ID: 1152442526

View in Genome Browser
Species Human (GRCh38)
Location 17:80317747-80317769
Sequence ACACTACTGTCCATAGACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152442526_1152442528 -7 Left 1152442526 17:80317747-80317769 CCGCCGTCTATGGACAGTAGTGT 0: 1
1: 0
2: 0
3: 13
4: 71
Right 1152442528 17:80317763-80317785 GTAGTGTGTTATCAGCTCAGTGG 0: 3
1: 31
2: 35
3: 38
4: 164
1152442526_1152442529 -6 Left 1152442526 17:80317747-80317769 CCGCCGTCTATGGACAGTAGTGT 0: 1
1: 0
2: 0
3: 13
4: 71
Right 1152442529 17:80317764-80317786 TAGTGTGTTATCAGCTCAGTGGG 0: 3
1: 31
2: 58
3: 66
4: 208
1152442526_1152442530 15 Left 1152442526 17:80317747-80317769 CCGCCGTCTATGGACAGTAGTGT 0: 1
1: 0
2: 0
3: 13
4: 71
Right 1152442530 17:80317785-80317807 GGTCCCTTGCCTTGTTGCCTAGG 0: 1
1: 0
2: 6
3: 74
4: 924
1152442526_1152442534 19 Left 1152442526 17:80317747-80317769 CCGCCGTCTATGGACAGTAGTGT 0: 1
1: 0
2: 0
3: 13
4: 71
Right 1152442534 17:80317789-80317811 CCTTGCCTTGTTGCCTAGGGTGG 0: 1
1: 1
2: 29
3: 846
4: 10312
1152442526_1152442531 16 Left 1152442526 17:80317747-80317769 CCGCCGTCTATGGACAGTAGTGT 0: 1
1: 0
2: 0
3: 13
4: 71
Right 1152442531 17:80317786-80317808 GTCCCTTGCCTTGTTGCCTAGGG 0: 1
1: 0
2: 0
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152442526 Original CRISPR ACACTACTGTCCATAGACGG CGG (reversed) Intronic
902519225 1:17006536-17006558 ACACTACTGGCCAAGCACGGTGG - Intronic
907576883 1:55534667-55534689 AAACTACTGCCCATAAATGGAGG + Intergenic
908100661 1:60787796-60787818 ACACACCTGTCCTTAGAAGGTGG - Intergenic
910112911 1:83701343-83701365 ACACTTCTGCCCATGGAGGGAGG + Intergenic
916900255 1:169214882-169214904 ACACTGCTGTCCACAGGTGGTGG - Intronic
918058349 1:181042033-181042055 ACACAACTGTCTAAAGAAGGAGG - Intronic
924493399 1:244562294-244562316 ACAGTAGTGTGCATAGACAGTGG - Intronic
1066746783 10:38609257-38609279 ACACTACTGGCCAGGCACGGTGG + Intergenic
1069841708 10:71343896-71343918 ACACTTCTGCCCATGGACTGAGG - Intronic
1069964754 10:72105240-72105262 ACGCTGCTGTCCACAGACAGCGG + Intronic
1076994469 11:291386-291408 ACACTACTGTCTACAAACGCTGG - Intronic
1078986774 11:16605453-16605475 AAAGTACTGTCCAAAAACGGGGG + Intronic
1079221061 11:18561552-18561574 ACACTACTGGCCAGGCACGGTGG + Intronic
1080604367 11:33852655-33852677 ACACCACTGTCCACAGACACCGG - Intergenic
1083460255 11:62806391-62806413 ACACTAATCTCCCTGGACGGTGG + Intergenic
1087102221 11:94376716-94376738 GCAATACTGCACATAGACGGTGG + Intergenic
1088835517 11:113575155-113575177 ACACTACTGTCATTAAAAGGAGG - Intergenic
1089806704 11:121097170-121097192 ACACAAGTGACCATAGACTGAGG - Intergenic
1114908679 14:27164240-27164262 ACACTACGGTCCATGGACAGTGG + Intergenic
1118160452 14:63284322-63284344 ACATTACTGTGCATAGAAGTAGG - Intronic
1129019535 15:72503945-72503967 ACACCGCTGTCCACAGACGGTGG - Intronic
1132813031 16:1810777-1810799 ACACCACTGCCCATAGCGGGTGG - Intronic
1136736278 16:32470376-32470398 ACACTACTGGCCAGGCACGGTGG - Intergenic
1140796266 16:78441247-78441269 ACACCACTGTCAAGAGAAGGGGG - Intronic
1203016792 16_KI270728v1_random:359198-359220 ACACTACTGGCCAGGCACGGTGG + Intergenic
1203035127 16_KI270728v1_random:632356-632378 ACACTACTGGCCAGGCACGGTGG + Intergenic
1146182487 17:30707082-30707104 AGACAGCTGTCCATAGAAGGCGG + Intergenic
1151990493 17:77571122-77571144 CCACTTCTGTCCAGAGAGGGTGG - Intergenic
1152442526 17:80317747-80317769 ACACTACTGTCCATAGACGGCGG - Intronic
1155310414 18:24517849-24517871 AAACCACTGTCCATGGACAGCGG - Intergenic
1156651495 18:39231996-39232018 ACCCTACTGACCATAGGTGGAGG + Intergenic
1156946877 18:42844234-42844256 ACACTGCTATCCATGGATGGTGG - Intronic
1160192571 18:76726247-76726269 CCACTACTGTCCATGGCCTGGGG + Intergenic
929345836 2:40883702-40883724 ACCCAAATGTCCATTGACGGTGG + Intergenic
930532976 2:52613575-52613597 ACACTTCTGCCCATGGACTGAGG - Intergenic
932437732 2:71712557-71712579 AGCCTACTGTCCACAGACAGGGG + Intergenic
934138058 2:89017167-89017189 ACAATATTGTTCATAGACAGAGG + Intergenic
934187443 2:89759503-89759525 ACACTACTGGCCAGGCACGGTGG - Intergenic
934231186 2:90183459-90183481 ACAATATTGTTCATAGACAGAGG - Intergenic
934309187 2:91848436-91848458 ACACTACTGGCCAGGCACGGTGG + Intergenic
935194424 2:100803966-100803988 CCTCTGCTGTCCATAGATGGAGG - Intergenic
942083898 2:172427352-172427374 ACAATTCTGTCCACAGAGGGCGG + Intronic
946008145 2:216542925-216542947 ACACAACTGTCCATGGACAAAGG + Intronic
946235947 2:218324270-218324292 ACATTACTGTCCCTAAACTGGGG - Intronic
946811578 2:223531013-223531035 ACACTGCTGTCCACAGATGGTGG + Intergenic
1174520696 20:51128241-51128263 ATACTACTGTCCAAAGCCAGTGG - Intergenic
1175580504 20:60095259-60095281 AGAATGCTGTCCATAGATGGGGG + Intergenic
1177962046 21:27679722-27679744 ACACCACTGTCCATGGACAGTGG - Intergenic
1178919663 21:36730222-36730244 AAACAACTGTCCACAGACAGAGG + Intronic
1180536272 22:16395549-16395571 ACACTACTGGCCAGGCACGGTGG + Intergenic
950254435 3:11492934-11492956 ACGCTGCTGTCCATGGACGGCGG - Intronic
962114109 3:132483866-132483888 ATACTGCAGTCCATAGACAGTGG + Intronic
962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG + Intronic
967262420 3:187656477-187656499 ACACTCTTGACCATAGACTGAGG - Intergenic
979188151 4:117824543-117824565 ACACTGCTGTCCATGGGCAGCGG + Intergenic
984229285 4:177075011-177075033 ACACCGCTGTCCACAGATGGCGG - Intergenic
984695350 4:182773969-182773991 AAACTACTGTACTTAGATGGCGG - Intronic
986658741 5:10040508-10040530 ACACAAATGTCCATTGATGGAGG - Intergenic
988603548 5:32661426-32661448 ACACCACTGTCCACAGGTGGTGG - Intergenic
989158215 5:38364994-38365016 ACTCTACTGGCCTTAGAGGGAGG - Intronic
990293500 5:54378754-54378776 ACACTGCTGTCCATGGATGGTGG + Intergenic
1001715654 5:173813670-173813692 ACCCTACTGTCCATCAACAGTGG + Intergenic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1009461931 6:63923735-63923757 ACACTGGGGACCATAGACGGGGG - Intronic
1016084342 6:139894586-139894608 ATACCACTGTCCATGGACGGTGG - Intergenic
1021134789 7:16952248-16952270 ACACTACTGTTCAAAGCCTGAGG + Intergenic
1025164110 7:56695696-56695718 ACAGAACTGGCCATAGACTGTGG - Intergenic
1030524831 7:110640412-110640434 ACAGTACTTTCCATAGGGGGAGG - Intergenic
1034324025 7:150213220-150213242 ATACTCATGTCCATAGATGGTGG + Intergenic
1034769171 7:153756016-153756038 ATACTCATGTCCATAGATGGTGG - Intergenic
1041131920 8:54710427-54710449 ACACTGCTGTCTACAGACGGTGG - Intergenic
1043951315 8:86311927-86311949 ACACCACTGTCCATGGATAGCGG + Intronic
1046709950 8:117499529-117499551 ACACTGCTGTCCAAAAATGGTGG + Intergenic
1050237583 9:3597896-3597918 ATGCTGCTGTCCATGGACGGTGG + Intergenic
1051222480 9:14864408-14864430 ACAGTAGTGTCCATAGTCAGTGG - Intronic
1051996087 9:23219728-23219750 ACACTGCTGTCTGCAGACGGTGG - Intergenic
1056429854 9:86516526-86516548 ACACTACTGTTCATGGACAGTGG + Intergenic
1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG + Intergenic
1188526965 X:31097491-31097513 ACTCCACTGTCCACGGACGGTGG - Intergenic
1188607666 X:32052630-32052652 ACACTACTGTCCACAGATATTGG + Intronic
1189297038 X:39926229-39926251 ACACTTCAGCCCATAGAAGGAGG + Intergenic
1191772346 X:64774880-64774902 ACACTCCTGTCCAAATACTGTGG + Intergenic
1198330679 X:135619615-135619637 ACACTGCTGTCCATGGATGGTGG - Intergenic
1198336247 X:135669381-135669403 ACACTGCTGTCCATGGATGGTGG + Intergenic
1200112436 X:153748401-153748423 ACACTACTGGCCAGGCACGGTGG + Intergenic