ID: 1152445098

View in Genome Browser
Species Human (GRCh38)
Location 17:80337826-80337848
Sequence TTCACAGATTTCCCCAGACA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152445095_1152445098 6 Left 1152445095 17:80337797-80337819 CCCAAGAAAGTGACTTCTAACCT 0: 1
1: 0
2: 2
3: 28
4: 249
Right 1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG 0: 1
1: 0
2: 0
3: 28
4: 196
1152445094_1152445098 7 Left 1152445094 17:80337796-80337818 CCCCAAGAAAGTGACTTCTAACC 0: 1
1: 0
2: 2
3: 18
4: 194
Right 1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG 0: 1
1: 0
2: 0
3: 28
4: 196
1152445092_1152445098 25 Left 1152445092 17:80337778-80337800 CCAGTCCAGGTCTTCTGGCCCCA 0: 1
1: 0
2: 4
3: 30
4: 228
Right 1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG 0: 1
1: 0
2: 0
3: 28
4: 196
1152445096_1152445098 5 Left 1152445096 17:80337798-80337820 CCAAGAAAGTGACTTCTAACCTA 0: 1
1: 0
2: 0
3: 21
4: 180
Right 1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG 0: 1
1: 0
2: 0
3: 28
4: 196
1152445093_1152445098 20 Left 1152445093 17:80337783-80337805 CCAGGTCTTCTGGCCCCAAGAAA 0: 1
1: 0
2: 0
3: 32
4: 239
Right 1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG 0: 1
1: 0
2: 0
3: 28
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152445098 Original CRISPR TTCACAGATTTCCCCAGACA CGG Exonic
901922156 1:12545074-12545096 TTCCCACAGTTCCCCAGCCAGGG - Intergenic
902728691 1:18354138-18354160 TTCCCAGGTTTTTCCAGACAGGG - Intronic
903549014 1:24144580-24144602 TTCAGAGATTTCCCCAAAGCAGG - Intergenic
904744758 1:32703598-32703620 GTCAAAGACCTCCCCAGACAGGG - Intergenic
907301124 1:53486909-53486931 TTCACAGAGTTCACCAGCCATGG - Intergenic
907519742 1:55015409-55015431 TTCACAGATGACCCAGGACAAGG + Intergenic
908261666 1:62343889-62343911 GTCACAGACTGCCCAAGACATGG - Intergenic
911149371 1:94582588-94582610 ATCACAGATTGCCACAGATAGGG + Intergenic
913683890 1:121213557-121213579 CTCACTGATTTCCCCAGAAAGGG + Intronic
914035729 1:144001172-144001194 CTCACTGATTTCCCCAGAAAGGG + Intergenic
914153726 1:145066773-145066795 CTCACTGATTTCCCCAGAAAGGG - Intronic
915114303 1:153586246-153586268 ATAACAGGATTCCCCAGACAGGG + Intergenic
915743931 1:158141711-158141733 TCCACAGACTTCCCCAGATCTGG + Intergenic
916824254 1:168429064-168429086 TTCACAGCCTTCACCAGAGAGGG + Intergenic
919663608 1:200271409-200271431 TTCTCAGATTACCCTAGACTTGG - Intergenic
919948677 1:202341984-202342006 ATCACAATCTTCCCCAGACAGGG - Intergenic
920471194 1:206232049-206232071 CTCACTGATTTCCCCAGAAAGGG + Intronic
921108260 1:212005841-212005863 GTCACAGATATCCCAAGATAAGG - Intronic
922422681 1:225470291-225470313 GTCACAAAGTTCCCCAGACTGGG - Intergenic
922969249 1:229720582-229720604 TTCACATATTTGGCCAGGCATGG - Intergenic
923633075 1:235667816-235667838 TTCAAAAATTTAGCCAGACATGG - Intronic
923910564 1:238437437-238437459 TTCACAGAGTTCCATATACATGG - Intergenic
1063083317 10:2789561-2789583 CACACAGCTTTCCCCAGAGAGGG + Intergenic
1063591496 10:7399992-7400014 ATCACAGTTTTCTCCAGACCTGG - Intronic
1063988708 10:11536391-11536413 TAAACAGTTTTCCCCAGGCATGG - Intronic
1064639694 10:17403113-17403135 CCCACAGATTACCCCAAACAGGG + Intronic
1071926930 10:90420635-90420657 TTTACAGATTTCCACAGATGAGG + Intergenic
1072538214 10:96379087-96379109 TTCATTGATCTCCCCAGATAAGG - Exonic
1073513477 10:104057157-104057179 TTCACAGATATCCACAGCTACGG - Exonic
1073568466 10:104555856-104555878 TTCAATGATTTCTCCAGCCAGGG + Intergenic
1073708445 10:106013360-106013382 CTCACATATGTCCTCAGACATGG + Intergenic
1076190416 10:128479448-128479470 GGCACAGATTTCCCGAGACTTGG + Intergenic
1080546755 11:33326974-33326996 TTCTCAGATTTTCCCAGATTTGG - Intronic
1080619088 11:33971737-33971759 TTCACAGATTTGGACAGCCATGG + Intergenic
1082192220 11:49260132-49260154 TTTACTGAATTCTCCAGACAAGG + Intergenic
1082913973 11:58410621-58410643 TTCACTTATTTGGCCAGACATGG - Intergenic
1083623891 11:64062136-64062158 TTCCTGGATTTCCCCAGACAGGG + Intronic
1085755609 11:79198891-79198913 TGCTCTGATTTCCCCAGACCAGG - Intronic
1086673904 11:89580911-89580933 TTTACTGAATTCTCCAGACAAGG - Intergenic
1091035377 11:132228242-132228264 TTCACAGAATTCCCAGGGCATGG - Intronic
1091877376 12:3947063-3947085 GTCACAGAATACCCGAGACAGGG - Intergenic
1092413289 12:8270672-8270694 TTCACAGATTACACCTGAGAGGG - Intergenic
1092958789 12:13576121-13576143 TTCACAGATCTCACCAGGCTGGG - Intronic
1098797131 12:74903788-74903810 TTCACAGATTTCCATTGACAAGG - Intergenic
1101790896 12:107926773-107926795 TTCATACAATTCCCTAGACAAGG + Intergenic
1104929687 12:132331782-132331804 TGCAAAGGTTTCACCAGACATGG + Intergenic
1106548318 13:30749785-30749807 TTCATAGACTTCTCCAGAAAAGG + Intronic
1107731735 13:43355866-43355888 TCCACAGGGATCCCCAGACACGG - Intronic
1108184642 13:47876390-47876412 ATCAAGGATTTCCTCAGACAGGG + Intergenic
1109627897 13:65001315-65001337 TTCACAGATTTCCACTGGGAGGG + Intergenic
1110539170 13:76688556-76688578 TTCACAGATGTAACCAGAGATGG - Intergenic
1114192264 14:20448901-20448923 TTCAGGGATTTCCCCATATACGG - Intronic
1114674978 14:24434102-24434124 GTCACAGATTACCCAAGATATGG + Intronic
1118457766 14:65960250-65960272 TTCACAGCTTTCCCTGGACAAGG - Intronic
1119862187 14:77944150-77944172 TACAAAGATTTCCCTAGAAAGGG - Intergenic
1122529904 14:102418283-102418305 TTCACAGATATCCCCCGATGAGG - Intronic
1125014388 15:34917459-34917481 TTCACTTATTTCCCCAGATTTGG - Intronic
1128352128 15:66898126-66898148 GTCCCTGATATCCCCAGACATGG + Intergenic
1128749800 15:70140758-70140780 TTCTCAGGATGCCCCAGACAGGG - Intergenic
1130334074 15:82943781-82943803 GACAGAGATTTCCCCAGGCAGGG + Intronic
1130953019 15:88606728-88606750 TTCCAGGATTTCCCCAGACGGGG - Intergenic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133354500 16:5126177-5126199 TTCACAGATTACACCTGAGAGGG - Intergenic
1133727234 16:8549024-8549046 TACAAAGATTTAGCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134327130 16:13217372-13217394 TAAACAGATTTCCAAAGACACGG - Intronic
1135252220 16:20910326-20910348 TTCAAAGATTTCCTGAGAGAAGG - Intronic
1137549127 16:49424818-49424840 TGCACACATTTAGCCAGACAAGG - Intergenic
1140510192 16:75502005-75502027 TTCACAGACATCCTCAGCCACGG + Intergenic
1141412604 16:83845616-83845638 CTCAGGGATTACCCCAGACAAGG - Intergenic
1145755217 17:27385300-27385322 TTCACAGATTTCCCTGCACATGG + Intergenic
1146523914 17:33549709-33549731 TTCACAGATTTCCCTAAAGGAGG - Intronic
1148442579 17:47719427-47719449 TTTACAGATTCACACAGACAGGG - Intergenic
1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG + Exonic
1153598350 18:6752638-6752660 TTCACAGCATTCCTTAGACATGG - Intronic
1154026505 18:10712255-10712277 TTCACAGACTTGCCCATGCAGGG + Intronic
1157638604 18:49188385-49188407 GTCACAGACTGCCCCTGACAAGG - Intronic
1159060866 18:63512593-63512615 TCCACAGACTGCCACAGACATGG + Intergenic
1160144959 18:76356248-76356270 TGCAAAGCTCTCCCCAGACACGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161590586 19:5127545-5127567 TTCACTGCTGTCTCCAGACAGGG + Intronic
1166287973 19:41844187-41844209 TTCACAGAAATACCCAGAGAAGG + Exonic
1166636321 19:44454747-44454769 TTCTCAGTTTTCCACACACAAGG + Intergenic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
925131315 2:1496051-1496073 GTCACAGATGACCCGAGACAGGG - Exonic
925435146 2:3830537-3830559 TTCACAAATTTCCCAAGAGCTGG - Intronic
926608292 2:14919456-14919478 TTCAGAAATTGCCCCAGTCATGG - Intergenic
926701817 2:15809143-15809165 TTGACAGAATTCCTCAGGCAAGG + Intergenic
927897768 2:26795545-26795567 TTAAAAGATTTCCAGAGACATGG + Intronic
930253973 2:49067641-49067663 TTTAGAGTTTTCCCAAGACATGG - Intronic
931939586 2:67237539-67237561 TTGACACATGTCCCCAGACAGGG + Intergenic
932099562 2:68885411-68885433 TCCACATTTTTCCCCATACATGG - Intergenic
932530434 2:72524419-72524441 TTCACAGTGTTCCCATGACAAGG + Intronic
936009230 2:108914721-108914743 TTCACGGATTTCTCCAGAACTGG - Intronic
936809809 2:116384408-116384430 ATCAGAGATTTTCCCAAACAGGG - Intergenic
937084359 2:119160760-119160782 TTCACTGGTTTCCTCAGACTTGG + Intergenic
939557396 2:143692415-143692437 TTCACCCAGTTCCCCAGAAAAGG + Intronic
942051626 2:172146154-172146176 TTCACAGGTGTTTCCAGACATGG + Intergenic
942093150 2:172513549-172513571 TTCACAGCGATCCCCACACAGGG - Intergenic
942978077 2:182043505-182043527 TCCACATATATGCCCAGACATGG + Intronic
943165759 2:184323674-184323696 CTAACAGAATTCCACAGACAGGG + Intergenic
943454700 2:188090870-188090892 TTCTAAAATTTCCCCAGCCAGGG + Intergenic
944131018 2:196347505-196347527 GTCACAGATTTCACCAGGCCAGG - Intronic
946429565 2:219617815-219617837 TACACAATTTTCCCCAGAAAAGG + Intergenic
947795534 2:232891739-232891761 TTCACAGACTTGGCCACACAAGG - Intronic
947847968 2:233260866-233260888 GGCAAAGATTTCCCCAGACAAGG - Intronic
948298478 2:236883695-236883717 TCCCCAGAATTACCCAGACAGGG - Intergenic
1171158046 20:22894822-22894844 TTCACAGAAATCCCCAGCCCAGG + Intergenic
1172248667 20:33463606-33463628 TTCAAAGATTTTCCCTGACTTGG - Intergenic
1172376496 20:34445602-34445624 CACACAGAATACCCCAGACAAGG - Intronic
1173501723 20:43558851-43558873 TTCAGAGAGTCCCCCAGGCAGGG + Intronic
1178473508 21:32916699-32916721 TTCACAGTCCTCCCCAGTCATGG - Intergenic
1180117665 21:45721739-45721761 TTCACAGAGGTCCATAGACAGGG + Intronic
1180189830 21:46157590-46157612 CACACAGAGTTCCCCAGCCAGGG + Intergenic
1182306559 22:29373328-29373350 TTCACATATTTCTTCTGACAAGG + Intronic
1182523905 22:30903592-30903614 TTCACTCCTTTCACCAGACATGG + Intronic
1183357928 22:37369384-37369406 TTCCCAGACCTACCCAGACACGG + Exonic
1184119997 22:42443992-42444014 TTCACCTATCTCCCCAGGCATGG + Intergenic
952499700 3:33949239-33949261 TTCTCAGATATCCCCAGGTAAGG - Intergenic
953082135 3:39630776-39630798 TTAGCATATTTCCCGAGACAGGG + Intergenic
953197452 3:40747631-40747653 TTCTCAGATTTGCACAGACCTGG + Intergenic
954185078 3:48910761-48910783 TTCACAAATTTGGCCAGGCATGG - Intergenic
957001658 3:74893510-74893532 TTCACAGGTGTGCACAGACATGG + Intergenic
957258912 3:77875201-77875223 GGCACAGATTTCCTCAAACATGG + Intergenic
957315469 3:78570388-78570410 TTCACAGCTTTCCTAGGACAAGG + Intergenic
958128621 3:89389165-89389187 TACACTGATTTCCCCAAACCTGG - Intronic
958923052 3:100127564-100127586 TGCACAAAATTCCCCAGTCAGGG + Intronic
961554659 3:127689741-127689763 TTCACAGCTTTCCAAGGACAGGG + Exonic
964035161 3:152187044-152187066 TTTACAGATTTACCAAGTCATGG - Intergenic
965051798 3:163660105-163660127 TTCAAAGATTTTGCCAGAGATGG + Intergenic
967290231 3:187912685-187912707 TTCTCAAATTTCCCCAGCGACGG - Intergenic
967876010 3:194268864-194268886 TTAACAGCTTTACCCAAACAGGG + Intergenic
968657980 4:1786842-1786864 TTCCCAGATTCCCCCAGAGCTGG + Intergenic
969087273 4:4665839-4665861 GACACAGACATCCCCAGACATGG + Intergenic
969116822 4:4875476-4875498 TTCACAAATCTACCCAGAGAAGG + Intergenic
969244905 4:5925680-5925702 GTCACAGAAATGCCCAGACATGG + Intronic
969751774 4:9116772-9116794 TTCACAGATTACACCTGAGAGGG + Intergenic
970755661 4:19422759-19422781 TTCTCAGATTTCCCTAGAATTGG - Intergenic
971958964 4:33459611-33459633 TTCACATATTTGCCCAGCCTTGG + Intergenic
972824094 4:42736642-42736664 TGCAGAGATTTTCCCAGACATGG + Intergenic
974358621 4:60845921-60845943 ATCAGTGATTTTCCCAGACATGG + Intergenic
975770480 4:77716041-77716063 TTCACACAGTTCTCCAAACATGG + Exonic
977473008 4:97465832-97465854 TCCACAGATTTCACCAACCATGG - Intronic
977710719 4:100121158-100121180 TTTACAGATTCCCACAGTCAAGG + Intergenic
981340212 4:143613374-143613396 TGCATAGGTTTCCCCAGAGAAGG - Intronic
985490687 5:176801-176823 TTCACAGCCTTCCTCAAACAGGG + Intronic
986470080 5:8064878-8064900 TTCACAGAATTCTCCACACGGGG + Intergenic
986608865 5:9547218-9547240 TTCACACATTTCCTCATGCAGGG - Intergenic
987049703 5:14139223-14139245 TCCACACCATTCCCCAGACATGG + Intergenic
987120909 5:14765531-14765553 GTAATGGATTTCCCCAGACAAGG - Intronic
987186076 5:15420311-15420333 TCCACAGATTTGCTCAGACCTGG - Intergenic
990730467 5:58803262-58803284 TTAACAGCTTTTCCCAGAAATGG - Intronic
991094518 5:62725389-62725411 TTTAGAGATTTCCACAGTCAAGG + Intergenic
992541454 5:77769025-77769047 ATCACAGTTTTCCCAACACAAGG - Intronic
993015392 5:82530053-82530075 TTCACAATTTTGCCCAGACCAGG - Intergenic
993041528 5:82820174-82820196 TTCACAGATTTCCTGAGTTATGG + Intergenic
993379261 5:87187212-87187234 TTAACAGATTTCCCAAGCCTTGG + Intergenic
993805560 5:92404183-92404205 TTCTGAGATTTGCCCAAACATGG + Intergenic
994051546 5:95367607-95367629 TTCACAAATTTTCCCAGGCATGG + Intergenic
997245352 5:132343520-132343542 TTCACAGTTTTCCCAAGCAAAGG - Intronic
997946841 5:138210233-138210255 TTCACAGTTTTGGCCAGGCACGG + Intronic
998377125 5:141698554-141698576 TTCCCAGATTTCCCCAGCCTGGG + Intergenic
998737831 5:145163023-145163045 ATCACAGATTCCCCAAAACATGG - Intergenic
1002532069 5:179853261-179853283 CAAACAGAGTTCCCCAGACACGG - Intronic
1003213288 6:4087227-4087249 CTCTCAGTTTTCCCCAGAAATGG + Intronic
1004373707 6:15074280-15074302 TGCACAGACTTCCCGAAACAGGG + Intergenic
1007409544 6:41653894-41653916 TTCACAGTGTTCCCCAGCCCTGG - Exonic
1008075304 6:47139425-47139447 TTCACAGCTATCCCAAGAGAGGG + Intergenic
1008359434 6:50598102-50598124 TTCACAGAGTTGCCCAGCCTGGG + Intergenic
1011690906 6:89867986-89868008 TTGACATCTTTGCCCAGACATGG + Exonic
1013169835 6:107626806-107626828 CTCACATGTTTCCCCAGGCAGGG + Intronic
1014593720 6:123306284-123306306 CCCAAACATTTCCCCAGACATGG + Intronic
1015407483 6:132854152-132854174 TTCAGATATTTGACCAGACACGG - Intergenic
1016315519 6:142781759-142781781 TTAAATAATTTCCCCAGACAGGG + Intronic
1017875705 6:158522663-158522685 TGTACAGCTTTCCCCAGCCAGGG - Intergenic
1019887381 7:3917426-3917448 GTGACAGATTCCCCAAGACACGG + Intronic
1021327420 7:19291722-19291744 TTCACAGAATTCTCTAGACCAGG - Intergenic
1023183235 7:37507467-37507489 TTCACATTTTTGCCCAGACATGG - Intergenic
1029058355 7:97770832-97770854 GTCCCAGAGTTACCCAGACAAGG + Intergenic
1029119534 7:98257818-98257840 GTCACTGATTTCCCCAGTGATGG - Intronic
1033211026 7:139460328-139460350 GTCACAGATTACCACAGAAAGGG + Intronic
1033897598 7:146093922-146093944 ATTATGGATTTCCCCAGACAGGG - Intergenic
1036854560 8:12230949-12230971 TTCACAGATTACACCTGAGAGGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1040115110 8:43608538-43608560 TTCACAGATTCCACAAGAAAAGG - Intergenic
1040554794 8:48469110-48469132 TTCCCAGACTTTCCCAGAGAAGG + Intergenic
1040923495 8:52650887-52650909 GACACTGATTTCCTCAGACAAGG - Intronic
1043180770 8:77083826-77083848 TTCACAGGTTTCCACATAAATGG - Intergenic
1044305672 8:90638018-90638040 TGGATAGATTTCCCCAGAGAAGG - Intronic
1045135756 8:99215869-99215891 TTCCCAGACTTCACCAGTCAAGG + Intronic
1045194054 8:99912077-99912099 TTCACAGATATGCCCAGAAAGGG + Intergenic
1045974787 8:108120224-108120246 TTCACACACTTCTCCACACATGG - Intergenic
1046766355 8:118074238-118074260 TTCAGAGGTTGCTCCAGACACGG + Intronic
1047870379 8:129075711-129075733 TTCACAGATTTCCAGGGCCAGGG - Intergenic
1047875895 8:129137441-129137463 TTCCCCGACTTCCCCAGAGAGGG + Intergenic
1048801161 8:138194888-138194910 TGCACAGATGGCCTCAGACATGG - Intronic
1050262874 9:3859708-3859730 TTCAGAGATTTCACTGGACATGG + Intronic
1051341968 9:16120383-16120405 TTGGCATATTTCCCCAGACATGG - Intergenic
1052018453 9:23497795-23497817 TTCACAGATTTCCAGCTACATGG + Intergenic
1052350196 9:27450638-27450660 TTCACAGATTCCCCTTCACATGG - Intronic
1054146760 9:61567775-61567797 TTCACAGATTATCACAAACAAGG - Intergenic
1056670154 9:88620638-88620660 ATCACAGCTTTCCTCAGCCAAGG - Intergenic
1060273953 9:122168115-122168137 TTCACAGGTTGCAGCAGACAGGG + Intronic
1061124442 9:128665339-128665361 TTCACAGATTTGGCCAGGCACGG - Intergenic
1061481207 9:130898537-130898559 GTCACAGAGGTCCTCAGACAAGG - Intergenic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1186128932 X:6445460-6445482 TTTAGAGATTTCCCTGGACATGG - Intergenic
1188741175 X:33784541-33784563 TACTCAGATTTTCCCTGACATGG - Intergenic
1194003172 X:88457291-88457313 TTCACAGATTTCCACAACAATGG - Intergenic
1197890812 X:131268573-131268595 TTCAGGGATTTCCCCAGAATGGG + Intergenic
1200968050 Y:9119369-9119391 TTCACAGTGTTCCTCAGACAAGG + Intergenic
1201572130 Y:15425832-15425854 TTCACAGAATTGCCCTGAAAGGG + Intergenic
1201957866 Y:19646056-19646078 TTCCCAAATATCCCCATACATGG - Intergenic
1202142696 Y:21744719-21744741 TTCACAGTGTTCCTCAGACAAGG - Intergenic
1202144162 Y:21760899-21760921 TTCACAGTGTTCCTCAGACAAGG + Intergenic