ID: 1152442912

View in Genome Browser
Species Human (GRCh38)
Location 17:80320063-80320085
Sequence GTTCCAGTTCAGCAGGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152442909_1152442912 -1 Left 1152442909 17:80320041-80320063 CCATACGGTACATCTGTCAAAAG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1152442912 17:80320063-80320085 GTTCCAGTTCAGCAGGTTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152442912 Original CRISPR GTTCCAGTTCAGCAGGTTTT GGG Intronic