ID: 1152442800

View in Genome Browser
Species Human (GRCh38)
Location 17:80319311-80319333
Sequence AGGTGAACAATCTCTCCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152442797_1152442800 -5 Left 1152442797 17:80319293-80319315 CCGTGAGCTCAGCCTGCCAGGTG 0: 1
1: 0
2: 2
3: 77
4: 348
Right 1152442800 17:80319311-80319333 AGGTGAACAATCTCTCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 116
1152442794_1152442800 25 Left 1152442794 17:80319263-80319285 CCAAGACCTTCGAGAAATGCATC 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1152442800 17:80319311-80319333 AGGTGAACAATCTCTCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 116
1152442795_1152442800 19 Left 1152442795 17:80319269-80319291 CCTTCGAGAAATGCATCATTGAA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1152442800 17:80319311-80319333 AGGTGAACAATCTCTCCTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152442800 Original CRISPR AGGTGAACAATCTCTCCTCC TGG Exonic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
902066641 1:13693640-13693662 AGGTGAACCATCTCTTACCCTGG - Intergenic
902898011 1:19492755-19492777 AGGAGAGCAATGTCTCTTCCTGG - Intergenic
905306924 1:37026073-37026095 GGGAGTACAATCTCACCTCCTGG - Intronic
906012350 1:42540025-42540047 AGGTTATCACTATCTCCTCCTGG + Intronic
906380667 1:45330412-45330434 GGGTGAACATTCTCCACTCCAGG - Intronic
907330962 1:53671351-53671373 AGGTGAAAATACTCTCCTCCTGG + Intronic
910909210 1:92215920-92215942 AGTTGATCATTCCCTCCTCCTGG - Intergenic
913010364 1:114677413-114677435 AGTGGAGCAAACTCTCCTCCTGG - Exonic
914698537 1:150108652-150108674 AGGTGATCACTTGCTCCTCCTGG - Intronic
917055598 1:170978226-170978248 AGGAGACCAATCTTTCCACCTGG - Intronic
919984001 1:202660090-202660112 AGGTGACAGCTCTCTCCTCCTGG + Intronic
921300663 1:213748765-213748787 AGGTGATATATCTCTCCTCTTGG - Intergenic
921997314 1:221435105-221435127 AGGTGAAAAATATCTCTACCAGG - Intergenic
1064564776 10:16628917-16628939 AAGTGAAAAATCTCTCTTCATGG - Intronic
1065784681 10:29202351-29202373 AGGTAAACAACCTCCCCTCGAGG + Intergenic
1066137806 10:32468281-32468303 AGGTGAACAATCTCTACAAGGGG - Intronic
1068021912 10:51595713-51595735 AGTTGAATCATCACTCCTCCAGG + Intronic
1069925557 10:71848158-71848180 AGGTTAACAATGTTTCCTTCGGG + Intronic
1071303150 10:84272981-84273003 ATGTGAACATTCTCTGCTTCAGG - Intergenic
1072562380 10:96587467-96587489 AGTTTAACAATCTCTCCTAACGG - Intergenic
1075283143 10:121158543-121158565 AAGTGAAAAATAGCTCCTCCTGG + Intergenic
1080572533 11:33569174-33569196 AGGTTTAGAATCTCTACTCCTGG - Intronic
1082489480 11:53512703-53512725 AGGTGAACAATCCCTGCTGATGG + Intergenic
1084622592 11:70283339-70283361 AGGTGAACAGTCTCTCTTCTAGG - Intronic
1085349091 11:75786798-75786820 TGGTGAAAAATCTCTGGTCCAGG - Intronic
1086135227 11:83437951-83437973 AGGTGAACATTCTGTCCCTCAGG + Intergenic
1089469125 11:118706694-118706716 AGGCGAACAAGCTCTTCACCTGG - Intergenic
1089696888 11:120221369-120221391 AAGAGAACAATCTCAACTCCTGG + Intronic
1089983067 11:122788645-122788667 AGGTGGAGTGTCTCTCCTCCAGG - Intronic
1097593490 12:61600164-61600186 AAGTGAGAAATCTCTCCTCCTGG + Intergenic
1103685608 12:122729950-122729972 CGGTGAACACTATCTCCACCCGG - Exonic
1107077741 13:36341871-36341893 ATATTAACAATCTCTTCTCCTGG + Intronic
1109469154 13:62781717-62781739 AGATGAATGATCTGTCCTCCTGG + Intergenic
1112683932 13:101800943-101800965 AGTTTAACAGTCCCTCCTCCAGG - Intronic
1113372973 13:109739425-109739447 AGGTGAACACACTTTTCTCCTGG + Intergenic
1118655656 14:67945543-67945565 AGTGGCGCAATCTCTCCTCCCGG + Intronic
1120833342 14:89017541-89017563 AGGCAAACAAACTCTGCTCCAGG + Intergenic
1121148430 14:91607007-91607029 AGGTTAAGAAGCTCTGCTCCAGG - Intronic
1125953550 15:43774357-43774379 AGGTGACAACTCTCTGCTCCTGG - Intronic
1127615017 15:60675877-60675899 AGTTGAACAATCTCTCCGTGAGG + Intronic
1132162524 15:99556285-99556307 GGGTGAAGAATCTTTCCTGCTGG + Intergenic
1148556485 17:48581774-48581796 AGGAGAAAAATCTCTGCTCTTGG - Intronic
1149019900 17:51950854-51950876 AGGTGAAAAATCTCTGCGCTCGG - Intronic
1149458298 17:56807353-56807375 AGGTGGTCCATCTCTGCTCCTGG - Intronic
1149949872 17:60974138-60974160 AGTTTAACAATCTCTGCTTCAGG + Intronic
1152442800 17:80319311-80319333 AGGTGAACAATCTCTCCTCCTGG + Exonic
1156617980 18:38810631-38810653 GGGTGAATAATCATTCCTCCTGG - Intergenic
1157099462 18:44716175-44716197 AAGTGGACAACCTTTCCTCCGGG - Intronic
1157104082 18:44756788-44756810 AGGAGAGCAAGCTCTCCTCCTGG - Intronic
1159083107 18:63757716-63757738 AGTTGACCAATCTCTGCTCTTGG + Intronic
1160041563 18:75350169-75350191 AGATGAATATTTTCTCCTCCTGG + Intergenic
1162948298 19:14056660-14056682 ACGTGAACAAACTGTCTTCCAGG + Exonic
1164156976 19:22602956-22602978 AGCTGAACACCCTCTCCTCCAGG + Intergenic
1165749392 19:38251088-38251110 AGATGGAGAATCACTCCTCCCGG - Intronic
926071287 2:9894722-9894744 AGGTTCCCATTCTCTCCTCCTGG - Intronic
929667495 2:43844509-43844531 AGGAGAACAATCTATCCTGGAGG - Exonic
931674586 2:64681850-64681872 AGGTGACCACTCCCTCCTCTAGG + Intronic
932445420 2:71777980-71778002 AGGTGCAGATTCCCTCCTCCAGG - Intergenic
933022835 2:77216615-77216637 AGGTGAACAAGCTATCTTCAGGG - Intronic
933952499 2:87342626-87342648 GGGTGAACAAGCTCTCGGCCCGG + Intergenic
935471341 2:103464234-103464256 AGCTGCACACTGTCTCCTCCTGG + Intergenic
936000368 2:108821868-108821890 AGTGGCACAATCTCACCTCCTGG - Intronic
937000982 2:118467379-118467401 GGGTGAACAATCTATCCCCTGGG + Intergenic
937465976 2:122133478-122133500 AGGAAAACAATCTGTCCTCAGGG + Intergenic
938734393 2:134173258-134173280 AACTGAACAATCTGTCTTCCAGG + Intronic
940113923 2:150186710-150186732 AGGTACAGAATCTATCCTCCAGG - Intergenic
940446882 2:153786591-153786613 AGGAGATCAGTCTCTCCTCCTGG + Intergenic
941849635 2:170166319-170166341 AGGTGAACAATGTGTTTTCCAGG + Intergenic
942967687 2:181916661-181916683 ACGAGAAAAATCTCTCCTCTTGG - Intronic
945218294 2:207458805-207458827 AGGTAAAGAATGTCACCTCCTGG + Intergenic
947112441 2:226733264-226733286 AGGTTAAAAATCTCTACTTCTGG + Exonic
947192466 2:227521601-227521623 AGGAGAACAGTCTTTCCTACAGG - Intronic
1168832328 20:853377-853399 AGGTCAGCAATCTCTCCTTCCGG - Intronic
1168924847 20:1571049-1571071 AGGTGAGCAATTTCTACCCCCGG - Exonic
1170347776 20:15406058-15406080 AGGGGAAAAACCTCTCCTCTCGG - Intronic
1172837937 20:37884973-37884995 AGGTGCCCATTCCCTCCTCCTGG + Intergenic
1173970556 20:47148963-47148985 GGCTGAACAGTATCTCCTCCTGG - Intronic
1174082914 20:47983520-47983542 AGGTGGACATTCGCTCCTCCTGG + Intergenic
1174133042 20:48359464-48359486 AGGTGGACATTCGCTCCTCCTGG - Intergenic
1179461224 21:41536597-41536619 AAGGAAACATTCTCTCCTCCAGG - Intergenic
1180168073 21:46040388-46040410 GAGTGACCAACCTCTCCTCCTGG + Intergenic
1182906223 22:33938792-33938814 ATTTGAAAAATCTCTCCTCCAGG - Intergenic
1184438165 22:44492923-44492945 AGTTGAAGAATCCCACCTCCTGG + Exonic
949935510 3:9112687-9112709 AGCTGAGCTATTTCTCCTCCTGG + Intronic
950248782 3:11446770-11446792 AGGTGAACCAGCTATGCTCCAGG + Intronic
950340423 3:12239444-12239466 TGGTGCACAATCTCTCCGTCTGG - Intergenic
951487656 3:23231938-23231960 AGGTGAACAAGAACTCATCCAGG - Intronic
957981692 3:87519448-87519470 AGGAGACCAATTTTTCCTCCTGG - Intergenic
959502483 3:107122498-107122520 AGGTTAACAATCTCTGCTCTAGG + Intergenic
959575265 3:107926927-107926949 ACGTGAACAAACTTTCCTCTGGG - Intergenic
961112721 3:124298692-124298714 AGGGGAAAAAGCTCTCCTGCTGG - Intronic
962932568 3:140051555-140051577 GTGTGAATAATCCCTCCTCCTGG - Intronic
963241433 3:143006828-143006850 AGTTTAACAATCTCTCCTATAGG - Intronic
966152322 3:176877967-176877989 AGGAGAACAGTCTCTACTCCTGG + Intergenic
971001981 4:22333595-22333617 AGGATAACAATCTCTTCTTCTGG - Intergenic
983354692 4:166641297-166641319 GGAAGAACAATCTGTCCTCCGGG + Intergenic
983880475 4:172926579-172926601 AGGTGGCCAATCTTTCCTGCAGG - Intronic
985122885 4:186661522-186661544 AGGTGAACAAGAACTCATCCAGG + Intronic
990827789 5:59921890-59921912 AGGTGAGCAATCTCTGTACCTGG + Intronic
993018653 5:82564467-82564489 AGGAGACCAAACTCTCCTCCTGG + Intergenic
993225521 5:85164585-85164607 AGGTGACCAGTGTCTCCTTCTGG - Intergenic
993518665 5:88870553-88870575 AGTTGAACACTTTCTCTTCCAGG - Intronic
995192742 5:109336280-109336302 AGATGCACAATGTCTCCTTCAGG - Exonic
995265165 5:110151686-110151708 AGGTGAACAATCACACTACCTGG + Intergenic
1002457605 5:179354439-179354461 AAGTGAACACTCTCGCCTCTGGG - Intergenic
1003442691 6:6158565-6158587 AGGTGAAGAAGCCCACCTCCTGG + Intronic
1004816824 6:19320152-19320174 AGGTGAAAAAACTCATCTCCTGG - Intergenic
1007709091 6:43810374-43810396 ATGTGAACAGTCACTTCTCCAGG + Intergenic
1007905744 6:45458888-45458910 AGGTCCACAATCTGTCCTCTTGG + Intronic
1008294173 6:49756421-49756443 AGGAGACCAGTCTCTCCTCCTGG - Intergenic
1011856400 6:91698163-91698185 ATGTTCACAATATCTCCTCCAGG + Intergenic
1020804653 7:12773691-12773713 AGGTGAAAGATCTCTCCTCAAGG + Intergenic
1021141428 7:17030228-17030250 AGGTGATCAATGTCTACTCTTGG - Intergenic
1024618053 7:51132571-51132593 AGGAAAACAAACTCTCCTTCGGG + Intronic
1031977387 7:128102697-128102719 TGGTGAAGAATCTCTGCTCTAGG + Intergenic
1033952918 7:146807641-146807663 AGCTGAGCCTTCTCTCCTCCAGG + Intronic
1039015392 8:33142542-33142564 AGTTGAACTATCTCTCTTCACGG + Intergenic
1041778045 8:61545940-61545962 AGGTACACCCTCTCTCCTCCTGG + Intronic
1044860609 8:96519708-96519730 AGTGGTGCAATCTCTCCTCCCGG + Intronic
1046010379 8:108539264-108539286 AGCTGAACACTGTCTGCTCCTGG - Intergenic
1047693409 8:127379517-127379539 AGATTAACAATCTGTCCTCCAGG - Intergenic
1049984195 9:933147-933169 AGGTGATCAATCCACCCTCCTGG + Intronic
1051822221 9:21181426-21181448 AGGAGAATAGTCTCTACTCCTGG + Intergenic
1051827253 9:21234082-21234104 GTGAGAACAGTCTCTCCTCCTGG + Intronic
1058542084 9:106022000-106022022 AGCTGAATTACCTCTCCTCCTGG - Intergenic
1059946100 9:119409857-119409879 AGGTCAACACACTCTCCACCAGG + Intergenic
1189561290 X:42193872-42193894 AGGTGACCAATCCCTCCCACTGG + Intergenic
1190321239 X:49180561-49180583 AGCTGACCACTCTCTCTTCCTGG + Intronic
1192770612 X:74185712-74185734 ATGTTACAAATCTCTCCTCCTGG - Intergenic
1192956458 X:76075905-76075927 AGGAGAAAAATCTCTCTTCCTGG + Intergenic
1193738372 X:85186789-85186811 AGGTGAACAATCACACTACCTGG - Intergenic
1199017482 X:142835681-142835703 GGGTGAACCATAACTCCTCCTGG + Intergenic
1200857251 Y:7952306-7952328 AGGTGATGTATCTCTCCTTCTGG - Intergenic