ID: 1152439234

View in Genome Browser
Species Human (GRCh38)
Location 17:80295289-80295311
Sequence CCCAGGCTGCACCGCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7269
Summary {0: 1, 1: 0, 2: 11, 3: 249, 4: 7008}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152439234_1152439240 -8 Left 1152439234 17:80295289-80295311 CCCACACTGCGGTGCAGCCTGGG 0: 1
1: 0
2: 11
3: 249
4: 7008
Right 1152439240 17:80295304-80295326 AGCCTGGGTGGGTTTCAGGCCGG 0: 1
1: 1
2: 4
3: 30
4: 295
1152439234_1152439242 -3 Left 1152439234 17:80295289-80295311 CCCACACTGCGGTGCAGCCTGGG 0: 1
1: 0
2: 11
3: 249
4: 7008
Right 1152439242 17:80295309-80295331 GGGTGGGTTTCAGGCCGGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152439234 Original CRISPR CCCAGGCTGCACCGCAGTGT GGG (reversed) Intronic