG - Intronic
987050738 5:14144693-14144715 GGAGAGGCGCGGGTGGCGACCGG + Intronic
987198601 5:15552221-15552243 GGACAGGAAGAAGTGGCCAATGG - Intronic
987315258 5:16717952-16717974 GGAGAGGCACGAGCGGGAACCGG + Intronic
987365004 5:17140929-17140951 GGAGAGGCACGAGCGGGAACCGG + Intronic
987532824 5:19143130-19143152 GGAGAGGCATGAGCGGGAACCGG - Intergenic
988155093 5:27439810-27439832 GGAGAGGCATGAGCGGGAACAGG - Intergenic
988915934 5:35893227-35893249 GGAGAGGCACGAGCGGGAACTGG - Intergenic
989003165 5:36782582-36782604 GGAGAGGCGCGAGTGGGAACCGG + Intergenic
989052715 5:37337050-37337072 GGACAGGCAGGAGTGAGCAGAGG + Intronic
989642790 5:43599689-43599711 GGAGAGGGAGGTTTGGACACAGG + Intergenic
989956811 5:50369439-50369461 GGAGAGGCGCGAGTGGGAACTGG + Intergenic
990979911 5:61593033-61593055 GGTGAGGCAGAGGTGGCCTCTGG + Intergenic
991214910 5:64150081-64150103 GGAGAGGCACGGGTGGGAACCGG + Intergenic
991440125 5:66638391-66638413 AGAGAGGCAGGAGTGACCCAGGG - Intronic
991482793 5:67101218-67101240 GGAGAGGCAGGATTGGACAGAGG + Intronic
991973814 5:72166339-72166361 GGAGAGAAAGAAGTGGCCACTGG + Intronic
993031828 5:82714681-82714703 GGAGAGGCACCAGTGGGAACCGG + Intergenic
994229929 5:97301149-97301171 GGAGAGGCGTGAGTGGGAACCGG + Intergenic
994251556 5:97542238-97542260 GGAGAGGCATGGGTGGGAACCGG - Intergenic
994507070 5:100656764-100656786 GGAGAGGCAGGAGCGGGATCCGG + Intergenic
995568639 5:113457145-113457167 GGAGAGGCGGGAGCGGGAACCGG + Intronic
995658332 5:114451973-114451995 AGAGAAGCAGCAGTGGCAACAGG - Intronic
996141425 5:119913805-119913827 TGGAAGGCAGGAGGGGCCACAGG - Intergenic
996992696 5:129655157-129655179 GAAGAGGCAGGTTTGGGCACAGG + Intronic
997359305 5:133284442-133284464 GGAGGGGAAGGAGTGGGCAGAGG + Intronic
997391416 5:133520280-133520302 GGAAGGGAAGGAGTGGGCACAGG - Intronic
997465261 5:134083835-134083857 AGTGAGGGAAGAGTGGCCACGGG + Intergenic
997592980 5:135086889-135086911 GGAGGGGCAGGACTTGCCAATGG + Intronic
997716347 5:136046029-136046051 ACAGAGGCAGGAATGGACACTGG - Intronic
999539406 5:152555295-152555317 GGAGGGGCAGAAGGGGCCATGGG + Intergenic
1000364620 5:160479237-160479259 GCAGAGGCAGGAGTGGAATCAGG + Intergenic
1000891857 5:166810555-166810577 GGAGAGGCACCAGCGGCAACGGG - Intergenic
1001403747 5:171461500-171461522 GGAGGGCAAGGGGTGGCCACAGG - Intergenic
1001717554 5:173828999-173829021 GGAGAGGCAGGAGAGGATGCTGG - Intergenic
1001780986 5:174368924-174368946 GGAAAGGAAGGAGTGGCAGCAGG - Intergenic
1001841508 5:174880664-174880686 GGAGAGGCATGGGTGGGAACTGG + Intergenic
1002429442 5:179194507-179194529 GGAGAGGCGGGTGTGGCCAGGGG + Intronic
1002948682 6:1787011-1787033 GGAGAGTCATGAGTGGCTGCGGG - Intronic
1003060689 6:2860145-2860167 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1003069633 6:2935810-2935832 GGAGAGGCACGGGTGGGAACCGG + Intergenic
1003121829 6:3324379-3324401 GGACAGGAAGGAATGGCGACAGG - Intronic
1003224500 6:4191648-4191670 GGAGAGGCATGGGTGGGAACCGG - Intergenic
1003378901 6:5604458-5604480 GGAAAGGCAGGGGTGGCAGCAGG + Intronic
1003717589 6:8665713-8665735 GGAGAGGCGCGAGTGGGAACCGG + Intergenic
1004308608 6:14523637-14523659 GGAGAGGGAGAAGGGGCCGCTGG - Intergenic
1005759769 6:28957846-28957868 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1005986853 6:30881154-30881176 GGGAGGGCAGGAGTGGGCACTGG + Intronic
1006088509 6:31614153-31614175 GGAGATGCTGGAGTGGCCTCTGG - Intergenic
1006370625 6:33641636-33641658 GGAGAGGCAGCAGGGGCCAACGG - Intronic
1006440863 6:34052770-34052792 GGAAGGGCAGGGGTGGGCACTGG + Intronic
1006477793 6:34269027-34269049 GGAGAGGCAAGAGCGGGAACCGG + Intergenic
1006479033 6:34277033-34277055 GGAGAAGCAGGAGGTGCCATAGG - Intergenic
1006577647 6:35057870-35057892 GGACAGCCAGGAGAGGACACAGG - Intronic
1006611961 6:35299424-35299446 GGAGAGGTCTCAGTGGCCACAGG - Intronic
1006748934 6:36364591-36364613 GGAGAGGCACGAGCGGGAACTGG - Intronic
1006902928 6:37514722-37514744 GGAGAGCCAGGACTTGCCCCAGG + Intergenic
1007169431 6:39852315-39852337 GGAGAAGGTGAAGTGGCCACAGG - Intronic
1007324241 6:41048205-41048227 GCAGTGCCAGGAGTAGCCACTGG + Intronic
1007471552 6:42094009-42094031 GGAGAGGGAGAAGTGAGCACAGG + Intergenic
1007612645 6:43160465-43160487 AGAGTGGCTGGAGTGGGCACTGG - Intronic
1007699666 6:43759239-43759261 GGAGAGGCCAGAGTGGACAGAGG + Intergenic
1007748336 6:44056862-44056884 GGAGATGTAGGAGTGGACAGAGG - Intergenic
1008051239 6:46902257-46902279 GGGGAGGAGGGAGTGGCCACTGG + Intronic
1008887851 6:56450561-56450583 AGACAGGAAGGAGAGGCCACAGG + Intergenic
1010269312 6:73903160-73903182 GGAGAGGCACGGGTGGGAACTGG + Intergenic
1011143653 6:84189369-84189391 GGAGAGGCACGAGCGGGAACCGG + Intronic
1011560077 6:88605252-88605274 GGAGAGACAAGAGTGGAAACTGG + Intergenic
1011585798 6:88923979-88924001 GGAGAGGAAGGGGAAGCCACCGG + Intronic
1012224298 6:96687098-96687120 GGAGAGGCAGCATTTCCCACAGG - Intergenic
1013081522 6:106817121-106817143 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1013955383 6:115834959-115834981 GGAGAGGCATGAGCGGGAACCGG - Intergenic
1013960056 6:115889106-115889128 GGAGAGGCGCGAGTGGGAACCGG + Intergenic
1014012035 6:116487100-116487122 GAAGATTCAGTAGTGGCCACAGG + Intergenic
1015024552 6:128519070-128519092 GGAGACGCAGTGGTGGCCAGAGG - Intronic
1016814058 6:148287383-148287405 GGAGAGAGAGCAGGGGCCACTGG - Intronic
1016859095 6:148698940-148698962 GGAGAGGCGCGGGTGGCAACCGG - Intergenic
1017801358 6:157899060-157899082 GGAGAAGGAGGAGAGCCCACAGG + Intronic
1017801367 6:157899090-157899112 GGAGAAGGAGGAGAGCCCACAGG + Intronic
1018071477 6:160167895-160167917 GGAAAGGCTGGCGTGGGCACAGG + Intergenic
1018397277 6:163388052-163388074 GGAGAGCCACGAGTGTCCAGAGG - Intergenic
1018611452 6:165651534-165651556 GGAGAGGTAGGAGAGGCACCAGG + Intronic
1018919747 6:168163327-168163349 GGAGAGGCAAACGTGGCTACTGG + Intergenic
1019136493 6:169911831-169911853 GCAGAGGAGGGAGTGGCCCCTGG + Intergenic
1019200633 6:170311527-170311549 AGACAGGCAGGTGTGGCCAGAGG - Intronic
1019275015 7:171623-171645 GAGGAGGCCGGGGTGGCCACAGG - Intergenic
1019366643 7:636545-636567 GGTGGGGCAGGAGGGGCCCCAGG - Intronic
1019408902 7:898197-898219 CCAGAGGCAGGAGTGGCCCTGGG - Exonic
1019723806 7:2589477-2589499 GGAGAGGCAGGAGTGGAGGGCGG + Intronic
1019819796 7:3234093-3234115 GGAGCGGCAGGGGTGGCAAGAGG + Intergenic
1019938628 7:4272189-4272211 GGAGAGGCAGGGGTGACCTCTGG + Intergenic
1020006022 7:4784171-4784193 GGACAGGCAGGAGTGGGCGGAGG - Intronic
1020662231 7:10995886-10995908 GGAGAGGCACGGGTGGGAACCGG - Intronic
1021094633 7:16521850-16521872 GGAGGAGAAGGAGTGCCCACTGG + Intronic
1021211880 7:17863673-17863695 AGCCAGGCAGCAGTGGCCACAGG + Intronic
1021324085 7:19245485-19245507 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1021513849 7:21461604-21461626 GGAGAGGCACGGGTGGCAACCGG - Intronic
1021588840 7:22239185-22239207 GTGGAGGCAGGAGTGGTCACTGG + Intronic
1021968009 7:25941104-25941126 GGAAGGGCAGGAGTGGCTATTGG + Intergenic
1022096762 7:27146017-27146039 GGAGAGGCTGGAGTGGAGGCGGG - Intronic
1024022914 7:45387512-45387534 GGAGCAGCAGGAGGGACCACAGG + Intergenic
1024794309 7:53003942-53003964 GGAGAGGCACGGGTGGGAACCGG + Intergenic
1024905834 7:54378321-54378343 GGCTAGGCAGGAGTGGACATAGG - Intergenic
1025021155 7:55481226-55481248 AGTGAGCCAGGAGGGGCCACAGG + Intronic
1026501217 7:70944855-70944877 GGAGAGGAAGGGGTGACCAAAGG - Intergenic
1026931154 7:74223696-74223718 GGAGAGAGAGGAGTGGGCACGGG - Intronic
1027564079 7:79768323-79768345 GGAGAGGCGGGAGCGGGAACCGG - Intergenic
1028852560 7:95552825-95552847 GGAGAGGCGGGAGCGGGAACCGG - Intergenic
1028989464 7:97034341-97034363 GGAGAGGCACGGGTGGGAACCGG + Intergenic
1029286384 7:99468746-99468768 CAAAAGGCAGGAGTGGCCAGTGG + Intergenic
1029619554 7:101681355-101681377 GTGGAGGCAGAAGTGCCCACTGG + Intergenic
1029841949 7:103374409-103374431 GGAGTGGCAGGAGTGGCATTGGG + Exonic
1030085239 7:105810290-105810312 GGAGAGCCAGGACTGGGCCCAGG - Intronic
1030506713 7:110433781-110433803 GGAGAGCCAGGAGGAGCCTCTGG - Intergenic
1030600021 7:111582302-111582324 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1031597297 7:123662835-123662857 GGAGGAGGAGGTGTGGCCACAGG - Exonic
1031773702 7:125879549-125879571 CGAGATGCAGGGGTGGCCAGGGG - Intergenic
1032478265 7:132226958-132226980 GGAAAGACAGGAGTGGGCAGAGG - Intronic
1033664143 7:143424756-143424778 GGAGAGGCGCGAGTGGGAACCGG - Intergenic
1033755455 7:144395540-144395562 GGAGAGACAGGAGATGGCACAGG - Intergenic
1034091005 7:148363818-148363840 GGAGAGGCACGAGCGGGAACTGG + Intronic
1034154978 7:148949082-148949104 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1034269034 7:149794814-149794836 GCTGCGGCAGGAGTGGCCATGGG - Intergenic
1034288473 7:149907451-149907473 AGAGAGGCAAGAGAGGCCCCAGG - Intergenic
1034656081 7:152730635-152730657 GGAGAGGCGAGAGCGGCAACCGG - Intergenic
1034662659 7:152785529-152785551 AGAGAGGCAAGAGGGGCCCCAGG + Intronic
1035031921 7:155866374-155866396 TGAGCTGCAGGTGTGGCCACAGG + Intergenic
1035043958 7:155952057-155952079 GGAGAGGCAGCTGTGTCCAGAGG + Intergenic
1035331371 7:158099109-158099131 GGGGAGGAAGGAGAGGCCTCCGG - Intronic
1035644246 8:1206243-1206265 GGAGCTGCAGGAGTGCCCAGTGG - Intergenic
1036505124 8:9347897-9347919 GGAAACTCAGGAGTGCCCACAGG + Intergenic
1036528298 8:9556060-9556082 GGAGAGGCTGGGGTGGTCCCCGG - Exonic
1036617584 8:10400478-10400500 GGAGAAGCAGGAGTGAGAACAGG + Intronic
1036756736 8:11476216-11476238 GGAGAGGAAGGAGAGGCCAGAGG + Intergenic
1037558923 8:20054792-20054814 GGAGAGGCACGAGTGGGAACTGG + Intergenic
1037580320 8:20241629-20241651 GGAGAGGCAGGAGTCAACAATGG + Intergenic
1037815998 8:22112154-22112176 GGAGAGGGAGGGCTGGCCACAGG + Intergenic
1038327777 8:26585630-26585652 GGAGAGGCAGAAACGCCCACAGG - Intronic
1038442982 8:27584615-27584637 GGAGAGGCAGGAGCTGCGATGGG + Intergenic
1038561379 8:28583592-28583614 GGAGAGGCAGAAGTGCCCTGTGG + Intergenic
1038576584 8:28709488-28709510 GGAGAGACAGGAGGCGCGACAGG - Intronic
1038847634 8:31244465-31244487 GGAGAGGCGGGAGCGGGAACCGG - Intergenic
1038938131 8:32275168-32275190 GGAGAGGAAGGAGGCTCCACAGG - Intronic
1039475657 8:37838097-37838119 GGAGAGGTAGGAGAGGCCAAAGG - Intronic
1039513957 8:38115764-38115786 GTAGAGGCAGGAGAGGGCACAGG - Intronic
1039546498 8:38414644-38414666 GGGGAGGTTGGAGTGGCCCCAGG + Intronic
1039637261 8:39180115-39180137 GGAGAGGCGCGAGTGGGAACTGG + Intronic
1040059573 8:43093023-43093045 GGAGGGGCAGGACTGGGCAAAGG - Intergenic
1040415302 8:47189525-47189547 GGAGTGCGAGGAGTGGCCCCGGG + Intergenic
1041918893 8:63161990-63162012 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1042320579 8:67471066-67471088 GAAGAGGCAGAAGTGGTCAGAGG - Intronic
1042460263 8:69057697-69057719 TCAGAGGCAGCAGTAGCCACTGG + Intergenic
1044633517 8:94300693-94300715 GGAGAGGCGCGAGTGGGAACCGG - Intergenic
1044880699 8:96719445-96719467 GGAGAGGCGCGAGTGGCAACCGG - Intronic
1045823695 8:106371976-106371998 GGAGAGGCAGCAGTCAGCACTGG - Intronic
1046265431 8:111823641-111823663 GGAGAGGCGCGAGTGGGAACCGG - Intergenic
1046822059 8:118644481-118644503 GGAGAGGCTGGAGAGGCTGCAGG - Intergenic
1046885995 8:119367831-119367853 GGAGAAGCAGGTGGAGCCACGGG + Intergenic
1047770838 8:128028509-128028531 GGAGAGGCAGGACTGGGCAAAGG + Intergenic
1048186918 8:132250016-132250038 GGAGAGGCACGGGTGGGAACTGG - Intronic
1048268743 8:133011111-133011133 TGAGGGGCAGGATTGGCCAGAGG + Intronic
1049239085 8:141527842-141527864 GGTGTGGTAGGAGTGGGCACTGG - Intergenic
1049408168 8:142460830-142460852 TGAGGGCCAGGAGTGGCCATGGG - Intronic
1049431855 8:142569054-142569076 TGAGAGCCGGGAGTGGCCCCAGG - Intergenic
1049540057 8:143204511-143204533 GGAGAGACAGGAGTGGCCCTAGG + Intergenic
1049574599 8:143384444-143384466 GGAGAGGCATGTGTGGGCAGGGG - Intergenic
1049663976 8:143834964-143834986 GGAGGGGCTGCAGTGGCCAGAGG + Exonic
1049778263 8:144416139-144416161 GGAGAGGCAGGCCTGGCCAGGGG + Intronic
1049786675 8:144454208-144454230 TGAGAGCCAGGATAGGCCACTGG - Intronic
1050313844 9:4380985-4381007 GGACAGGCAGAAATGGCCAGAGG + Intergenic
1051305129 9:15700401-15700423 GGAGAGGCGTGAGTGGGAACCGG - Intronic
1051722871 9:20056762-20056784 AGATAGGCAGATGTGGCCACAGG + Intergenic
1052192948 9:25678887-25678909 GGAGAGCCAGGTGTTTCCACCGG - Intergenic
1052342149 9:27374541-27374563 GGTGAGGCAGGAGTGGGAAGAGG + Intronic
1053141156 9:35683469-35683491 GGAGAGGCAGGAGCTGCCATGGG - Intronic
1053280066 9:36814693-36814715 GGAGAGGCAGGAAGGGACACAGG + Intergenic
1056305724 9:85289048-85289070 GGAGAGGCACGAGCGGGAACTGG + Intergenic
1056489659 9:87092935-87092957 AGAGAGACAGGAATGGCCACAGG - Intergenic
1056747038 9:89311586-89311608 GGTGAGGGAAGAGTGCCCACCGG + Intronic
1056771436 9:89480778-89480800 GGAGAGGCAGGAGCGGGAACAGG - Intronic
1057552936 9:96065339-96065361 GGACAGGCGGGAGTGGCTAGAGG + Intergenic
1057627367 9:96689359-96689381 TGATAGACAGGATTGGCCACAGG + Intergenic
1057628678 9:96701277-96701299 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1058101055 9:100917935-100917957 CAAGAGGCAGGAGTTACCACAGG - Intergenic
1058286528 9:103186914-103186936 GGAGAGGCACGAGTGGGAACTGG + Intergenic
1058391368 9:104498941-104498963 GGTGAGGCAAGTGTGGGCACAGG - Intergenic
1058648565 9:107153805-107153827 GAAGAGCAGGGAGTGGCCACGGG - Intergenic
1058650268 9:107169135-107169157 GGAGAGACAGGAGTGGCCTCTGG - Intergenic
1058815920 9:108682812-108682834 GGAGAGGGAGGTGGGGCCAAGGG - Intergenic
1059383348 9:113945651-113945673 GGAGACCCAGGACTGGCCACAGG - Intronic
1059991602 9:119870642-119870664 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1060515997 9:124266131-124266153 GGAGAGGCAGGTGGGGCCGGTGG + Intronic
1060895664 9:127215624-127215646 GGAGAGGCAGGAGGGCTCAGGGG - Intronic
1060922169 9:127428876-127428898 GGAGAGGAAGGAATGGCTGCTGG + Exonic
1060975415 9:127762230-127762252 GGAGAGCCTGGAGAGGCCAGAGG + Intronic
1061043024 9:128150614-128150636 GGAGCGGGAGGAGGGGACACTGG + Intronic
1061233394 9:129328084-129328106 GGGGAAGTGGGAGTGGCCACGGG - Intergenic
1061576603 9:131511249-131511271 CCAGAGGGAGGAGTGGCCATCGG + Intronic
1062221104 9:135415659-135415681 GGAGTGTCAGGTGAGGCCACTGG - Intergenic
1062443552 9:136584058-136584080 GCAGAGGCCGTACTGGCCACCGG + Intergenic
1062540352 9:137039278-137039300 GGAGCTGGAGGAGAGGCCACGGG - Intergenic
1062718821 9:138024184-138024206 GGAGAGGCAGAAGGGCCCAAGGG + Intronic
1185456572 X:313774-313796 GGAGAGGCAGAAGGAGCCCCTGG + Intronic
1185462110 X:338227-338249 GCGGAGGCTGGAATGGCCACGGG + Intronic
1186196293 X:7113095-7113117 GGAGGGGCAGGACTGCCTACAGG + Intronic
1186555213 X:10550806-10550828 GGAGAGGAAGGGGCTGCCACTGG - Intronic
1187304567 X:18083803-18083825 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1188328481 X:28837598-28837620 GGAGAAGCAGGAGAGGCTTCTGG + Intronic
1188589849 X:31820499-31820521 GGAGGGGCTGCAGTGGACACGGG + Intronic
1189292504 X:39896123-39896145 AGAGGGGCAGGACTGGCCTCAGG + Intergenic
1190247106 X:48697563-48697585 GGAGAGGAAAGCGTGGGCACAGG + Intronic
1190437273 X:50437933-50437955 GAAGAGGCAGTAGTGGCTACTGG + Intronic
1192583880 X:72305604-72305626 GGACAGGCAGGAAGGGGCACGGG + Intronic
1192869700 X:75173958-75173980 GGAGAGGCGGGAGCGGGAACCGG - Intergenic
1192870606 X:75179878-75179900 GGAGAGGCGGGAGCGGGAACCGG - Intergenic
1193040233 X:76997002-76997024 GGAGAGGCACGAGTGGGAACTGG - Intergenic
1193804087 X:85972718-85972740 GGAGAGGCACGAGCGGGAACTGG - Intronic
1194071638 X:89331390-89331412 GGAGAGGCACGAGTGGGAACCGG - Intergenic
1194166303 X:90521335-90521357 GGAGAGGCGCGAGTGGGAACCGG + Intergenic
1194650866 X:96512612-96512634 GGAGAGGCATGAGCGGGAACCGG - Intergenic
1194811166 X:98389012-98389034 AGAGAAGCAGGATTGGTCACAGG + Intergenic
1195259394 X:103117419-103117441 GGAGAGGCGCGAGTGGGAACCGG - Intergenic
1195574638 X:106436260-106436282 GGAGAGGCATGAAAGGGCACAGG + Intergenic
1196014590 X:110924045-110924067 GGAGTGGCAAGAATGGCCAGAGG + Intergenic
1196264428 X:113625836-113625858 AGCCAGGCAGCAGTGGCCACAGG - Intergenic
1196319576 X:114270920-114270942 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1196662557 X:118283064-118283086 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1196714570 X:118798956-118798978 GGAGAGGCACGAGCGGGAACCGG + Intergenic
1196728976 X:118922345-118922367 GGAGAGGCACGAGCGGGAACCGG - Intergenic
1196775464 X:119333595-119333617 GGAGAGGCACCAGTGGGAACCGG + Intergenic
1196937008 X:120740248-120740270 GGAGAGTCATGACTGGGCACGGG + Intergenic
1197134961 X:123050300-123050322 GGGGAGGCTGGAGAGGCCTCAGG + Intergenic
1197969581 X:132101179-132101201 GGAGGCGCAGGCATGGCCACAGG - Intronic
1198186142 X:134255835-134255857 GGAGATGCAGGAGTGGGCCCAGG - Intergenic
1198321479 X:135521840-135521862 GGGGAGGAAGGAGGGGCCAGAGG - Intronic
1199724144 X:150565520-150565542 GTTGAGGCAGGAGTGGGGACTGG + Intergenic
1199833064 X:151563140-151563162 GGAGAGGCACCGGTGGCAACTGG - Intergenic
1200057232 X:153468091-153468113 GCAGAGGCAGGAGACGCCTCTGG + Intronic
1200081559 X:153579302-153579324 GAAGATGCAGAAGTGGCCAGTGG + Intronic
1200423603 Y:2998736-2998758 GGAGAGGCGCGAGTGGGAACCGG - Intergenic
1200512574 Y:4099116-4099138 GGAGAGGCGCGAGTGGGAACCGG + Intergenic
1200725880 Y:6667119-6667141 GGAGAGGCACGAGCGGGAACTGG - Intergenic
1201479894 Y:14428090-14428112 GGAGAGACAGGAGCGGGAACCGG + Intergenic
1201572992 Y:15433844-15433866 GGAGAGGCATGAGTGGGAACTGG + Intergenic
1202086444 Y:21141678-21141700 TTGGAGGCAGGAGGGGCCACTGG - Intergenic